ID: 1161756423

View in Genome Browser
Species Human (GRCh38)
Location 19:6137447-6137469
Sequence TGGCTGCAGCAGAGTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1308
Summary {0: 2, 1: 16, 2: 63, 3: 242, 4: 985}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161756413_1161756423 28 Left 1161756413 19:6137396-6137418 CCAAGGAAGGACTGCACCTGGTG 0: 1
1: 0
2: 2
3: 25
4: 228
Right 1161756423 19:6137447-6137469 TGGCTGCAGCAGAGTGAGGAGGG 0: 2
1: 16
2: 63
3: 242
4: 985
1161756415_1161756423 12 Left 1161756415 19:6137412-6137434 CCTGGTGAGTTGGAAGAACAGTG 0: 1
1: 1
2: 6
3: 29
4: 201
Right 1161756423 19:6137447-6137469 TGGCTGCAGCAGAGTGAGGAGGG 0: 2
1: 16
2: 63
3: 242
4: 985
1161756412_1161756423 29 Left 1161756412 19:6137395-6137417 CCCAAGGAAGGACTGCACCTGGT 0: 1
1: 0
2: 1
3: 13
4: 161
Right 1161756423 19:6137447-6137469 TGGCTGCAGCAGAGTGAGGAGGG 0: 2
1: 16
2: 63
3: 242
4: 985
1161756410_1161756423 30 Left 1161756410 19:6137394-6137416 CCCCAAGGAAGGACTGCACCTGG 0: 1
1: 0
2: 1
3: 26
4: 379
Right 1161756423 19:6137447-6137469 TGGCTGCAGCAGAGTGAGGAGGG 0: 2
1: 16
2: 63
3: 242
4: 985

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161756423 Original CRISPR TGGCTGCAGCAGAGTGAGGA GGG Intronic
900005142 1:40372-40394 TGGCTGCGGCAGAGGGAGTCAGG - Intergenic
900028619 1:353997-354019 TGGCTGCAGGCCATTGAGGAAGG - Intergenic
900270936 1:1788310-1788332 TGGCTGCAGGAGGTGGAGGAGGG - Intronic
900306757 1:2013715-2013737 TGGCTTCATCAAAGTGAGTAGGG + Intergenic
900648921 1:3721673-3721695 GGGCTGCTGGAGAGTGAGGGCGG - Intronic
900728886 1:4238481-4238503 TTGCTGCCGCCAAGTGAGGAAGG - Intergenic
900949753 1:5851832-5851854 TGGCTGCAGCAGGAGGAAGAGGG - Intergenic
901010605 1:6199573-6199595 TGGCGGCAGCGGAGTTAGAAAGG + Exonic
901237488 1:7675243-7675265 TGGCTGCAGGATAGTGAGTGGGG + Intronic
901354643 1:8634155-8634177 TAGTAGCAGCAGCGTGAGGATGG - Intronic
901753981 1:11429732-11429754 TGGCTGCAGTAGAGGGAGGGTGG - Intergenic
901862136 1:12081214-12081236 AGGCCCCAGCAGAGTGAGCAGGG + Intronic
902098994 1:13969558-13969580 TGGCTGAAGCAGAGTGACTAGGG - Intergenic
902109238 1:14064426-14064448 AGGCTGCAGCAGAGTGACCTGGG - Intergenic
902161489 1:14534138-14534160 TGTCTGCTGCAGATTCAGGATGG - Intergenic
902185856 1:14724846-14724868 TTGATGAACCAGAGTGAGGAAGG - Intronic
902250426 1:15151521-15151543 AGTCTGCAGCAGAGTGGGGCGGG + Intergenic
902715131 1:18267489-18267511 TGGCTGCTGTGGAGTGAGGGAGG - Intronic
902907076 1:19566279-19566301 TGCCTGTAGCAAAGTGAGCAAGG + Intergenic
902999281 1:20253272-20253294 TGGCAGAAGCAGAGTAAAGAGGG + Intergenic
903023935 1:20413652-20413674 CGGCTGCATCAGAGAGAGGCTGG - Intergenic
903024163 1:20415413-20415435 TGGCTGCAGCAGAGTGACCAAGG + Intergenic
903030758 1:20462692-20462714 TGGCTGCTGCACAATGGGGAGGG + Intergenic
903117830 1:21192678-21192700 TGGCAGCAGGAGAGTGAGGAAGG - Intergenic
903121439 1:21219139-21219161 TGGCTATAGCAGAATGAGGTCGG - Intronic
903290599 1:22311697-22311719 TGGTCGGAGCAGAGTGAGGGAGG + Intergenic
903293503 1:22329298-22329320 TGGCTGGAGTAGAGTGGGCAAGG - Intergenic
903296045 1:22343675-22343697 TGGCTGCAGCAGAGTGGGCAAGG + Intergenic
903320561 1:22540663-22540685 TGGCTGGAGCAGAGTGGGCATGG + Intergenic
903648193 1:24907219-24907241 GGGCTGCAGCGGGGTGAGGTGGG - Intronic
903655123 1:24944258-24944280 TGGCTGGAGCAGGGTGAGGGAGG - Intronic
903681821 1:25102556-25102578 TGGCTGGAGCAGAGTGAATGGGG - Intergenic
904421608 1:30398054-30398076 AGGCTGCAGCAGGATGAGGAGGG + Intergenic
904431617 1:30468168-30468190 TGGCAGAAGCAGAGCGTGGAAGG - Intergenic
904451688 1:30617027-30617049 TGGCTGGGGCAGAGTAAAGAGGG + Intergenic
904706981 1:32398582-32398604 TGTCTGGAGCAGAGTGACTAAGG - Intergenic
904876901 1:33662347-33662369 TGGCTGAAGCACAGGGAGCAAGG - Intronic
904914048 1:33956960-33956982 TGGCTGGAGCATGGTGAGGAAGG - Intronic
905034741 1:34910541-34910563 TGGCTGCCGCAGAGAAAGCAAGG - Intronic
905106528 1:35566342-35566364 GTGTTGCAGCAGAGTGACGATGG + Exonic
905518929 1:38582592-38582614 TGGCTGTAGCACAGTGAGTGGGG - Intergenic
905521325 1:38602894-38602916 TGGCTGCAGTAGAATGAAGGAGG + Intergenic
906283253 1:44568277-44568299 TGGCTGGAGCAGAGTGAGGTGGG - Intronic
906545819 1:46618706-46618728 AGGCTGCAGGAGTGTGGGGAAGG + Intergenic
906613603 1:47220102-47220124 TGGCGGCAGCAGAATGTGAACGG - Exonic
906657062 1:47556036-47556058 AGGCTTCAGCAGAGTCAGGGCGG - Intergenic
906889064 1:49687290-49687312 TGGCTGTAGCAGAGATAGAAAGG + Intronic
907078244 1:51597145-51597167 TGGCTTAAGCACAGTGAGGAAGG + Intronic
907184311 1:52598120-52598142 TGGCTGGAGCAGAGTGAGCAAGG - Intergenic
907298980 1:53474039-53474061 TGGCTTCACCAGACTGACGATGG - Intergenic
907347624 1:53795964-53795986 TGGCTGGAGCAGAGTGAGTGAGG - Intronic
907476983 1:54712465-54712487 GGCCTGCAGGAGACTGAGGAAGG + Intronic
907477470 1:54715272-54715294 GGGCTGAAGCAGAGTGAGGAAGG - Intronic
907534740 1:55140720-55140742 GGGCAGCAGCAGAGTGAGGTAGG + Intronic
907550865 1:55303668-55303690 GGGCTGTTGCAGACTGAGGAAGG + Intergenic
907561845 1:55398269-55398291 TGGCTGGAGCAGAATGAGTGAGG + Intergenic
907615750 1:55924556-55924578 TGGCTGGAGCAGAATGAACATGG + Intergenic
907869157 1:58427216-58427238 GAGATGCAGTAGAGTGAGGAGGG + Intronic
908381691 1:63602957-63602979 TGGTTCCAGCAGAGGGAGTAGGG + Intronic
908470845 1:64442338-64442360 TGGCTGCAGCAGAGGACTGATGG + Intergenic
908641396 1:66228025-66228047 TGGCTGGAGCAAAGTGAGTGAGG - Intronic
908647053 1:66289545-66289567 TGGCTGGAACAGAGTGAGCTAGG + Intronic
908701802 1:66910388-66910410 TGGCTGAAGCAGAGTAAACAAGG - Intronic
909809817 1:79918745-79918767 TGGTTTCAGCAGAGTGCAGAGGG + Intergenic
910002173 1:82354242-82354264 TGGCTATAGCAGAGTGGGCAAGG - Intergenic
910104397 1:83615680-83615702 TGGCTGGGGCACAGTGAGTAAGG + Intergenic
910669298 1:89757096-89757118 TGGCTGCAGTGGGGTGAGGATGG - Intronic
911099000 1:94079107-94079129 AGGCTGCAGTAGAGAGGGGAGGG + Intronic
911164028 1:94709285-94709307 CGGCTGCAGCTGAGTGAGCCAGG - Intergenic
911240861 1:95464513-95464535 TGGCGGCAGCGGGGTGGGGATGG - Intergenic
911279079 1:95900668-95900690 TGCCTGCAGCAGGGTGGGGAAGG + Intergenic
911297854 1:96139336-96139358 TGGCTGGAGAAGAATGAAGAGGG + Intergenic
911878728 1:103204870-103204892 TGGATGGAGCAGAATGAGGGAGG - Intergenic
912672989 1:111648750-111648772 TGGTCTCAGCAGATTGAGGAGGG - Intronic
912777869 1:112517377-112517399 AGGCTGCAGGTGAGTAAGGAAGG + Exonic
912797551 1:112701991-112702013 TGACTGGAAGAGAGTGAGGATGG - Intronic
913007808 1:114651959-114651981 GAGCTTCAGCAGAATGAGGAGGG + Intronic
913596055 1:120378333-120378355 TGGCGGCAGCAAAGAGAGGTGGG + Intergenic
914091224 1:144500643-144500665 TGGCGGCAGCAAAGAGAGGTGGG - Intergenic
914307380 1:146433552-146433574 TGGCGGCAGCAAAGAGAGGTGGG + Intergenic
914594727 1:149139579-149139601 TGGCGGCAGCAAAGAGAGGTGGG - Intergenic
914667763 1:149845598-149845620 TGGCTGAAGCACAGTGACCAAGG + Intronic
914697230 1:150095741-150095763 TGGCTGGAGCATAGTGAATAAGG + Intronic
914922617 1:151857810-151857832 TGGCTGGAGGAGAGTGAAGGAGG + Intergenic
914976504 1:152368648-152368670 TGGCTAGAGCAGAGAGAGTAAGG - Intergenic
915349045 1:155213217-155213239 GGGCTGGAGCAGAGAGAGAAGGG - Exonic
915352232 1:155233844-155233866 GGGCTGGAGCAGAGAGAGAAGGG - Intergenic
916076117 1:161200850-161200872 TGGCTGCAGCAGTGTGTGTGGGG + Intronic
916209750 1:162350569-162350591 TGTCTGCAGCTGGGGGAGGAGGG - Intronic
917048331 1:170888972-170888994 AGGCTGTAGCATAGTGAGGATGG - Intergenic
917127112 1:171696760-171696782 TGGCTGCAGCACAGCAAGGAAGG + Intergenic
917137236 1:171799520-171799542 TGGCTACAGCTGAGTGGGGATGG + Intronic
917180391 1:172290466-172290488 TGGCTGGAGCAGAATGAGGATGG + Intronic
917265961 1:173221150-173221172 TGGCTACAGCAGAGTAAAGCAGG + Intergenic
917432823 1:174988208-174988230 TGCCTGTAGTAGACTGAGGAAGG - Intronic
918237207 1:182592201-182592223 AGGCTGGAGCAGAGTGAGGGAGG + Intergenic
918547012 1:185696517-185696539 TAGCTGCAGCAGAAGGAGGACGG - Intergenic
919673860 1:200362165-200362187 TGGCTGAAACAGAGTGAGTGAGG - Intergenic
919728150 1:200897004-200897026 TGGCTGCAGCAGGGGTGGGAGGG - Intronic
919860037 1:201733794-201733816 TGGCTGAAGCAGAGTTAGCAAGG + Intronic
920010318 1:202862162-202862184 TGGCCAAAGCAGACTGAGGAGGG + Intergenic
920055296 1:203186626-203186648 TGGCTGCAGCAGAGCAGGGCAGG + Exonic
920076203 1:203338778-203338800 TGGCTGCAGCACAGAGAGAAAGG - Intergenic
920338286 1:205259333-205259355 TGCCTGCCTCAGAGGGAGGAGGG + Intronic
920460603 1:206136673-206136695 TTGCTGGTGCAGAGTGGGGATGG + Intergenic
921077025 1:211707906-211707928 TGGCTGTGGCAGGGTGGGGAAGG - Intergenic
921164857 1:212499648-212499670 TGGCTGGAGCAGAGTGAGCAGGG + Intergenic
921190532 1:212704200-212704222 TGGCTGGAGTGGAGTGAGGAAGG + Intergenic
921221478 1:212977010-212977032 TGGCCGCAACAAGGTGAGGAGGG + Intronic
921353278 1:214259844-214259866 TGGCTAGAGCTGAGTGAGCAAGG - Intergenic
921562753 1:216677945-216677967 TTGCAGCATCAGAATGAGGAAGG - Intronic
921670147 1:217916073-217916095 TGGCCAGAGCAGAGTGAGAAAGG - Intergenic
921740608 1:218680575-218680597 TGGCAGAAGCACAGTGAGCATGG + Intergenic
921819750 1:219603956-219603978 TGACTGTAGCAGAATGAGAAGGG + Intergenic
922348709 1:224718386-224718408 TGGCTGGAGTGGAGTGAGCAGGG + Intronic
922496028 1:226058641-226058663 AGTCTGCAGCACAGTGCGGAGGG + Intergenic
922627113 1:227059919-227059941 TGGCTGAAGTTGAGTCAGGATGG - Intronic
922726268 1:227924447-227924469 TGGCTGCAGGACAGTGAAGGGGG - Intronic
922927330 1:229360835-229360857 TGGCGGGAGCAGGGTGGGGAGGG + Intergenic
923660719 1:235954824-235954846 TGGCTGCAACAGTGAGAGCATGG - Intergenic
924946972 1:248853104-248853126 TGGCTGCAGTCGAGTGGGAAGGG - Intronic
924956222 1:248930005-248930027 TGGCTGCAGGCCATTGAGGAAGG + Intergenic
1062922445 10:1290333-1290355 CGCCTGCAGCAGAGTGGAGAAGG + Intronic
1063819749 10:9820281-9820303 TGGCTGCAGCAGGGTGCTGGTGG - Intergenic
1064327182 10:14362469-14362491 TGGCTGCTGCAGAGAGATGGGGG - Intronic
1064392968 10:14957468-14957490 TGGCTGCAGCAGAATGATCCGGG + Intergenic
1065068695 10:22000486-22000508 TGGCTGGAGCAGAGTGATCAAGG - Intronic
1065797839 10:29323414-29323436 TGGCTTCCTGAGAGTGAGGAGGG - Intergenic
1066139554 10:32489718-32489740 AGGCTGGTGCAGAGTGAGCATGG + Intronic
1066287081 10:33978813-33978835 TCTCTGCAGGAGATTGAGGAAGG - Intergenic
1067064722 10:43097297-43097319 AGGCTGCAGAAGAGTGGGTAGGG - Intronic
1067271649 10:44796756-44796778 TGGCTGAAGCAAAGTGTGCAAGG - Intergenic
1067666483 10:48283852-48283874 TGGCTGAGGTAGAGTGAGGAAGG - Intergenic
1068369755 10:56096726-56096748 AGGCAGCAACAGAGTGAGGGAGG + Intergenic
1068492633 10:57743162-57743184 TGGCTGGAACAGAGTGAGCAAGG - Intergenic
1069160202 10:65083755-65083777 GGGCTGTAGCAGAGTGAGCAGGG + Intergenic
1069333258 10:67318588-67318610 TAGCTGGAGCAGAGTGAACATGG - Intronic
1069643762 10:69975689-69975711 TGGCTTTTGAAGAGTGAGGATGG + Intergenic
1069720117 10:70544494-70544516 AGGCAGGAGCTGAGTGAGGAGGG + Intronic
1069936250 10:71919252-71919274 TGCCTGCAGCAGGGTGGGGAAGG + Intergenic
1070311172 10:75275278-75275300 ATGCTGCAGCAGAGTGACAAAGG - Intergenic
1070657649 10:78282346-78282368 TGGCTCCAGCAGAGGCAGGGAGG + Intergenic
1070873964 10:79783946-79783968 TGGCTGGAGCAGAGTGAGTGAGG - Intergenic
1071571609 10:86700344-86700366 TGGTTGCAGCAGGGTGTGGAAGG - Intronic
1071572636 10:86706431-86706453 TGGCTGCAGCAGAGGCAGGCTGG - Intronic
1071640896 10:87306085-87306107 TGGCTGGAGCAGAGTGAGTGAGG - Intergenic
1071654340 10:87431851-87431873 TGGCTGGAGCAGAGTGAGTGAGG + Intergenic
1072317356 10:94215676-94215698 AGCCAGCAGCAGAGAGAGGATGG + Intronic
1072517722 10:96202307-96202329 TGGCAACAGCAGAGTGGGGGAGG + Intronic
1072716204 10:97754207-97754229 TGGCTGCTGCAGGGGTAGGAAGG - Intronic
1072787829 10:98296249-98296271 TCCCTGCAGGAGAGGGAGGAAGG + Intergenic
1073081959 10:100865960-100865982 TGGGTGAAGAAGTGTGAGGAAGG + Intergenic
1073172025 10:101518663-101518685 TGGCTGGAACAGAGTGAGCAAGG - Intronic
1073261191 10:102191738-102191760 TGGCTGCTTCATAATGAGGAGGG - Intergenic
1073485995 10:103819559-103819581 TGGGGGCAGAAGAGGGAGGAGGG + Intronic
1073682114 10:105716078-105716100 TGGCTGGAGCCCAGTGAAGAGGG - Intergenic
1074056216 10:109924485-109924507 CAGCTGAAGAAGAGTGAGGAAGG - Intergenic
1074210001 10:111322524-111322546 TGGCAGCAGCAGTAGGAGGATGG + Intergenic
1074436961 10:113442397-113442419 TGGCTGGGGGAGAGGGAGGAGGG - Intergenic
1075085677 10:119412877-119412899 TCGCTGCAGCTGGGTGAGCAGGG + Intronic
1075413684 10:122247417-122247439 TGGTGACAGCAGAGTGGGGAAGG - Intronic
1075530336 10:123223673-123223695 AGGGTGCAGCTGAGAGAGGAAGG - Intergenic
1076329884 10:129656381-129656403 TGCCTCCTGCAGGGTGAGGAGGG + Intronic
1076623429 10:131807541-131807563 TGGCTGCAGAAAGGTGAGGCTGG - Intergenic
1076648760 10:131972711-131972733 TGGCTGCAGCCTAGAGAGGAGGG - Intronic
1076787793 10:132759706-132759728 GGGCTCCTGCAGGGTGAGGAGGG - Intronic
1076839114 10:133036909-133036931 AGGCTGCACCAGAGTCAGGCTGG - Intergenic
1076851552 10:133095835-133095857 TGGCTCCGGCTGAGTGAGGCGGG - Intronic
1076962026 10:133770900-133770922 TGGCTGCAGGCCATTGAGGAAGG + Intergenic
1077581597 11:3420818-3420840 TGGCTGGAGTGGAGTGAGCAGGG - Intergenic
1078087247 11:8241514-8241536 TGGCTGGAGCACAGTGTGGGAGG - Intronic
1078315317 11:10289366-10289388 TGGCTGCAGCACACCCAGGAGGG + Intronic
1078357948 11:10646881-10646903 TAGCTGAAGGAGAATGAGGAAGG - Intronic
1078357958 11:10646951-10646973 TGACTGAAGGAGAATGAGGAAGG + Intronic
1078369776 11:10735283-10735305 TGGTAGCAGCAGAGTCAGAATGG - Intergenic
1078450621 11:11437992-11438014 TGACTACAGCCGAGAGAGGAGGG - Intronic
1078567185 11:12426375-12426397 TGGCTGGAGCATGGTGAGTAAGG + Intronic
1078860681 11:15243553-15243575 AGGCTGCTGCACACTGAGGAGGG + Intronic
1078865249 11:15291255-15291277 TGGCAGCAGGAGGGTGAGCAGGG + Intergenic
1078885546 11:15496405-15496427 GTGGTGCAGTAGAGTGAGGAAGG - Intergenic
1079003221 11:16774745-16774767 AGGTTGGAGCAGGGTGAGGAAGG - Intergenic
1079078767 11:17399388-17399410 TGGCTGCAGCATAGTGTGTGGGG - Intronic
1079445681 11:20554441-20554463 TGGCTGAAGCAAAGGAAGGAAGG - Intergenic
1079465911 11:20730735-20730757 TGAGAGCAGCAGACTGAGGATGG + Intronic
1080305242 11:30828131-30828153 TGGCTGGAGCAGAGTGAGTGAGG - Intergenic
1080635646 11:34121030-34121052 GGGCTGAAGCAGGGTGAGTAGGG + Intronic
1081468328 11:43345898-43345920 TGGCTGCAGCAGAGTGATCAAGG - Intergenic
1081528084 11:43940721-43940743 TGGCTAAAGCAGAGTGAGAGAGG - Intronic
1081552754 11:44129403-44129425 TGGCTGGAGCAGAGTAAAGAAGG - Intronic
1081659551 11:44879638-44879660 TGGCTGGAACAGGGTGAGGAGGG + Intronic
1082785817 11:57315857-57315879 TCGATGCAGGAGAGAGAGGAGGG - Intronic
1082896675 11:58199014-58199036 TGGCTAGAGCAGAGTGAGTGAGG - Intergenic
1082901280 11:58255974-58255996 TGTCTGCAGCAGTGAGAGGGTGG + Intergenic
1083001641 11:59297720-59297742 TGCCTGCAGCAGAGTGGGAAAGG + Intergenic
1083150710 11:60790294-60790316 TGGCTGCAGGACGGGGAGGAAGG - Exonic
1083275055 11:61592188-61592210 GGGCTGGAGCAGAGGGAGGATGG + Intergenic
1083318806 11:61832684-61832706 TTTCTGCAGCAGAGAGAGGCAGG - Intronic
1083340749 11:61957019-61957041 GGGCTGCCGCAGAGTGGGAAGGG + Intronic
1083853900 11:65382727-65382749 TGGCTGCAGCAGAGAAAGCAAGG - Intronic
1083944233 11:65915303-65915325 TGGCTCCAGCTGGGTGAGCATGG + Intergenic
1084098378 11:66928447-66928469 TGGCAGCAGCAGAATGACCATGG + Intronic
1084176082 11:67423062-67423084 GGGCTGCAGCACAGAGAAGAGGG - Intronic
1084238510 11:67803641-67803663 TGGCTGGAGTGGAGTGAGCAGGG - Intergenic
1084468148 11:69339350-69339372 TGGCTGCTGCAGAGTTAGGGAGG - Intronic
1084833907 11:71789192-71789214 TGGCTGGAGTGGAGTGAGCAGGG + Intronic
1084925804 11:72510515-72510537 TGGGTGCAGCATGGTGGGGATGG + Intergenic
1085299466 11:75449871-75449893 TCCCTGCAGGTGAGTGAGGAGGG - Exonic
1085446815 11:76606298-76606320 TTGCAGCAGAAGAGTGAGAAGGG - Intergenic
1085448342 11:76615904-76615926 GGGCTGAAGCAGGGTGGGGATGG + Intergenic
1085506701 11:77064939-77064961 ATGCTGCAGCACAGGGAGGAAGG + Intergenic
1085600070 11:77847629-77847651 TGGCTCCATCAGAGTGAAGTTGG + Intronic
1085858977 11:80210214-80210236 TGGCTGCAGCAGCCTGCTGACGG - Intergenic
1085862107 11:80246256-80246278 TGGCTGGAGCAGGATGAGCAGGG + Intergenic
1085929124 11:81059473-81059495 TGGCTGGAGCAGAGGGAGGTAGG - Intergenic
1086980743 11:93195699-93195721 TGGCTGAAGCAGAGTGATGGAGG - Intronic
1087227163 11:95614219-95614241 TGCCTGTGGCAGAGTGGGGAAGG + Intergenic
1087311913 11:96554519-96554541 TGGCTGAAGAATAGTGAGCATGG + Intergenic
1087425646 11:97982341-97982363 TGGATGCTGGAGAGTGAGTAAGG - Intergenic
1088279854 11:108124742-108124764 TGGCAAAAGCAGAGTGAGCACGG - Intronic
1088626140 11:111732027-111732049 AGGCTCCAGCAGGGTGGGGAAGG + Intronic
1089454487 11:118618117-118618139 TGGCTGGAGAAGAGTCGGGAAGG - Intronic
1089572655 11:119420553-119420575 AGGCTCAAGCAGAGTGGGGAGGG - Intronic
1089577850 11:119459468-119459490 GGGCTGCAGCACTGTGGGGAGGG + Intergenic
1089611656 11:119672720-119672742 TGGCTGGAGCAGAGTGGGCAGGG - Intronic
1090359233 11:126161124-126161146 TGGCTGCAGTGAAGTGTGGAAGG - Intergenic
1090846819 11:130536454-130536476 GGGCTGGAGCGGAGTCAGGAGGG + Intergenic
1090937323 11:131354625-131354647 TGGCTGCTGCCAAGTGGGGAGGG + Intergenic
1091175620 11:133554872-133554894 TGGCTGCTGCAGTCTGAGGGAGG - Intergenic
1091206789 11:133827036-133827058 TGGCTGCAGCAGAGGGAGCAAGG - Intergenic
1091243048 11:134067334-134067356 GGGATGCAGCAGAGTGGGGTAGG - Intergenic
1091526996 12:1312843-1312865 TGGCTGCAGGAGAGACAGAAGGG - Intronic
1091705962 12:2693551-2693573 AGGCTGCTCCAGAGTGAGGAAGG - Intronic
1091938253 12:4450651-4450673 TGGCTGGAGCATAGTAAGGAGGG - Intergenic
1091968336 12:4764347-4764369 TGGCGGGAGCAGTGGGAGGAGGG - Intronic
1092090557 12:5800240-5800262 TGGCTGGGGCAGAGTGAGCACGG + Intronic
1092396998 12:8135455-8135477 TGGTTGCATCTGAGTGTGGAGGG + Intronic
1092409198 12:8241266-8241288 TGGCTGGAGTGGAGTGAGCAGGG - Intergenic
1092762240 12:11820651-11820673 TGGCTGGAGCAGAATGAAGGAGG + Intronic
1092836456 12:12493610-12493632 TGGCTGGAGCAGAGTGAGCATGG - Intronic
1093312632 12:17609178-17609200 TAGCTTAAGCAGACTGAGGAGGG + Intergenic
1093583033 12:20806156-20806178 CGGCTGCAGAAGAGACAGGAAGG + Intergenic
1094100213 12:26753549-26753571 TGCCTGAAGCAGGGTGGGGAAGG - Intronic
1094115924 12:26912708-26912730 TGATTGCAGCAAAGTGTGGAAGG - Intronic
1095349264 12:41189201-41189223 TTCCTGCTGCATAGTGAGGAAGG - Intronic
1095683959 12:45010990-45011012 TGGATGCATCAGAGGGAGCATGG + Intergenic
1095991706 12:48039238-48039260 TGGCTGAGGCAGAGTGGGCAGGG + Intergenic
1096117609 12:49064537-49064559 TGCCTGCAGAAGACTGAGGCAGG + Intergenic
1096178411 12:49538151-49538173 TGGCACCAGGAGAGCGAGGAAGG - Intergenic
1096291881 12:50350703-50350725 TGGCTTCATGAGAGTGAGAAGGG + Exonic
1096908235 12:54956264-54956286 TGGCAGCAGAAGAGACAGGAGGG - Intronic
1096979794 12:55721815-55721837 TTGCTGCAGCAGAGGCAGCAGGG - Exonic
1097626434 12:62007107-62007129 TGGCTGGAGCAGAAGGAGCATGG - Intronic
1097650547 12:62292553-62292575 TGTCTGCAGCAGTGGGTGGAGGG + Intronic
1097695061 12:62767617-62767639 AGTCTGGAGAAGAGTGAGGATGG + Intronic
1098158938 12:67629295-67629317 TGGCTGAAGCGAAGTGAGCAAGG + Intergenic
1098249158 12:68550842-68550864 TGGCTGGAGCACAGTGAGGAAGG - Intergenic
1098287167 12:68919009-68919031 TGGCTGGAGCCCAGTGAGCAAGG - Intronic
1098339235 12:69434649-69434671 TGGCTAGAGCAGAGGGAGGGAGG + Intergenic
1098445739 12:70564019-70564041 TGGCTGGAACAGAGTGAGCGAGG - Intronic
1098465757 12:70784074-70784096 TGGCTGCAGCTGAGGGCAGAGGG + Intronic
1098498544 12:71165065-71165087 TGGCTGCAGCAGCATGAGTAAGG - Intronic
1099016369 12:77348382-77348404 TGGCTGGAGCAGAGGGAAGGGGG + Intergenic
1099366675 12:81773506-81773528 TGGCTATAGCAGAGTGGTGAGGG + Intergenic
1099541034 12:83907907-83907929 TGGCTGGAGCAGAGTGAGGTGGG + Intergenic
1099607695 12:84826669-84826691 TGTCTGCAGTAGGGTTAGGAAGG + Intergenic
1100193049 12:92213349-92213371 TGACTGCAGTGGAGTGAGCAAGG + Intergenic
1100255144 12:92875787-92875809 TAGCTGTAGCATAGTGAGCAAGG - Intronic
1100442215 12:94627550-94627572 TGGCTGGGGCAGTGTGAGCAGGG - Intronic
1100702306 12:97161470-97161492 GGGCTGAAGCAGGGTGAGGAGGG + Intergenic
1101168560 12:102063905-102063927 TAGCTGAAGCAGAGTGAGCAAGG + Intergenic
1101285553 12:103308556-103308578 TGGAGGGAGCAGAATGAGGAAGG + Intronic
1101418308 12:104527878-104527900 TGGCAGCAGGAGAGAGAGTAAGG + Intronic
1101441026 12:104704360-104704382 AGGCTGCAGGTGAGGGAGGAAGG + Intronic
1101535555 12:105613147-105613169 AGGCAGCAGGAGAGAGAGGAAGG - Intergenic
1101709223 12:107249315-107249337 TGGCTGGAGCGGAATGAGGCAGG - Intergenic
1101714855 12:107301804-107301826 TGGATGCAGCAAAGTGAGCAAGG - Intergenic
1101930122 12:109006930-109006952 TGGCTGCAGAGGAGTCAGGGAGG + Intronic
1102119327 12:110428761-110428783 ATGCTGCAGCAGAGTGAGCAAGG - Intergenic
1102194375 12:111014182-111014204 TGCCTGCTGCAGAATGAAGATGG + Intergenic
1102247945 12:111367087-111367109 TGGCTGGAGCTGAGTGAACAAGG - Intronic
1102260240 12:111438881-111438903 TGGCTGGATCAGAGCGAGGGAGG + Intronic
1102330041 12:112021196-112021218 TGGCTGGAGCTGGGTGAGAAAGG - Intronic
1102469363 12:113150834-113150856 TGGCTGCAGAGGAGGGAGGGAGG - Intronic
1102504440 12:113374783-113374805 GAGCTGCAGCAGGCTGAGGAGGG - Exonic
1102764678 12:115422479-115422501 TGGCTGGAGCAGAGAAAGCAGGG - Intergenic
1102807463 12:115794536-115794558 TGGCTGGAGAAGAGTGACCAAGG + Intergenic
1103007954 12:117436769-117436791 TGGATGAGGCAGCGTGAGGAAGG - Intronic
1103158842 12:118710563-118710585 TGGGTGCAGCAGAGAGAGAAAGG - Intergenic
1103361022 12:120353713-120353735 TGGCTGGAGCAGAGGGAGGGAGG - Intronic
1103586407 12:121959473-121959495 TGGCCGCACCAGTGTGGGGATGG - Intronic
1103643280 12:122370216-122370238 TAGCTGAAGCAGAGTGAGAAAGG + Intronic
1103865424 12:124047989-124048011 TGGCTGGAGCATAGTGAGAGAGG - Intronic
1103932562 12:124458306-124458328 GGGCTGCAGCAGAGAGAGGAGGG + Intronic
1103995851 12:124829547-124829569 TGGCTGGAGCAGAGTGAGCGAGG - Intronic
1104002423 12:124868716-124868738 TGGCTGGAGCAGAGTGGGCAAGG - Intronic
1104121590 12:125805171-125805193 TGGCTGTAGAGGAGTGAGCAAGG + Intergenic
1104385790 12:128350583-128350605 TGGCTGGAGCAGAGTGAGTGTGG + Intronic
1104588115 12:130063618-130063640 TTGCTGCAGCCGTGTGAAGAAGG + Intergenic
1104642045 12:130473572-130473594 TAGATGGAGCAGAGTGAGGGAGG + Intronic
1104644484 12:130487085-130487107 TGGCAAAAGCACAGTGAGGAAGG - Intronic
1105665583 13:22552344-22552366 TGGCTGGAGCAGAGTGGGACAGG + Intergenic
1106370744 13:29130336-29130358 TGGCTTGAGCAGAGTGAGGAGGG - Intronic
1106657264 13:31759547-31759569 TGGCTCAAGCAGAGTGAACAGGG + Intronic
1107015683 13:35706405-35706427 AGGCTGCAGGAGAGAGAAGAGGG + Intergenic
1107200817 13:37714646-37714668 TGGCTGGAGCACAGAGAGCAAGG - Intronic
1107525943 13:41231357-41231379 TGCCTTCTGCAGATTGAGGAAGG - Intronic
1107798454 13:44079690-44079712 TGGCTGAAGCAGAGCGAGCAAGG + Intergenic
1107799200 13:44088298-44088320 TGGCTGAAGCAGAGCGAGCAAGG - Intergenic
1108224055 13:48269551-48269573 TGGCTGTAGAGGAGTGAGAAAGG - Exonic
1108621376 13:52187706-52187728 TGGCTGGAACACAGTGGGGAAGG - Intergenic
1108855664 13:54789751-54789773 TGGCTGCTTCACACTGAGGAGGG + Intergenic
1109242029 13:59901303-59901325 TGGCTGTGGCAGAGTGAAGGTGG - Intronic
1109272387 13:60268825-60268847 TGGCTGCAGAGTAGTGAGAAAGG + Intergenic
1109622350 13:64926019-64926041 TAGCTGCAGCAGAGAGGCGAGGG - Intergenic
1109915749 13:68983413-68983435 TGCCTGCAGCACAGTGAATAGGG + Intergenic
1110467141 13:75814916-75814938 TGGCTGGAGCAGAGGGAGTGGGG + Intronic
1110469441 13:75842265-75842287 GGGCTGGAACAGAGTGAGTAAGG - Intronic
1110583471 13:77159656-77159678 TGGCAGCAGGAGAGAGAGAAGGG - Intronic
1111156524 13:84334909-84334931 TGGTTGCAGGGGACTGAGGAAGG + Intergenic
1111162751 13:84417366-84417388 TAACTGGAGCTGAGTGAGGAAGG + Intergenic
1111716292 13:91883623-91883645 TAGCTGAAGCAGAGTGAGGAAGG + Intronic
1111934581 13:94546315-94546337 GGGCTTCAGCAGAGTCAGGAAGG - Intergenic
1112117698 13:96375030-96375052 TGGCTACAGCACAGTGAGTAGGG - Intronic
1112131398 13:96527762-96527784 TGGCTGGAGCAGAGGGAGGCAGG + Intronic
1112138507 13:96611784-96611806 TGGCTCAGGCAGAGTGAGCATGG + Intronic
1112202083 13:97286673-97286695 TGGCTGGAGCACAGTGTGGGGGG - Intronic
1112204799 13:97314139-97314161 TGGCTAGAGCAGAGTGAGTGAGG - Intronic
1112574922 13:100627175-100627197 TGGCTGGAGCACAGAGAGCAGGG + Intronic
1112725823 13:102303070-102303092 TGGGTGGAGCAGAGTGAGTCGGG - Intronic
1113281742 13:108796059-108796081 TGGCTGAAGCAGTGTCAGCAGGG + Intronic
1113337495 13:109391204-109391226 TGGCTTCAGCAGAGTAAAGTAGG - Intergenic
1113587591 13:111475953-111475975 GCTCTGCAGAAGAGTGAGGAGGG + Intergenic
1113666142 13:112143223-112143245 TGGGTGCAGATGAGTGAGGAGGG - Intergenic
1113884926 13:113653559-113653581 TGTCTGCAGCACAGGAAGGAAGG + Intronic
1114406784 14:22464184-22464206 TGGCTGAAAAAGAGTGAAGAGGG - Intergenic
1114846887 14:26333188-26333210 TGGCTGGAGCAGAGTGTGCAAGG - Intergenic
1114860725 14:26517228-26517250 TAGCAGCAGCAGAATGAGCAAGG - Intronic
1115427529 14:33277744-33277766 TTGCTGGAGCAGAATGAGAAAGG + Intronic
1115769192 14:36653315-36653337 TGGCTGCAGGGGGGAGAGGAAGG - Intergenic
1115787980 14:36847719-36847741 TGGCTGCAGCAGAGGGTGCCTGG + Intronic
1116770818 14:49125110-49125132 TGGCTGTAACAGAGGGAGGCTGG - Intergenic
1116986734 14:51227854-51227876 TGGATGGAGCAGAGTGAGGAAGG + Intergenic
1118142925 14:63104489-63104511 TGTCTGGAGCATAGTGAGTAAGG - Intergenic
1118589375 14:67389982-67390004 TGACTGAAGCTCAGTGAGGAAGG + Intronic
1118816303 14:69316667-69316689 TGGCTGGAGCAGAGCAAGTAAGG + Intronic
1119621053 14:76132070-76132092 TGGCTGTAGCAGAGTGCTGGGGG + Intergenic
1119674223 14:76541815-76541837 GGGCTGAAGCAAAGAGAGGAGGG + Intergenic
1119939924 14:78629418-78629440 TGGTTGAAGCAGAGTTAGGAGGG + Intronic
1120581378 14:86255017-86255039 TGGATGCAGGAGAGTGAGATAGG - Intergenic
1120703373 14:87723131-87723153 TGGCTGGAGAAGAGTGGGCAAGG + Intergenic
1120741103 14:88109820-88109842 TGGCTGCAGCTGAGTGATTCAGG - Intergenic
1121156100 14:91685818-91685840 TGGCTGCAGTAGGGGCAGGATGG + Intronic
1121571656 14:94951088-94951110 GGGCTGCAGCAGAGAGAAGCTGG - Intergenic
1121795025 14:96727680-96727702 TGTGTGCAGTGGAGTGAGGAGGG + Intergenic
1121826826 14:97017003-97017025 TGGCTGCAGCAATGTGGGAAAGG - Intergenic
1121960917 14:98258643-98258665 TGGTTGAAGCAGAATGAGAAAGG - Intergenic
1122144253 14:99679793-99679815 TGTCTGCGACAGAGTGAGGAGGG + Exonic
1122297537 14:100713804-100713826 TGGAAGCAGGAGAGAGAGGACGG + Intergenic
1122492852 14:102131510-102131532 TGGCTGGAGCAGAGTGAGCAGGG - Intronic
1122735740 14:103839744-103839766 TGGCTGGAGCAGAGTGAGTAAGG - Intronic
1123437137 15:20262801-20262823 TGTGTGCAGCAGAGAGGGGAGGG - Intergenic
1123627578 15:22238377-22238399 TGGCCACAGCAAAGAGAGGAGGG + Intergenic
1123685616 15:22795022-22795044 AGGGAGCCGCAGAGTGAGGATGG + Intronic
1123813048 15:23948584-23948606 TGAGTCCAGCACAGTGAGGAAGG + Intergenic
1124040181 15:26094768-26094790 TGCCTGCAGCAGGGTGGGGAAGG + Intergenic
1124781135 15:32635156-32635178 AGACTGGAGCAGAGTGAGCAAGG - Intronic
1124812961 15:32960225-32960247 TGGCAGCAGGAGAGAGAGGGTGG + Intronic
1125207242 15:37167601-37167623 TTGCTGCAGGAGAGGGAAGATGG - Intergenic
1125935671 15:43633444-43633466 TGACTGGAGTAGAGTGAGCAGGG - Intronic
1125948442 15:43729908-43729930 TGACTGGAGTAGAGTGAGCAGGG - Intergenic
1125967650 15:43887226-43887248 TCTCCGCAGCAGAGAGAGGAAGG - Intronic
1126326255 15:47480647-47480669 TGGCAGAAGCAGGGTGTGGAGGG - Intronic
1126482939 15:49146903-49146925 TGGCTGCAGCAAAGTGAATGAGG - Intronic
1126563536 15:50071075-50071097 TGGCTACAGCAGATTGAACAAGG - Intronic
1126657712 15:50997640-50997662 AGGCTGCAGTAGATTGAGGAGGG - Exonic
1127102943 15:55586597-55586619 TAACTGCAGCAAAGTGAGCAAGG - Intronic
1127745817 15:61971084-61971106 TGGCTGAAGCAGAGTGAGCAAGG + Intronic
1127931983 15:63602842-63602864 TGGCTGGAGCAGAGTGAATGAGG + Intergenic
1128072169 15:64804559-64804581 TGGATGAAGGAGAGTGAGGTGGG + Intergenic
1128393134 15:67196721-67196743 TGGCAGCAGCAGAGAGGTGATGG - Intergenic
1128523068 15:68388220-68388242 TGGCTGGAGTAGAGTGAGCTAGG - Intronic
1129108268 15:73323300-73323322 TGGCTGCAGCGGGGTGAGCAGGG + Exonic
1129113462 15:73351843-73351865 TGTCTGCAGCAGAGTGTGCAAGG - Intronic
1129240697 15:74250374-74250396 TGGCTGGAGCAAAGAGAGGGAGG - Intronic
1129449460 15:75642343-75642365 TGGCTGGAGCAGAGTGGGCAAGG + Intronic
1129477274 15:75794603-75794625 CTGTTGCAGCAGAGTGAGGGTGG - Intergenic
1129736180 15:77966076-77966098 TGGATGCAGCAGGGTGAGAGAGG - Intergenic
1130512079 15:84598305-84598327 TGGATGCAGCAGGGTGAGAGAGG - Intergenic
1131003943 15:88960553-88960575 TGGTCCCAGCAGACTGAGGAGGG + Intergenic
1131145140 15:90006083-90006105 GGTCTGCAGCAGAGGGAGGCTGG + Intronic
1131151195 15:90048421-90048443 TGGCATCAGCACAGGGAGGAGGG + Intronic
1131439282 15:92446859-92446881 TGGTTGAAACAGAGTGAGCAAGG + Intronic
1131998334 15:98154966-98154988 TGGCTGTAGCACAATGAGGAGGG + Intergenic
1132448371 15:101950572-101950594 TGGCTGCGGCAGAGGGAGTCAGG + Intergenic
1132530950 16:449146-449168 TGTCAGGAGCAGAGTGAGCAGGG - Intronic
1132744316 16:1430395-1430417 TGGCTGCAGCTGAGGAAGGAAGG + Intergenic
1132953869 16:2580709-2580731 TGGAAGCAGCAGAGAGAAGAGGG - Intronic
1132960476 16:2619454-2619476 TGGAAGCAGCAGAGAGAAGAGGG + Intergenic
1133350167 16:5096069-5096091 TGGCTGGAGTGGAGTGAGCAGGG - Intronic
1133404715 16:5514347-5514369 TGGTGGCAGAAGAGTGAGAAAGG + Intergenic
1133736350 16:8618985-8619007 TGTCTGCAGCAGAGGGAAGGCGG - Intergenic
1133755341 16:8758449-8758471 TGGCTGGAGCAGAGAGAGTGGGG + Intronic
1133757672 16:8774866-8774888 TGGCCGGAGAAGAGAGAGGAGGG - Intronic
1134027369 16:10964497-10964519 TGGCTGCAGCATAGAGTGGCTGG + Intronic
1134075797 16:11290485-11290507 TGGCTGGAGCAGAGAGAGGTGGG + Intronic
1134447257 16:14340201-14340223 TGGCTGCAGCAGAGCGAGTCGGG + Intergenic
1134595365 16:15491617-15491639 TGGGTGGAGCAAAATGAGGAAGG - Intronic
1134692724 16:16201499-16201521 TGGCTGGAGGAGAGTGAGCATGG + Intronic
1134979121 16:18593182-18593204 TGGCTGGAGGAGAGTGAGCATGG - Intergenic
1135053125 16:19208452-19208474 TGGCAGCAGGAGAGTGAGGGGGG + Intronic
1135197647 16:20407993-20408015 TGGCTGGAGCAGACTGAGACAGG + Intergenic
1135694896 16:24577021-24577043 TGGGTGCAGCAAGGTGAGTAAGG - Intergenic
1135812234 16:25598754-25598776 TGGCCGAAGCAGAGTGAGTGAGG + Intergenic
1136020394 16:27436412-27436434 TGGCTGGAGTGGAGTGAGGCAGG + Intronic
1136080411 16:27848882-27848904 ATGCTGTAGCAGAGTGAGCAAGG + Intronic
1136368415 16:29820632-29820654 TGTCTGAATCAGAGTGGGGAAGG + Intronic
1136684933 16:31988542-31988564 TGGCTGCATGAGAGGGAGGAAGG + Intergenic
1136785548 16:32932077-32932099 TGGCTGCATGAGAGGGAGGAAGG + Intergenic
1136847432 16:33588031-33588053 TGTGTGCAGCAGAGAGGGGAGGG + Intergenic
1136884225 16:33921727-33921749 TGGCTGCATGAGAAGGAGGAAGG - Intergenic
1137565421 16:49529795-49529817 GGGCTGCAGCGGGGTGTGGACGG + Intronic
1138197209 16:55060496-55060518 TGGCTGGAGCAGAGTGGGTGAGG - Intergenic
1138413813 16:56859774-56859796 TGGCTGGAGCAGAGGGACCAAGG - Intergenic
1138487804 16:57358000-57358022 TGGCTGCTGCAGGGTGGGGATGG + Intergenic
1138550271 16:57744001-57744023 TGCCTGGGGCAGAGTGAAGATGG + Intronic
1138653276 16:58473975-58473997 TGGCTGGAGCAGAGTGAGCCAGG - Intronic
1139521924 16:67488033-67488055 ATGCTGCAGAAGAGTGAGGATGG + Intergenic
1139531297 16:67543956-67543978 GGGCAGCAGCAGAGGAAGGAGGG - Intronic
1140130618 16:72157537-72157559 TGGCTGGAGCAGAGACAGTAAGG + Intronic
1140607094 16:76552131-76552153 TGGCAGCAGGAGAGAGAAGAAGG + Intronic
1140777146 16:78260136-78260158 AGGCTGCAGCACAGCAAGGATGG - Intronic
1140926644 16:79590088-79590110 TGGCTGCAGCTGCGTGGGGCTGG - Intronic
1141103249 16:81213095-81213117 TGACTGCAGCAGAAAGAAGAGGG + Intergenic
1141124909 16:81394408-81394430 TGGCAGCAGGAGAGAGAGAACGG + Intergenic
1141339270 16:83188028-83188050 TGGCTGAAGCAGAGGGAGCAAGG + Intronic
1141976378 16:87518975-87518997 TGGCCGCAGCAAAGAGAGGAGGG - Intergenic
1142223460 16:88866247-88866269 TGGCTGCAGCTGACTTAGGAGGG - Intronic
1203109140 16_KI270728v1_random:1436686-1436708 TGTGTGCAGCAGAGAGGGGAGGG + Intergenic
1142564017 17:827825-827847 GGGCAGCAGCAGAGGGAAGAGGG + Intronic
1142909747 17:3079078-3079100 TGGCAGCAGGAGAGAGAGAAGGG + Intergenic
1142924755 17:3224740-3224762 TGGCAGCAGGAGAGAGAGAAGGG - Intergenic
1142992206 17:3739039-3739061 TGGCTGCAGTGGAGTGGGGCGGG - Intronic
1143097723 17:4487383-4487405 TGGCTGCAGCAGAAGCAAGAGGG + Intronic
1143255399 17:5553981-5554003 TGTCTGCATCAAAGGGAGGAAGG - Intronic
1143345116 17:6243528-6243550 GGGCTGCAGCAATGTTAGGAAGG + Intergenic
1143363205 17:6388047-6388069 AGGGTGGAGCAGAGTGAGAAGGG + Intergenic
1143365049 17:6401964-6401986 TGGCTGGAGCAGGAGGAGGAGGG + Intronic
1143386556 17:6534486-6534508 TGGCTGCAAGGGAGGGAGGACGG + Intronic
1143408062 17:6691086-6691108 AGGAGACAGCAGAGTGAGGACGG - Intronic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1144133305 17:12268438-12268460 TGCCAGAAGCAGAGTGAAGATGG - Intergenic
1144330839 17:14222797-14222819 TGGCTGGAGCAGTGTGGGGGCGG - Intergenic
1144426413 17:15146595-15146617 TGCCTGCAGCAGGGTGGGGAAGG - Intergenic
1144506610 17:15836895-15836917 TAGCTGCTGCAGAGAGGGGAAGG + Intergenic
1144626775 17:16847936-16847958 TGGCTGCAGGCGATGGAGGAGGG + Intergenic
1144646862 17:16981043-16981065 TGGCTGCAGCGGAGTTAAGCGGG - Intergenic
1144785164 17:17827402-17827424 TGGAGGCAGCAGGGTGAGGATGG + Intronic
1144826984 17:18110794-18110816 TGGCTGGAGCAGAGTGATTGAGG - Intronic
1144879659 17:18424774-18424796 TGGCTGCAGGCGATGGAGGAGGG - Intergenic
1144952120 17:19000045-19000067 AGGCTGCAGCCAAGTGAGGCCGG + Intronic
1145152577 17:20519611-20519633 TGGCTGCAGGCGATGGAGGAGGG + Intergenic
1145898418 17:28474196-28474218 AAGCAGCAGCAGAGTGAAGAGGG + Intronic
1145963220 17:28899634-28899656 TGGCTGGAACAGAGTGAGGGGGG - Intronic
1146163913 17:30573775-30573797 TGGCTGCAGGCGATGGAGGAGGG + Intergenic
1146593248 17:34146954-34146976 AGGCTGCAGCAGGATGAGGGAGG - Intronic
1146660743 17:34663712-34663734 GGGCTGCAGCAGGGGGAGGTGGG - Intergenic
1146662676 17:34675028-34675050 CATGTGCAGCAGAGTGAGGAGGG - Intergenic
1146690895 17:34875399-34875421 TGGCTGCAGTGCAGTGAGTAGGG - Intergenic
1147145874 17:38484223-38484245 TGTCTGCATGAGAGGGAGGAAGG + Intronic
1147242108 17:39097200-39097222 TGCCTGGGGCAGTGTGAGGAGGG - Intronic
1147580918 17:41626629-41626651 TGGCTGCAGGCGATGGAGGAGGG + Intergenic
1147584694 17:41647587-41647609 TGGATGAGGCAGGGTGAGGAAGG + Intergenic
1147669902 17:42170962-42170984 TGGCTGCAGCGCAGGGAGCACGG + Intronic
1148638662 17:49168723-49168745 TTGCTGGAACAGAGTGAGAATGG + Exonic
1148717421 17:49725682-49725704 TGGCTGGAGCAGAGTGTGTCAGG + Intronic
1148770425 17:50063103-50063125 TGGCTGGAGCAGAAAGAGGCAGG - Intronic
1148860707 17:50602967-50602989 TGGCTGCAGCGCAGGGAGGGCGG + Intronic
1148872051 17:50664047-50664069 TGACCACAGCAGATTGAGGAAGG - Exonic
1150293062 17:63992969-63992991 TGGCAGGGGCAGAGTCAGGAGGG + Intergenic
1150379066 17:64706488-64706510 TGGCTGGAATGGAGTGAGGACGG - Intergenic
1150486363 17:65546470-65546492 TGCTTGCAGCAGAGTGGGGAGGG + Intronic
1150909356 17:69371795-69371817 TGGCCTCAGCAGAATGAGCAAGG + Intergenic
1150997549 17:70336263-70336285 AGGCAGCATCAGAGTGAGGCAGG - Intergenic
1151284543 17:73100508-73100530 TGGATGAAGCAGAGTGAGGAAGG - Intergenic
1151291695 17:73155461-73155483 TGGCTGCTGGAGAGTGAGGTGGG + Intergenic
1151391918 17:73793119-73793141 AGGCTGCAGCAGAGCTTGGAAGG + Intergenic
1151768584 17:76145167-76145189 AGGCAGCAGCTGAGTGAGGATGG + Exonic
1152031979 17:77848484-77848506 GGGCTACAGCAGTGAGAGGAAGG - Intergenic
1152094215 17:78263707-78263729 TGGCTGCAGAAGTGGGAGGAGGG - Intergenic
1152549901 17:81024043-81024065 TGGCTGCAGCAGAGTGGTGGGGG + Intergenic
1152577260 17:81148319-81148341 TGGGGGCAGCAGAGAGTGGACGG - Intronic
1152797442 17:82315197-82315219 CGGCTGCAGCAGAGTTTGAAGGG - Exonic
1152805689 17:82354723-82354745 TGGTTGCAGGAGAGGAAGGAAGG - Intergenic
1152951141 17:83232560-83232582 TGGCTGCAGGCCATTGAGGAAGG + Intergenic
1152964264 18:99927-99949 TGGCTGCAGGCCATTGAGGAAGG - Intergenic
1153208445 18:2731212-2731234 TGGCTGCAACTGGATGAGGAAGG + Intronic
1153478052 18:5518241-5518263 TGGTTGGAGCAGAGAGAGGGAGG - Intronic
1153568862 18:6448106-6448128 CTGCTTCAGCAGAGTGTGGAAGG + Intergenic
1153617927 18:6951519-6951541 TGGCTCCAACATAGGGAGGAGGG + Intronic
1154470442 18:14695001-14695023 TGGGTGCAGTGGACTGAGGATGG - Intergenic
1155622805 18:27799869-27799891 TGGCTGCAGGAGATTGTGGCGGG - Intergenic
1155700649 18:28738862-28738884 TGGGTGCAGGAGAGTGAGATTGG + Intergenic
1155802811 18:30130863-30130885 TGGCAACAGGAGAGTGAGTAGGG - Intergenic
1155827673 18:30468547-30468569 TAGCTGGAGTGGAGTGAGGAAGG + Intergenic
1156372372 18:36483072-36483094 TGGCTGCTCCAGAGCCAGGATGG - Intronic
1156450306 18:37262883-37262905 CAGCTGCAGCAGCGTGAGGCAGG + Intronic
1156691230 18:39709246-39709268 TGGCAGCAGGAGAGAGAAGAAGG - Intergenic
1156774184 18:40767070-40767092 TGGTTTGTGCAGAGTGAGGAAGG + Intergenic
1156856642 18:41790174-41790196 TACCTGCAGCAGTGTGAGGTTGG + Intergenic
1157291964 18:46416018-46416040 TGCCAGCAGCAAAGTCAGGAAGG - Intronic
1157687868 18:49657361-49657383 AGGCAGCAGCAGGGTGAGGATGG - Intergenic
1157929053 18:51800335-51800357 TGGGTGCAAGAGAGTGAGGGAGG + Intergenic
1157956363 18:52101882-52101904 TGGCTGCAGTAGAGTAAAAAGGG - Intergenic
1158662454 18:59400922-59400944 TGGCTGGAGCAGAGCTGGGATGG + Intergenic
1159434781 18:68401905-68401927 TTGCTTGAGCAGAGTGAAGAAGG + Intergenic
1159807543 18:72974352-72974374 TGGCTGGAACAGAATGAGCAGGG - Intergenic
1159973800 18:74685625-74685647 TGACTGCAGCCGAGTGAGTGAGG - Intronic
1160636896 19:81981-82003 TGGCTGCGGCAGAGGGAGTCAGG - Intergenic
1160654573 19:257892-257914 TGGCTGCAGGCCATTGAGGAAGG - Intergenic
1160676319 19:393277-393299 TGGCTGCAGCAGACTGAGTAAGG + Intergenic
1160695974 19:484728-484750 TGGCTGCCGCAGGGTGAGGAGGG + Intergenic
1160699545 19:499146-499168 TGGCTGCAGCAGAATGAGGAGGG - Intronic
1160751762 19:737766-737788 TGGCTGGAGCAGCGTGAGGAGGG + Intronic
1160758793 19:772136-772158 TGGCTGGAGCAGAGGAAGGGGGG - Intergenic
1160988422 19:1850863-1850885 TGGCTGGACCAGGGTGAGGAGGG + Intergenic
1161226158 19:3146918-3146940 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161239336 19:3213344-3213366 TGGCTGGAGCAGAGTGAGCTGGG + Intergenic
1161243053 19:3233655-3233677 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161253090 19:3291727-3291749 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161257297 19:3316485-3316507 TGGCTGGACCAGAGTGAGGAGGG + Intergenic
1161257915 19:3320138-3320160 TGGCTGGAGCAGAGTGAGGAGGG + Intergenic
1161267901 19:3373442-3373464 TGGCTGGAGCAGAATGAGCAAGG - Intronic
1161273395 19:3402857-3402879 TGGCTGGAGCAGAGTGAGTGAGG + Intronic
1161274291 19:3406976-3406998 TGGCTGGAGCAGAGTGAGCGAGG + Intronic
1161274904 19:3410509-3410531 TGGCTAGAGCAGAGTGAGGAAGG + Intronic
1161283376 19:3457268-3457290 CGGCTGCAGCTGAGTGAGCATGG + Intronic
1161289397 19:3484998-3485020 TGGCTGGAGCAGAGTGAGCCGGG + Intergenic
1161301605 19:3545398-3545420 TGGCTGGAGTAGAGGGAGGAGGG - Intronic
1161302981 19:3551839-3551861 TGGCTGGAGCAGAGAGAGAAGGG - Intronic
1161345446 19:3766859-3766881 TGGCTGGAGCACAGTGAGGAGGG + Intronic
1161345959 19:3768823-3768845 CGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161407659 19:4099412-4099434 CGGCTGCAGCAGAGCCAGGGAGG + Exonic
1161414742 19:4139698-4139720 TAGCTATAGCAGAGTGAGCAAGG + Intergenic
1161422021 19:4181171-4181193 TGGCTGGAGCAGAGTGAGGCAGG - Intronic
1161427280 19:4210476-4210498 TGGCTGCAGCAGGGTGGGGAGGG - Intronic
1161431290 19:4233705-4233727 TGGCCACAGCAGAGTGAGCAAGG - Intronic
1161451750 19:4350237-4350259 TGGCTGGAGCCGAGTGAGTAAGG + Intronic
1161480139 19:4506234-4506256 AGGCTGGAGCCGAGTGAGGAGGG - Intronic
1161488310 19:4547815-4547837 TGGCTGGAGCACAGTGAGCAAGG - Intronic
1161493730 19:4576337-4576359 TGGCTGCAGCAGAGTGTGGAGGG - Intergenic
1161509645 19:4663341-4663363 TGGATGCTGTAGAATGAGGATGG - Intronic
1161515469 19:4693836-4693858 TGGCTGGAGCACAGGGAGGAGGG - Intronic
1161533854 19:4806651-4806673 TGGCTGGAGCAGAGTGACAAAGG + Intergenic
1161596647 19:5154164-5154186 TGGCTGGAGCAGAGGGAGGCAGG + Intergenic
1161599168 19:5170422-5170444 TGGCTGCAGCAGAGTGAGCCAGG + Intronic
1161619216 19:5289594-5289616 CGGCTGGAGCAGAGGGAGGAGGG - Intronic
1161620913 19:5296680-5296702 TTGCTGGAGCAGAGTGAGGAAGG + Intronic
1161623205 19:5310064-5310086 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161625400 19:5323636-5323658 TGGCTGGAACAGAGTGAGGACGG + Intronic
1161629354 19:5344490-5344512 TGGCGGGAGCAGAGTGAGCGAGG - Intergenic
1161633273 19:5370219-5370241 TGGCTGGAGCACAGTGAGCAAGG - Intergenic
1161634217 19:5377170-5377192 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161642950 19:5435715-5435737 TGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161644512 19:5444743-5444765 TGGCTGCAGCAGAGGGAGCAAGG - Intergenic
1161649338 19:5474753-5474775 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161649887 19:5477958-5477980 TGGCTGCAGCAGAGTGAGGAGGG - Intergenic
1161650361 19:5480546-5480568 TGGCTGGAGCAGAGTGAGTGAGG + Intergenic
1161663815 19:5563082-5563104 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161684804 19:5697487-5697509 AGGCTGAGGCAGAGGGAGGAGGG + Intronic
1161719745 19:5896218-5896240 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161756423 19:6137447-6137469 TGGCTGCAGCAGAGTGAGGAGGG + Intronic
1161760584 19:6168176-6168198 TGGCTAGAACAGAGTGAGCAAGG - Intronic
1161765033 19:6202799-6202821 TGGCTGGAGCAGAGTGAGGGAGG + Intergenic
1161813128 19:6481993-6482015 TGGCTGCTGCGGAGCGGGGAAGG - Intronic
1161815691 19:6498543-6498565 CGGCTGAAGCAGAGTGAGGGAGG - Intronic
1161857043 19:6772138-6772160 TGGCTGGAGCACAGTGAAGAGGG + Intergenic
1161883456 19:6974334-6974356 TTGCTTCACCACAGTGAGGATGG - Intergenic
1161979658 19:7623957-7623979 GGGCTGGAGCGGAGTGAGGGTGG - Intronic
1162087846 19:8259367-8259389 TGGCTGGAGCAGAGTGGGTGAGG + Intronic
1162110352 19:8396690-8396712 TGGCTGGAGCAGAGTGAGCCGGG + Intronic
1162156382 19:8680923-8680945 TGGCTGGAGTGGAGTGAGTAAGG + Intergenic
1162304437 19:9863223-9863245 TGGCTGGAGCAGATTGAGTAAGG + Intronic
1162370201 19:10274099-10274121 TGGCTGGAGCTGAGTGAGCAAGG - Intronic
1162400720 19:10445013-10445035 TGGCTGGAGCAGAATGAGTGAGG + Intronic
1162418142 19:10550587-10550609 TGGCTGCAGCAGAGTGTGGGAGG - Intronic
1162589807 19:11584115-11584137 TGGCTGGAGCAGAGTGAGCAAGG + Intronic
1162844455 19:13381678-13381700 TGGCTGGAACAGAGTGAGTGAGG - Intronic
1162844470 19:13381799-13381821 TGGCTGAAGCAGAGCGAGCAAGG + Intronic
1162875282 19:13616830-13616852 TGGCTGGAGCAGAGTGAGTGAGG + Intronic
1163017786 19:14467418-14467440 TGGCTGGAGGAGAGTGAGTGAGG + Intronic
1163025596 19:14509643-14509665 TAGCTCCAGAAGAGTGAGAAAGG + Intergenic
1163113505 19:15175858-15175880 TGGCTGGAACAGAGTGAGTGAGG + Intronic
1163166393 19:15500917-15500939 AAGCTGCAGCAGAGTGAGTGAGG - Intergenic
1163377423 19:16942021-16942043 TGGCTGGAGCAGGAGGAGGAGGG - Intronic
1163462303 19:17446486-17446508 TGGTGGGAGCTGAGTGAGGATGG - Intronic
1163704353 19:18803711-18803733 TGACTGGAGCAGAGTGAGGGAGG + Intergenic
1163781224 19:19249746-19249768 TGGCTGCAGGGAAGTGAGGGAGG - Exonic
1164860668 19:31559859-31559881 TGGCTGAAACCGAGTGAGAAAGG - Intergenic
1165033122 19:33012615-33012637 TGTGTGCAGCAGAGAGGGGAGGG - Intronic
1165146697 19:33735367-33735389 TGGCAGCAGGAGAGTGTGAATGG + Intronic
1165323875 19:35102806-35102828 CGGCTGGAGCAGAGTGAGTGAGG - Intergenic
1165335762 19:35168624-35168646 TGGCTGCTCCAGAGTGAGGGAGG - Intronic
1165387222 19:35517635-35517657 TGGCTGGAGCAGTGTTGGGATGG + Intergenic
1165433119 19:35783602-35783624 TGGCTGGAGCTGAGTGAGTGAGG + Intronic
1165737321 19:38184964-38184986 TGGCTGGAACAGAGCAAGGAGGG - Intronic
1165746229 19:38231238-38231260 TGACTGGAGCAGAGTGAGCAGGG + Intergenic
1165891234 19:39113497-39113519 TGGCTGCAGCAGAGTGGGCGAGG - Intergenic
1165940249 19:39411336-39411358 TGGCTGGAGCAGAGTGGCCAAGG - Intergenic
1166051700 19:40264538-40264560 TGGCTGGAGCAGTGTGAGCTAGG - Intronic
1166099909 19:40565733-40565755 TGGCTGCAGCAGAGTGAGTGGGG + Exonic
1166171695 19:41032198-41032220 TGGCTGAAATAGAGTGAAGAAGG + Intergenic
1166219623 19:41356040-41356062 TGGCTAGAGCAGAATGAGGTGGG + Intronic
1166299532 19:41906180-41906202 TGGCTGCAGAAGAGGGACGTGGG - Intronic
1166891550 19:45997066-45997088 TGGCTGCAGCAGAGTGAGCCAGG - Intronic
1166921088 19:46229743-46229765 TGGTTGCAGTGGAGTGAGGAGGG - Exonic
1167412643 19:49354135-49354157 TGGCTGCAGGACGGTGAGGCAGG - Intronic
1167539318 19:50075234-50075256 TGCCTGCATCTGAGGGAGGAGGG + Intergenic
1167604621 19:50475275-50475297 TGCCTGGAGCTGAGGGAGGAAGG + Intronic
1167670277 19:50848442-50848464 TGGCTGCAGCAGTGTGGGGCTGG + Intergenic
1167702061 19:51054648-51054670 TGGCTGGAGCTGAGTGAGCAAGG - Intergenic
1167842308 19:52131958-52131980 TGGCTGGAGCAGAGGGAGTGAGG + Intronic
1167880816 19:52455962-52455984 TAGCTACAGCAGAGGGAGCAAGG - Intronic
1167896668 19:52587345-52587367 TGGCTGGAGCAGAGGGAGTGAGG - Intergenic
1167906109 19:52661997-52662019 TGGCTGGAGCAGAGGGAGTGAGG + Intronic
1167932194 19:52874932-52874954 TGGCTGGAGCAGAGGGAGCGAGG + Intronic
1167945109 19:52981839-52981861 TGGCTGGAGCAGAGGGAGTGAGG + Intergenic
1167963187 19:53123600-53123622 TGGCTGGAGCAGAGGGAGCGAGG + Intronic
1167970098 19:53183843-53183865 TGGCTGGAGCAGAGGGAGCAAGG + Intronic
1167988842 19:53340804-53340826 TGGCTGGAGCAGAGGGAGGGAGG - Intronic
1168311352 19:55462438-55462460 TGGCTGGAGCGGAGTGAGCAGGG - Intergenic
1168468975 19:56625645-56625667 TGGCTGAAGCAGAGTGAGCAGGG - Exonic
1168472923 19:56654334-56654356 TGGCTGGAACAGAGTGAGAAAGG + Intronic
1168518742 19:57031695-57031717 CGGGGGCAGCAGAGGGAGGAAGG - Intergenic
1168708573 19:58483931-58483953 TGGGTACTGCAGGGTGAGGAGGG - Intronic
925604738 2:5647678-5647700 TGGCGGCAGCAAAGAGAGGTGGG + Intergenic
926133869 2:10323089-10323111 TGGCTGCAGCACAGTCATGGTGG - Intronic
926231583 2:11008234-11008256 GAGCTGCAGCAGAAGGAGGAAGG - Intergenic
926605871 2:14897950-14897972 TGGCTGGGCCAGAGTGAGGTGGG + Intergenic
926862894 2:17327504-17327526 TGGCTGGAGCAGAGTGTGCATGG - Intergenic
927118328 2:19926904-19926926 TGGCTGCAACAGGGTGGGGGGGG - Intronic
927144091 2:20149864-20149886 TGGCTGGAGCCCAGAGAGGAAGG - Intergenic
927205650 2:20608723-20608745 TTGGGGCAGCAGAGTGAGCAAGG - Intronic
927553723 2:24018550-24018572 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
928074454 2:28250277-28250299 TGGCTGGAGCACAGTGAGTAAGG + Intronic
928105891 2:28470416-28470438 TGCCTGCAGCAGAGTGACCTTGG - Intronic
928247837 2:29646594-29646616 TGGCTAGAGCAGAGTAAGGCAGG - Intronic
928576056 2:32656495-32656517 TGCCTGGAGCAGAGTGTGAAGGG + Intronic
928950414 2:36808630-36808652 CGGCTCCAGCAGTGTGGGGACGG + Exonic
928997639 2:37310930-37310952 TAACTGCTGCAGAGTGAAGAGGG + Intronic
929199095 2:39216607-39216629 TGGTGGCAGCAGTGAGAGGAAGG + Intronic
929481747 2:42314751-42314773 AGGCTGCATAAGAGAGAGGATGG - Intronic
929836404 2:45404834-45404856 TGGCCAGAGCAGAGTGAGCAAGG - Intronic
929879986 2:45827121-45827143 TGACTGGAGCAGAGTGTGGAGGG - Intronic
930511410 2:52349908-52349930 TGGCTGCAACAGAGTGGGCAAGG - Intergenic
930949467 2:57121466-57121488 AGGTTGCAGCAGAGTTAGAAAGG - Intergenic
931146717 2:59527262-59527284 TGGCTTGAGCAGAGTGAGCAGGG - Intergenic
931380743 2:61750964-61750986 TGGCTGGAGCAAAGTGATCAAGG + Intergenic
931743072 2:65266426-65266448 TGGCTGGAGCAGAGTGAGCAAGG + Intronic
931891856 2:66682091-66682113 TGGCAGCAGGACAGTGAGTAGGG + Intergenic
932426061 2:71636095-71636117 TGGCTGCAGCAGCATGAGTGAGG + Intronic
932460824 2:71880872-71880894 TGGGTGCTGAAGAGTGGGGATGG - Intergenic
932757166 2:74416969-74416991 ATGCTGCAGCAGAGAGAGCAAGG - Intronic
933124432 2:78586544-78586566 TGGCTGGAGCAGAGGGAGTGAGG + Intergenic
933302644 2:80559828-80559850 TTGCTGCAGGAGGCTGAGGAGGG + Intronic
933699455 2:85244153-85244175 TGGCTGGAGCAGAGTGGGCAAGG + Intronic
933845937 2:86327404-86327426 AGGCTGCAGCTGAGTGAGAGAGG + Intronic
934087316 2:88520678-88520700 CTGCTGCAGCAGAGCCAGGAGGG - Intergenic
934752044 2:96799753-96799775 TGGCTGGGGCAGAGGGAGGCTGG + Intronic
935219750 2:101002303-101002325 TGGACGCTGCAGAGTGAGTATGG + Exonic
935608030 2:104990360-104990382 TGGCTGGAGCAGTGTGAGTAAGG + Intergenic
936571379 2:113619592-113619614 TGGCTGCAGGCCATTGAGGAAGG - Intergenic
936917558 2:117655451-117655473 TGGCTGGAGCTGAGGGAAGAAGG + Intergenic
937534660 2:122871230-122871252 TGGCTACAGCAGACAAAGGATGG + Intergenic
937593711 2:123647250-123647272 TGGCTCCAGGAGAGTGGGGAGGG - Intergenic
937783670 2:125869842-125869864 TGGCAGGAGCACAGTGAGGAAGG - Intergenic
937835805 2:126469308-126469330 AGGCTGCTGCAAAGTGATGAGGG - Intergenic
938180583 2:129178775-129178797 TGCCTACAGCATGGTGAGGAAGG + Intergenic
940012849 2:149073026-149073048 TGGCTGGAGAATAGTGAGCAGGG + Intronic
941196628 2:162460279-162460301 TGGCTGCAGCAGAGTGAGTTTGG - Intronic
941284869 2:163598231-163598253 TGGGGGAGGCAGAGTGAGGAAGG - Intronic
941422529 2:165300676-165300698 TGGCTGGAGCAGAGTGGGAAAGG + Intronic
941443786 2:165574234-165574256 TGACTGCAGAAGCGAGAGGAGGG + Intronic
941521622 2:166552386-166552408 AGCATGCAGTAGAGTGAGGAAGG + Intergenic
941598580 2:167509708-167509730 TGGCTGGAGCAGTGTGAGTTAGG + Intergenic
941888250 2:170551918-170551940 TGGCAGCAGGAGAGAGAGAAGGG - Intronic
941918620 2:170828383-170828405 TGGGGACAGCAGAGGGAGGAGGG - Intronic
942110939 2:172682242-172682264 TGGCTGTAGTAGAGAGAGCAGGG + Intergenic
942193946 2:173498569-173498591 TGCCTGCAGCAGGGTGGGGAAGG - Intergenic
942852279 2:180502680-180502702 TGGCTGTAGCAGGGGGTGGAAGG + Intergenic
942957205 2:181787332-181787354 TGTCGGCAGGAGAGAGAGGAGGG + Intergenic
944053309 2:195496011-195496033 TGGCTGGAGCAGAGTGAGTGGGG - Intergenic
944207176 2:197169098-197169120 TGGCTGAAGGAGAGTGAAGGAGG - Intronic
944494919 2:200297002-200297024 TGGCTATAGCTGAGTGTGGAAGG - Intergenic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
945684183 2:212949315-212949337 TGGCTGAAGCAGAGTCAAGTTGG - Intergenic
946162303 2:217842781-217842803 TGGCTGGAGTAGAGTGATCAAGG - Intronic
946302019 2:218829919-218829941 CGGCTGCAGCACCGTGTGGATGG + Intronic
946364681 2:219241623-219241645 TGGCTGGAGCAGAGTGAACATGG + Intronic
946440837 2:219693762-219693784 TGGCTGGAGCAGAGAGTGCAGGG + Intergenic
946855740 2:223948084-223948106 AGGCTGGAGCAGAGTGAGTGAGG + Intergenic
947499937 2:230664510-230664532 TGGCTGGAGCACAGTGCAGAGGG + Intergenic
948124746 2:235556358-235556380 TGGCTACAGAAGAGAGAGGAGGG + Intronic
948494403 2:238337566-238337588 AGGCTGCAGCGCAGCGAGGAGGG + Intronic
948544949 2:238720872-238720894 TGGCTCCAGCAGATTCAAGATGG - Intergenic
949087634 2:242169574-242169596 TGGCTGCAGGCCATTGAGGAAGG + Intergenic
1168770156 20:409239-409261 GGGCTCCAGTAGAGTGAGCATGG - Intronic
1168772065 20:421702-421724 TGGCTGGAGCAGAGGGATGAAGG + Intronic
1168809407 20:694445-694467 TGGCTGGAGCACAGTGAACAAGG + Intergenic
1168857705 20:1020353-1020375 TGGATGAAGCAGAATGAGGGAGG + Intergenic
1169000330 20:2163622-2163644 TGGCTGCAGCAGAGGAAGCAAGG + Intronic
1170110325 20:12797939-12797961 TGGCTGGAGCAGCTTGAGGAAGG - Intergenic
1170117255 20:12873521-12873543 TGGCTGCTGGGGAGGGAGGATGG + Intergenic
1170175200 20:13461038-13461060 TGGCTGGAGCAGTGTGAGCAAGG - Intronic
1170770464 20:19328201-19328223 TGGCTGGAGCAGAATGAGGGAGG + Intronic
1170832825 20:19858274-19858296 AGGCTACATCTGAGTGAGGAAGG + Intergenic
1170852925 20:20020469-20020491 TGGCTGGTACAGAGTGAGCATGG + Intronic
1171298868 20:24041998-24042020 TGGCTGAAACAGAGTGAGCAAGG - Intergenic
1171374229 20:24681234-24681256 TGCCTGCTGTACAGTGAGGAGGG - Intergenic
1171414325 20:24967394-24967416 TTCCTGCAGCTGGGTGAGGAGGG - Intronic
1172027961 20:31962362-31962384 TGGCTGGAACAGAGTGAGCAAGG + Intergenic
1172115144 20:32569253-32569275 TGGCTGAAGGAAAGTGAGCAGGG + Intronic
1172359742 20:34303562-34303584 TGGCTGAACCAGCGAGAGGACGG - Intronic
1172779607 20:37428255-37428277 TGCCAGCAGCAAAGTGGGGATGG - Intergenic
1173164606 20:40678169-40678191 TGGCTGGAACAGAGTGAGCAAGG + Intergenic
1173288249 20:41692178-41692200 TGGTTGCAGCACTGTGGGGAAGG - Intergenic
1173510674 20:43625700-43625722 TGGCCACTGCAGAGTGAGTAGGG + Intronic
1173539422 20:43840494-43840516 GGGCTGGAGCAGAGTGATCAAGG + Intergenic
1173669352 20:44787174-44787196 TGGCTGGAGCAGACAGAGCAAGG + Intronic
1173919095 20:46730625-46730647 TGCCTGGAACAGAGGGAGGAAGG + Intronic
1173996974 20:47345984-47346006 TGGCTGCTGAAGGGTGAGGATGG + Intronic
1174166001 20:48583986-48584008 TGGCCGGGGCAGAGTGAGTAGGG + Intergenic
1174181954 20:48680550-48680572 TGGCTGCCTCAGAGTGAGGAGGG - Intronic
1174202219 20:48814693-48814715 CACCTCCAGCAGAGTGAGGATGG + Intronic
1174278340 20:49419921-49419943 TGGCTGGAGGGGAGTGAGCAAGG - Intronic
1174293004 20:49522136-49522158 CAGCTGAAGCAGAGTGAGGGAGG - Intronic
1174299259 20:49569565-49569587 TGGCTGGAGCAGAGTGGGTGAGG - Intergenic
1174302106 20:49589872-49589894 TGGCTGGAGCTGAGTGAGTTGGG - Intergenic
1174313949 20:49682433-49682455 TGGCTGGAACAGAGTGAGTGAGG - Intronic
1174387839 20:50197807-50197829 TGGCTGGAGCAGAGGCAGCAAGG + Intergenic
1174405108 20:50297709-50297731 TGGTTGCAGCAGAGAGAGGAAGG - Intergenic
1174421246 20:50400444-50400466 TGGCTGCAGCAGAATGAGTGAGG + Intergenic
1174428278 20:50448804-50448826 TGGCTGGAGGAGAGTGAGTGAGG - Intergenic
1174531999 20:51221722-51221744 TGGCGGGAGCAGAGGGAGCAAGG + Intergenic
1174693347 20:52531772-52531794 TGGCTGCAGAAGAGAGAGTGGGG + Intergenic
1174755879 20:53158193-53158215 TGTCTGGAGCCGAATGAGGAAGG + Intronic
1174943938 20:54964007-54964029 TGGCTGAAGTATAGTGAGGGAGG + Intergenic
1174981683 20:55402563-55402585 TGGCAGCAGGAGAGAGAAGAGGG + Intergenic
1175143463 20:56878207-56878229 TGGCTGCAGCCGTGTGAGCCAGG + Intergenic
1175183538 20:57165066-57165088 TGGCTGCGGCACAGGGAGGCAGG - Intergenic
1175270702 20:57731923-57731945 TGGCAGCAGGAGAGAGAGCACGG + Intergenic
1175592746 20:60206579-60206601 TGGCTGCAGCCCTGTGAGGGAGG + Intergenic
1175690512 20:61062464-61062486 TGGCTGCTACAGATTGAGGTGGG - Intergenic
1175840747 20:62025599-62025621 TGGCGGCAGGAGAGACAGGAGGG - Intronic
1175918790 20:62440285-62440307 TCGCTGGAGCAGACTGAGGCTGG + Intergenic
1176697034 21:9990484-9990506 TGACTGGAGATGAGTGAGGAAGG - Intergenic
1176804044 21:13462866-13462888 TGGGTGCAGTGGACTGAGGATGG + Intergenic
1177079390 21:16619824-16619846 TGGCTGAAGGAGAATGAGCAAGG + Intergenic
1177286314 21:19055916-19055938 TGACTGAAGCTTAGTGAGGAAGG + Intergenic
1177770422 21:25508525-25508547 TGGCTACTGCAGAGTCAGCAAGG - Intergenic
1177880016 21:26681876-26681898 TGGCTGCATTATAGTGAGGAAGG - Intergenic
1177927634 21:27238357-27238379 TGGCTGCAGCAGAGTAAGTGAGG - Intergenic
1178431978 21:32525383-32525405 TGGCTGAAGCAGAGCCAGGAGGG + Intergenic
1178601567 21:33999203-33999225 TGGCTGGAGCAGGGTGACAAGGG - Intergenic
1178906733 21:36642797-36642819 TTGCTGGAGAAGAGTGGGGAAGG - Intergenic
1178920427 21:36735047-36735069 TGGCTACAGCCGAGGGAGGCTGG + Intronic
1179036036 21:37759439-37759461 TGCCTGCAGCCCAGTGAGAAAGG - Intronic
1179224536 21:39442268-39442290 TGGCTGAAGCCCAGTGAGAAGGG + Intronic
1179231313 21:39506351-39506373 TGGCTGAAGTAGAGTGGTGAGGG + Intronic
1179272917 21:39865567-39865589 GGGCTGCAGCAGCCTGAGGTTGG - Intergenic
1179496201 21:41772684-41772706 TGGCTGCAGCAGAGACAGTGGGG - Intergenic
1179639564 21:42738432-42738454 TTGCTGGAGCACAGTGAGGCTGG + Intronic
1179780391 21:43696438-43696460 AGGCTGCAGCTGGGTGAGGCGGG + Intergenic
1179818871 21:43924982-43925004 TGGCTGAAGTGCAGTGAGGAAGG - Intronic
1180125807 21:45789621-45789643 TGGCCGGAGCAGAGCGAGCAAGG + Intronic
1180176523 21:46093114-46093136 TGGGTGCAGCAGGCTGCGGAGGG - Intergenic
1180262616 21:46683405-46683427 TGGCTGCAGGCCATTGAGGAAGG + Intergenic
1180590261 22:16931194-16931216 TGTCTGCATAAGAGGGAGGAAGG + Intergenic
1180713100 22:17853298-17853320 AGGCTGCAGCAGAGTGGGCTGGG - Intronic
1180933475 22:19608971-19608993 TGGCTGCAGCACAGTGAGAATGG - Intergenic
1180957489 22:19747434-19747456 AGGCTGCAGAGGTGTGAGGAGGG + Intergenic
1181041733 22:20195532-20195554 AGGCTGGGGCAGGGTGAGGACGG - Intergenic
1181175015 22:21030349-21030371 TGGCTGTAGCAGAGAGAGTGGGG + Exonic
1181777956 22:25173105-25173127 TGGCAGCAGGAGAGAGAGAACGG + Intronic
1181836748 22:25616365-25616387 TGGCGGCAGGAGAGAGAGGGAGG + Intronic
1181931490 22:26405370-26405392 TGGCTGCAGCTCAGAGAGGCTGG + Intergenic
1182043432 22:27256133-27256155 TGGAAGCAGGAGAGTGAGGCAGG - Intergenic
1182092109 22:27602839-27602861 TGGCGGCAGTAGGGTGGGGAGGG + Intergenic
1182697340 22:32206062-32206084 TGGCTGCAGCAGGGGCAGGTTGG + Intergenic
1183149258 22:36025186-36025208 TAGCTGGAGCAGAGAGAGCAAGG - Intronic
1183255965 22:36762403-36762425 GGGCTGCAGCAAGGTGAGGATGG + Intronic
1183465765 22:37979742-37979764 TGGCTGCCCCAGGGTGAGGAGGG + Intronic
1183669216 22:39262510-39262532 GGGCTGCAGCAGAGAGAGGTGGG - Intergenic
1183704967 22:39470576-39470598 TGGCTGCTGCAGAGGCAGGAGGG + Intronic
1184096735 22:42320145-42320167 TGACTGGAGCAGAGTGAGCAGGG - Intronic
1184189118 22:42883193-42883215 TGGCAGGAGCAGGGTGAGGCTGG - Intronic
1184452558 22:44591666-44591688 TGCCTGCTGCAGAGTGGGGCAGG - Intergenic
1184714454 22:46273033-46273055 AGGCTGCAGCAGGGTGAGAAGGG - Intronic
1184773961 22:46613976-46613998 CGGCTGCAGCAGTGTGAGGAGGG + Intronic
1185428813 22:50791282-50791304 TGGCTGCAGGCCATTGAGGAAGG + Intergenic
949252600 3:2005281-2005303 TGGCTGAAGCAGAGAAAGTAAGG + Intergenic
949478331 3:4470062-4470084 TGGCTACAGTGGAGTGAGCAAGG + Intergenic
949700241 3:6747921-6747943 TGGTTTCAGTAGAGTGGGGAAGG - Intergenic
949870335 3:8582730-8582752 TGGCTGGAGCACAGTGAGCAAGG - Intergenic
950101582 3:10360118-10360140 TGGGGGCTGCAGAGAGAGGAAGG + Exonic
950223272 3:11212865-11212887 TGGCTGGAGCTGAGTGAGTGAGG - Intronic
950399687 3:12760400-12760422 TTACTGGAGCAGAGTGAGGGAGG - Intronic
950425060 3:12920756-12920778 GGACTACAGTAGAGTGAGGAGGG - Intronic
950455939 3:13092814-13092836 TGCCTGGAGCAGAGTGAGGAGGG - Intergenic
950484609 3:13265635-13265657 TGGCTGCACCAGAGGGATGAGGG - Intergenic
950582545 3:13871940-13871962 TGGCTGGAGTAGAGTGAGGAAGG - Intronic
950644334 3:14368169-14368191 AGGCCTCAGCAGAGTGAGGAGGG - Intergenic
950719149 3:14870264-14870286 TGGCTGGAGCAAGGTGAGGTTGG + Intronic
950863877 3:16173782-16173804 TGGCTGAAGCAAAGAGAGCAGGG - Intergenic
950908918 3:16567052-16567074 TGGTTGAAGTAGAGTGAGGGAGG - Intergenic
951249859 3:20382127-20382149 TGTCTGCGGCAGGGTGGGGAAGG - Intergenic
952235230 3:31472499-31472521 TGGCTGAAGCTGAGTGAGCAAGG - Intergenic
952254328 3:31682407-31682429 TGGCTGGAGCAGGGTGAACAGGG - Intronic
952461925 3:33536527-33536549 TGGCAGGAGCAGAGTGAACAAGG + Intronic
953040883 3:39253816-39253838 TGGGTGCAGCAGAGTGACTCCGG + Intergenic
953067650 3:39489054-39489076 TGGCTGAAGCACAGTGAGGGAGG - Intronic
953239355 3:41134868-41134890 TGGCTGGAGCAGAATGAGTGAGG + Intergenic
953416201 3:42719352-42719374 TGCCTGAGGCAGAGTGGGGAAGG - Intronic
953605628 3:44411441-44411463 TGGCTGGAGCAGAGGGAGAATGG - Intergenic
953882780 3:46700308-46700330 AGGCTGCAGCAGGGAGCGGAGGG - Intergenic
953955006 3:47225032-47225054 TGGCTGGAGTAGAGTGAGCAAGG + Intergenic
954300658 3:49699208-49699230 TGGCTGCTGCAGAGTTAGTGGGG + Intronic
954420938 3:50418721-50418743 TGGCTGCTGCAGGGTGGAGAGGG + Intronic
955018566 3:55096310-55096332 TGGCTGCAGCAGAGTGAGCAAGG - Intergenic
955088789 3:55729224-55729246 TGGCTGGCGTAGAGTGAGCAAGG - Intronic
955215699 3:56983459-56983481 TGTCTGCAGCAGAGTCTGAAAGG - Intronic
955457191 3:59136352-59136374 TGGCTTGGGAAGAGTGAGGAAGG + Intergenic
955473593 3:59312797-59312819 TGGCTGCAGAGCTGTGAGGAGGG + Intergenic
955649104 3:61174083-61174105 TGGCTGCAGAAGAGGGATAATGG + Intronic
955717489 3:61845951-61845973 TGGGTGCAGAAGACTGAGGGAGG + Intronic
955999886 3:64718003-64718025 TGGCTGGAGCACAGCGAGGCAGG - Intergenic
956227507 3:66976186-66976208 TGGCTGCAGCAGGATCAAGAGGG - Intergenic
956488108 3:69742515-69742537 TGGCTGTAGCAGAGGGAGGTAGG - Intronic
956570049 3:70684121-70684143 AGGCTGGAGCACAGAGAGGAAGG - Intergenic
956576692 3:70760047-70760069 TGGCTGGAGCAGAGTGAACAAGG + Intergenic
956593750 3:70944631-70944653 TGGCTGCTGCAGAGTAAACATGG - Intergenic
956946797 3:74232493-74232515 TGGCTGGAACAGAGTGAGTAAGG + Intergenic
957054459 3:75433432-75433454 TGGCTGGAGTGGAGTGAGCAGGG - Intergenic
957617391 3:82548037-82548059 TGGCTGCAACAGAGAGAAAAAGG + Intergenic
957631778 3:82725164-82725186 TGGCTGCAGCAGAAATAAGAGGG + Intergenic
957854827 3:85860953-85860975 TGTCTGAAGCAGAGTGAGCTAGG + Intronic
958624562 3:96607320-96607342 TGGGTGCAGCACAGTGAGCATGG - Intergenic
958795310 3:98700842-98700864 AGTCTGAAGCAGACTGAGGAAGG + Intergenic
958913954 3:100026806-100026828 TGGCTGCAGGAGAGAAAGAATGG - Intronic
958989735 3:100828950-100828972 TGTCTGCAGCTAAGTGAGAAGGG - Intronic
959664130 3:108902646-108902668 TGGCTGCTGCAGTGTGGGGAAGG + Intergenic
960294591 3:115927635-115927657 TGGCCGAAGCAGAGTGAGCAAGG - Intronic
961289140 3:125831408-125831430 TGGGAGCAAGAGAGTGAGGAGGG + Intergenic
961307077 3:125965686-125965708 TGGCTGGAGGGAAGTGAGGAAGG + Intergenic
961552720 3:127678251-127678273 GGGCAGCAGCAGAGTGCTGAAGG + Intronic
961601914 3:128068801-128068823 TGGCTGCTTCTGAGTGACGATGG - Intronic
961829401 3:129615774-129615796 AGGATGCAGCAGAGTCAGGAGGG + Intergenic
961947130 3:130703235-130703257 TGGCTGGAGCAAAGTGAGCGAGG - Intronic
962354086 3:134678756-134678778 TAGCAGCAGCACAGTGAGGTGGG - Intronic
962649716 3:137476268-137476290 TGGCTGCAGCAGACTGAGTGAGG - Intergenic
962698686 3:137975824-137975846 TGGCTGCAGCAGAGTGAGGTGGG - Intergenic
962843797 3:139258287-139258309 TGGCTGCAGCGGATTGAATAAGG + Intronic
963089621 3:141471085-141471107 TGGTCTCAGCAGATTGAGGAGGG - Intergenic
963249760 3:143092276-143092298 TGGCAGCTGCAGAGGGAGAAAGG + Intergenic
963280289 3:143377874-143377896 TGGCTGGAGCTGAGTAAGCAAGG - Intronic
963730152 3:148963414-148963436 TGGCTGGAGAAAAGTGAGCAAGG + Intergenic
963897031 3:150697892-150697914 TGGCTGCAGTGGAGTAAGCAGGG - Intronic
964081407 3:152763078-152763100 TGGCTGGAGCAGAGTGATTAAGG - Intergenic
964361954 3:155907913-155907935 TGGTTGGAGCAGAGTAAGCATGG + Intronic
964419696 3:156488516-156488538 TGGCTGCAGCAGAGTAAGGAAGG + Intronic
964558233 3:157964361-157964383 TGGCTGCTGCAGGGTGAGAGAGG + Intergenic
964682829 3:159361419-159361441 TGGCTGAAGCAGAGAGAGCAAGG + Intronic
964948605 3:162258858-162258880 TGTCTAGAGCAGAGTGAGAAAGG + Intergenic
965268294 3:166577751-166577773 TGGCTGCGGCAGATTAAAGATGG + Intergenic
965537320 3:169836836-169836858 TGGCTGGAGCAGAGTGAGCCAGG + Intronic
966197206 3:177325340-177325362 TGGCTGCTGCACAGTGTGGCCGG - Intergenic
966323927 3:178733304-178733326 TGGCTGGAGTAGAGTGAGCTGGG + Intronic
966497081 3:180593307-180593329 TGGCAGGAACAGAGTGAGCATGG - Intergenic
966514705 3:180805997-180806019 TGGCTGCACCAGGGTTAGCATGG + Intronic
966567199 3:181396576-181396598 TGGCTGCAGTAGAGTGAGGCTGG + Intergenic
966605853 3:181820929-181820951 TGGCTGGAGCAGAGTGAGCAGGG - Intergenic
967210707 3:187165955-187165977 TGGTAACAGCAGAGTGAGGGAGG + Intronic
967248446 3:187512855-187512877 TGGATGCAGCACACTGAGCAGGG + Intergenic
967912315 3:194552511-194552533 TGGCCGCAGCAGAGTGGGCAAGG - Intergenic
968289498 3:197527632-197527654 TGGCTGAAGCAGAATGAGGGGGG - Intronic
968331008 3:197870173-197870195 TAGGTGCAGCAGATGGAGGAAGG - Exonic
968471355 4:783936-783958 TTGTTACAGCTGAGTGAGGAAGG - Intergenic
968471548 4:784835-784857 TGGATGGAGCTGAGTGAGAATGG + Intergenic
968664000 4:1810843-1810865 TGGCTGCAGGAGTGCGTGGATGG - Intergenic
968675675 4:1877672-1877694 TGGCTGGAACAGAATGAGAATGG - Intronic
968975767 4:3821391-3821413 TGGCTTGAACAGTGTGAGGATGG + Intergenic
968997272 4:3953742-3953764 TGGCTGGAGTGGAGTGAGCAGGG - Intergenic
969369004 4:6719263-6719285 AGGCTGCAGGGGAGTGAGCAAGG - Intergenic
969431028 4:7154456-7154478 TGACTGCAGCAGAGACCGGAAGG + Intergenic
969517441 4:7655465-7655487 TGGCGGCTGCAGAGTGGGCAAGG + Intronic
969587372 4:8102163-8102185 TGGCTGAAGCAGAATGACCAAGG - Intronic
969657818 4:8508277-8508299 TGGCTGTGGGAGGGTGAGGAGGG + Intergenic
969756742 4:9154940-9154962 TGGCTGGAGTGGAGTGAGCAGGG + Intergenic
969804851 4:9599295-9599317 TGGGAGCAAGAGAGTGAGGAGGG + Intergenic
969816712 4:9692509-9692531 TGGCTGGAGTGGAGTGAGCAGGG + Intergenic
970267868 4:14309325-14309347 AGGCTGCAGCAGAGAGTGGGAGG - Intergenic
970689655 4:18607883-18607905 AGGCTGGAGAAGAGGGAGGACGG - Intergenic
970873397 4:20842377-20842399 TGGCTGGAGCAGAGTAAATAGGG + Intronic
970965665 4:21925009-21925031 TGACTGGAGTAGAGTGAGTAAGG - Intronic
971091951 4:23355958-23355980 TGGCTGGAGTAGAGTGAGAAAGG + Intergenic
971261964 4:25065474-25065496 AGGCAGCAGCAGGGTGTGGAGGG - Intergenic
971470594 4:27021750-27021772 TGGCTGTTGCAGAGGAAGGATGG + Intronic
971507879 4:27386257-27386279 TAGCTGAAGCAGAGTGAATAGGG - Intergenic
972418306 4:38863973-38863995 TGGCTGGAGCAGAGGGAGGATGG - Intergenic
972425269 4:38927023-38927045 TGGCTGCAGCAGAGTGAGGCAGG - Intronic
972601369 4:40575887-40575909 TGGCTCCAGCAGGGAGAGAAAGG + Intronic
972709275 4:41578239-41578261 TGGCAGCAGGAGAGAGAGAAGGG + Intronic
973167658 4:47097243-47097265 TGGCTGGAGCAGAGTGAGAAAGG - Intronic
973607868 4:52605800-52605822 TGGCTGGAGCAGAGAGAAGGAGG - Intronic
973755574 4:54070222-54070244 TGGGTGGATCATAGTGAGGAAGG + Intronic
973816412 4:54623418-54623440 CTGCTGGAACAGAGTGAGGAAGG - Intergenic
974133070 4:57780332-57780354 TGGATGCATCATAGTGAGCAAGG + Intergenic
974756591 4:66217128-66217150 AGCATGCAGCAGAGTGTGGAGGG - Intergenic
975101647 4:70520974-70520996 TGGCCAGAGCAGAGTGAGGGAGG + Intronic
975195033 4:71514329-71514351 TGGCTGCAGCAGGAGGAAGAGGG - Intronic
975329850 4:73100310-73100332 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
975475781 4:74821751-74821773 TGGCAGGAGCACAGTGAGTAAGG + Intergenic
975654627 4:76629315-76629337 TGGCTGGGGCAGAGTGAGTGAGG + Intronic
976369202 4:84267523-84267545 TGGCTGAAGGACAGGGAGGAGGG - Intergenic
976718765 4:88150416-88150438 AGGCTGAAGCAGAGTGAGGGAGG + Intronic
977370708 4:96131292-96131314 TGGCTGAAACAAAGTGAGTAAGG - Intergenic
977589798 4:98813660-98813682 GGCCTGCAGCAGGGTGGGGAAGG - Intergenic
977593083 4:98848615-98848637 TGCCTGCAGCAGAGTGGGGAAGG + Intergenic
978787531 4:112626458-112626480 TGGTTGGAACAGAGTGAGCAAGG - Intronic
979653060 4:123158737-123158759 TGTCTGCAGCAGTCAGAGGAAGG + Intronic
979840615 4:125435676-125435698 TGTCTGGACCAGAGTGAGAAAGG + Intronic
980091431 4:128447242-128447264 TGGCTGAAGCAGAGTGAATGAGG + Intergenic
980369640 4:131850676-131850698 TGGCTGGAGATGAGTGAGGAAGG - Intergenic
981064545 4:140469014-140469036 GTGCTGCAGTAGAGAGAGGAGGG - Intronic
982048593 4:151475622-151475644 TGGCTGAAGTAGAGTGAGGGAGG + Intronic
982090354 4:151875160-151875182 TGGCTGGAGTAGAGAGAGCAAGG + Intergenic
982195388 4:152906789-152906811 TGACTGCAGCAGAGTGAATAAGG - Intronic
982413496 4:155105837-155105859 TGGATGAAGCAGAGTGAAGCGGG + Intergenic
982812544 4:159844226-159844248 TACCTGGAGCAGAGTGAGCAGGG - Intergenic
982864105 4:160488815-160488837 TGTATGCAGCAGGGTGAGGAAGG - Intergenic
982932559 4:161428019-161428041 TGGCTGCTGCTGAGGGATGAGGG - Intronic
983515734 4:168654714-168654736 GAGCTGCAGCAGAGCGGGGAGGG - Intronic
983671313 4:170241043-170241065 TGGCTGAAGTAGAGTGAGCAGGG - Intergenic
983711750 4:170725689-170725711 TGACTGCAGCAAAGAGAAGAAGG + Intergenic
984010530 4:174366229-174366251 TGGCTGCAGGACAGTGAGGATGG + Intergenic
984441370 4:179774582-179774604 TGCCTGAGGCAGAGTGGGGAAGG - Intergenic
985465258 4:190188379-190188401 TGGCTGCAGGCCATTGAGGAAGG + Intergenic
985575912 5:673445-673467 TGGCTGCAGGTGAATGGGGAGGG + Intronic
985718261 5:1475120-1475142 AGGATGAAGCAGAGTGAGGCGGG + Intronic
985835849 5:2271559-2271581 TGCCTGCAGGAGAGTGGTGAGGG + Intergenic
985920982 5:2973501-2973523 TAACTGCAGCAGAGTCATGATGG + Intergenic
985946893 5:3192599-3192621 AGGCTGCACCACAGTGAAGATGG - Intergenic
985960027 5:3294292-3294314 TGGTTCCTGCAGAATGAGGATGG + Intergenic
986228801 5:5842673-5842695 TGGCTGGAGCCGATGGAGGAAGG + Intergenic
986323395 5:6652276-6652298 GGGCTGTAGCAGAATGAGCAGGG + Intronic
986494924 5:8332273-8332295 TGGCGGCAGCAAAATGAAGAAGG - Intergenic
986637612 5:9838279-9838301 TGCCTGGAGAAGGGTGAGGATGG - Intergenic
986688417 5:10294133-10294155 TGGCTGCAACAGAAAGAGCAAGG + Intronic
988496588 5:31750812-31750834 TGGCTGGAGTGGAGTGAGTAGGG + Intronic
988568738 5:32343165-32343187 TGCCTGCCGCAGGGTGGGGAAGG - Intergenic
988627099 5:32889004-32889026 AGGCTGGAGCAGAGTGGGCAAGG - Intergenic
988901854 5:35741451-35741473 TGTCTGGAGCAGAGTGAGCTAGG + Intronic
988960546 5:36366802-36366824 TGGTTGAAGCTGGGTGAGGAAGG - Intergenic
990015048 5:51050434-51050456 TGGCTGCAGCTGCCTGAGGCTGG - Intergenic
990282341 5:54264609-54264631 TGGCTGAAGCAGAAAGAGTAGGG - Intronic
990308729 5:54518260-54518282 TGGCTGCAGCAGCGCCTGGAAGG - Exonic
991315512 5:65300533-65300555 TGGATTCAGCATAGTGAGGTAGG - Intronic
991489104 5:67165878-67165900 TGGCTCTAGCAGAGAGGGGAAGG + Exonic
991979013 5:72212345-72212367 TGGCTGGAGCAGAATGTGTAAGG - Intergenic
992146811 5:73858901-73858923 TGACTGGAGCAGAGGGAGTAAGG - Intronic
992388656 5:76310462-76310484 TGGCTGGAGCAGAATGACCAAGG + Intronic
992957939 5:81929769-81929791 GGGCTGCAGCAGACCAAGGAAGG - Intergenic
993973290 5:94445841-94445863 TGGCTGTTCCAGAGTGTGGATGG - Intronic
994052688 5:95380610-95380632 TGGCTGGAGGAGAGTAAGCAAGG + Intergenic
994142076 5:96352864-96352886 TGGCAGCAGGAGAGAGAGCAAGG - Intergenic
995110252 5:108420989-108421011 TGGCTAGAGCAGAGTGACTAAGG + Intergenic
995614827 5:113950194-113950216 TGGGAGCAGCAGAATGAGGGAGG - Intergenic
995821771 5:116242675-116242697 TGGCTGAAGCAGAAGTAGGAGGG - Intronic
995895387 5:117005268-117005290 GGCCTACAGCAGAGTGGGGAAGG + Intergenic
996139418 5:119887747-119887769 AGGCTGGAGCAGAGTAAGCAAGG - Intergenic
996190408 5:120533673-120533695 TGGCTGGAACAGAGGGAGCAAGG + Intronic
996220310 5:120924131-120924153 GAGTTGCAGCAGGGTGAGGAAGG - Intergenic
996245816 5:121263058-121263080 TGCCAGCAGCAGTGTGAGCATGG + Intergenic
996485323 5:124026884-124026906 TGATTGAAGCAGAGTGAGCAAGG + Intergenic
997267482 5:132503560-132503582 TGGCTGCAGCATGGTGGGCAAGG + Intergenic
997286185 5:132680390-132680412 TGGCTGGATCAGAGTGAGTGAGG + Intronic
997424056 5:133791049-133791071 TGGCTACAGCAGAGTGAGTGAGG - Intergenic
997628618 5:135349108-135349130 TGCCTGCTGCAGCCTGAGGAAGG - Intronic
997694688 5:135851864-135851886 AGGCTGCAGGAGGCTGAGGAGGG - Intronic
998141531 5:139702277-139702299 TGGCTGGAGCAGAAGGAGCAGGG - Intergenic
998449673 5:142224592-142224614 TGGCTGCCAGGGAGTGAGGATGG + Intergenic
998672659 5:144371174-144371196 TTGTTGAAGCAGAGTGAGGCAGG - Intronic
998882373 5:146656711-146656733 TGGCTGGAGAGGAGTGAGTAAGG + Intronic
999566819 5:152873114-152873136 TGTGTGCTTCAGAGTGAGGATGG - Intergenic
999632037 5:153581411-153581433 TGGCTCAAGCACAGTGAGCAAGG - Intronic
999857721 5:155613445-155613467 TGGATGGAGCAGAGTGAGCCAGG + Intergenic
1000158376 5:158574631-158574653 AGGCTGGAACAGAGTGAGCAAGG + Intergenic
1000166151 5:158650624-158650646 TGGCTGGAGAAGAATGAGCAGGG - Intergenic
1000186617 5:158864821-158864843 TGGCTGCAGCACAGTGAGCGAGG + Intronic
1000304759 5:159985049-159985071 TGGCTGAAGTGGAGTGAGGGAGG - Intergenic
1000763227 5:165252491-165252513 TGGCTAGAGTGGAGTGAGGAGGG + Intergenic
1000963829 5:167631464-167631486 TGGCTGAAGCATAGGGAGTAAGG + Intronic
1000971830 5:167723316-167723338 TGACTGCACAAGAGTGAGCAAGG - Intronic
1001016869 5:168149806-168149828 TGGCTGTAGCAGAGTGAGTGAGG - Intronic
1001164242 5:169349114-169349136 TGGCTGGAGCAAAGTGAGAGAGG - Intergenic
1001483076 5:172101908-172101930 AGGCTGGAGAAGAGTGAGGCTGG + Intronic
1001570240 5:172725992-172726014 TGGCTGCAGCGGGGTAAGGGAGG - Intergenic
1001741902 5:174060042-174060064 TGGCTGCCACACAGTGAGGCAGG + Intronic
1001751281 5:174133420-174133442 TGGCTGCAGCATAGTGTGAGAGG - Intronic
1001751795 5:174137062-174137084 TGGCTGGAACTGAGTGAGCAAGG + Intronic
1001763965 5:174230387-174230409 TAGCTGCAGCAGAGTGAGTTTGG - Intronic
1001922845 5:175613997-175614019 TGGGTGCGGCTGGGTGAGGAAGG + Intergenic
1001956054 5:175848908-175848930 TGGCTGAAGCAGAGTGAGCCGGG + Intronic
1002336949 5:178486235-178486257 AGGCAGCTGCAGAATGAGGACGG + Intronic
1002745371 5:181466374-181466396 TGGCTGCAGGCCATTGAGGAAGG + Intergenic
1002793724 6:453467-453489 TCGCTCCAGCACAGGGAGGACGG + Intergenic
1003257254 6:4485303-4485325 TGGCTGGGGCAGAGTGGGGCAGG - Intergenic
1004019178 6:11761019-11761041 TGGCTGGTTCAGATTGAGGAGGG - Intronic
1004370536 6:15048625-15048647 AAGCTGCAGTAGAGTGGGGACGG + Intergenic
1005423037 6:25672597-25672619 TGGCTGGAGCAGAGCAAGAAAGG + Intronic
1006127096 6:31846035-31846057 TGGCTGAAGCAGAGTGGAAATGG - Intergenic
1006178350 6:32137713-32137735 TGAGTGGAGCAGAGTGAGCAAGG + Intergenic
1006255941 6:32832400-32832422 GGGCTGCAGCAGATGCAGGATGG - Exonic
1006291189 6:33138107-33138129 TGTCTGCAGCAGGGTGGGGAAGG + Intergenic
1006466820 6:34200536-34200558 TGGCTAGAGCAGAGTAAGCAAGG + Intergenic
1006474599 6:34246062-34246084 ATGCTGCAGCAGAGTGAGCAAGG + Exonic
1006648808 6:35534497-35534519 TGTCTGCAGCAGAGTGGTGGTGG - Intergenic
1006728172 6:36215033-36215055 TGGCTGCAGCAGAGGGGGTGGGG + Intronic
1006803221 6:36772347-36772369 TGGTTGGAGCAGTGAGAGGACGG - Intronic
1006823743 6:36918508-36918530 TGGCAGCAGCAGAGAGAACAGGG + Intronic
1006864994 6:37202167-37202189 TGACTGGAGCATGGTGAGGAGGG - Intergenic
1006931273 6:37690083-37690105 TGGCTGGAGCAGAATGAGCCAGG - Intronic
1007574468 6:42916157-42916179 GGGCTTCGGCAGACTGAGGAGGG - Intronic
1007597767 6:43062131-43062153 TGGCTGCAGTAGAGTGAATGAGG + Intronic
1007728415 6:43930982-43931004 TGGCTGGAGCACAGTGAGGAAGG + Intergenic
1007736336 6:43984622-43984644 AGGCTGGAGCAGAGTGAGCGAGG + Intergenic
1008079256 6:47177636-47177658 TGCCAGCAGCAGAGAGAGAATGG - Intergenic
1008095578 6:47336300-47336322 TAGCTGGAGCAGAGGGAGCATGG - Intergenic
1008609750 6:53174798-53174820 TGGCTGGAGCAGAGTGAGCCAGG - Intergenic
1009565888 6:65310635-65310657 TGACTGTAGCAGAATGAGAAGGG - Intronic
1009822803 6:68826433-68826455 TGGCTGGAGCAGAGTGATCATGG + Intronic
1009989772 6:70827496-70827518 TGGCTGTAGCATAGAGAGTATGG + Intronic
1012140945 6:95625962-95625984 TGGGTGCGGTTGAGTGAGGAAGG - Intergenic
1012146893 6:95695349-95695371 TGGCTGCGGAGGAGTGGGGAGGG + Intergenic
1012415142 6:99005013-99005035 TGGCTGGAGCAGAGTGAGCCAGG - Intergenic
1012417734 6:99027779-99027801 TGGCTGCAGCTGAGTGAGCAAGG + Intergenic
1012489369 6:99763756-99763778 TGGCTGGAGCATAGTGAGCTAGG + Intergenic
1012603695 6:101131099-101131121 TGGCTGGAGCAGAGTGACTGAGG + Intergenic
1013070399 6:106723946-106723968 TGGCTGGAGTAGAGTGAAGAGGG + Intergenic
1013372913 6:109485450-109485472 TGGCTGGAGCACAGTGAGTGAGG + Intergenic
1013548448 6:111183178-111183200 TGGCAGAAGCAGAGTGGGCAAGG - Intronic
1013710508 6:112891901-112891923 AGGAGGCAGGAGAGTGAGGAAGG - Intergenic
1013732403 6:113184223-113184245 TGGCTGGAGTAGAGAGAGGCAGG + Intergenic
1014002939 6:116385150-116385172 TGGCTGGAGCAGAGAGAGACTGG + Intronic
1014007873 6:116442207-116442229 TGGCTAGAGCAGAGTGGGGGAGG + Intergenic
1014738249 6:125120293-125120315 TGCCTGTGGCAGAGTGGGGAAGG - Intronic
1014837317 6:126174105-126174127 AGGCTGCAGAAAGGTGAGGAAGG - Intergenic
1015377352 6:132526213-132526235 TGCCTGCGGCAGGGTGGGGAAGG - Intergenic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1015809084 6:137143225-137143247 GTGCTGGAGAAGAGTGAGGAAGG + Intergenic
1016295837 6:142572942-142572964 TGTCTGCAGCAGGGTGGGGAAGG - Intergenic
1016580426 6:145623502-145623524 TGGCTAGAGCAGAGTGAGAGAGG + Intronic
1017074747 6:150607238-150607260 TGATTGCAGCAGAGGGAGAATGG + Intronic
1017168212 6:151429885-151429907 TGTCTGCAGTATAGTTAGGATGG + Intronic
1017170710 6:151452093-151452115 TGGCTGCAGTAGTGAGAGGCTGG - Exonic
1017220488 6:151960570-151960592 TGACTAGAGCAGAGTGAGGCAGG + Intronic
1017384049 6:153861936-153861958 TGGCAGCAGCAGGCTGAGCATGG - Intergenic
1018565282 6:165145066-165145088 TGCCTGCAGCTGAGACAGGAAGG + Intergenic
1018829732 6:167433691-167433713 TGGTGGCGGCAGAGTGTGGATGG + Intergenic
1018829868 6:167434305-167434327 TGGTGGCGGCAGAGTGTGGATGG + Intergenic
1018864229 6:167734950-167734972 GGGTTGCAACAGAGCGAGGAGGG + Intergenic
1018952638 6:168389142-168389164 TGTCTGCACCAGGGTGCGGAGGG + Intergenic
1019166349 6:170100171-170100193 GGGCTGCATCTGAGTGGGGAAGG - Intergenic
1019190429 6:170247644-170247666 GGGCAGCAGCAGAGGCAGGAGGG + Intergenic
1019250287 6:170739920-170739942 TGGCTGCAGGCCATTGAGGAAGG + Intergenic
1019268580 7:133344-133366 TGGCTCCATCAGAGTGGTGATGG + Intergenic
1019478809 7:1256737-1256759 GGGCTGCAGCAGTGAGAGGCTGG + Intergenic
1019710892 7:2517754-2517776 TGGCTGCAGGGGATTGAGGAGGG + Intronic
1019842540 7:3462735-3462757 TGGCGGCAATAGAGAGAGGAGGG - Intronic
1020007109 7:4788908-4788930 TGCCTGCAGCAGCGTGGGCACGG - Exonic
1020140226 7:5607736-5607758 TGGCTGCTGCAGAGGGAAGTCGG + Intergenic
1020140811 7:5610637-5610659 TGGGGGCAGCAGAGGGAGAAGGG + Intergenic
1021052734 7:16009003-16009025 TGGCTGAACCATAGTGAGCAGGG + Intergenic
1021093694 7:16511475-16511497 TGGGTATAGCAGGGTGAGGAGGG + Intronic
1021820079 7:24488111-24488133 CGGATGCAGAAGAGTGAGAAAGG - Intergenic
1021941894 7:25686430-25686452 TGGCTCCAGCACAGTGAGTCCGG + Intergenic
1021979939 7:26044468-26044490 TGGCTGGAGCAGAGTCAGCAAGG - Intergenic
1022026423 7:26452156-26452178 GGGCTGGAGCAGAGCGAGGTTGG - Intergenic
1022041054 7:26581825-26581847 TGGTTCCAGGAGAGTGAGGGAGG - Intergenic
1023088075 7:36592326-36592348 AGGCTGTAGCAGAGGGAAGATGG + Intronic
1023105204 7:36756973-36756995 TGGCTGCAGCAGAGGGTGTCTGG + Intergenic
1023302566 7:38789467-38789489 TGGCTGCAGCACAGAGACCAAGG + Intronic
1023934188 7:44727498-44727520 TGGCTGGAGCATAGTGAGCAAGG + Intergenic
1025249584 7:57343024-57343046 TGGCTGCAGCAGAATGAGTGAGG - Intergenic
1027172646 7:75883650-75883672 TGGAGGCAGCAAAGGGAGGAGGG - Intronic
1027242934 7:76345023-76345045 TGGCTGCAAGAGTGGGAGGAGGG - Intronic
1027602941 7:80261918-80261940 TGGTTGCAGCATAGTGAGGAAGG - Intergenic
1027798866 7:82726604-82726626 TGGCCACAGCAGAGTGAGCAAGG + Intergenic
1027814092 7:82946657-82946679 TGGTCGGAGCAGAGTGAGGAGGG + Intronic
1028276389 7:88863104-88863126 TTGCTGTAGCATAGTGAGCACGG - Intronic
1028850339 7:95530616-95530638 TGGCTGAAGTGGAGTGAGCAAGG + Intronic
1029152595 7:98491539-98491561 AGGCTGCAGCAGCTTGAGGCGGG + Intergenic
1029224477 7:99014884-99014906 TGCCGGCTCCAGAGTGAGGAGGG + Intergenic
1029482802 7:100823371-100823393 TGGCTGGAGCACAGTGGGGTAGG + Intronic
1029551540 7:101239444-101239466 TGGCTTCAGGAAAGGGAGGAAGG + Intronic
1030848106 7:114447479-114447501 TGGCTGCAGCAGCAAGAGAATGG - Intronic
1031528845 7:122852685-122852707 TAGCTGGAGCAGAGAGAGCAAGG + Intronic
1031886107 7:127247585-127247607 TTGGTGGGGCAGAGTGAGGATGG + Intronic
1031990430 7:128194599-128194621 TGGCTGCAACAGAATGATGGAGG + Intergenic
1032273237 7:130430934-130430956 TGGTGGCAGCAGAATGATGAGGG + Intronic
1032415495 7:131732537-131732559 TGGCTGGAGCAGAGGGAGCTGGG - Intergenic
1032445138 7:131975889-131975911 TGGATGGAGCAGAGTGAACAAGG - Intergenic
1032550283 7:132778368-132778390 TGGCCCCAGCAGAGTGAAAAAGG - Intergenic
1033553775 7:142470506-142470528 TGGCTGCAGTAGAGAGGGGCGGG - Intergenic
1033558357 7:142508283-142508305 TGGCTGCAGTAGAGAGGGGCAGG - Intergenic
1033562434 7:142545211-142545233 TGGCTGGAGCAGAGAGAGCCAGG - Intergenic
1033583071 7:142753980-142754002 TGGATGCAGCAGAGGGAGGCAGG + Intronic
1033584620 7:142764884-142764906 TGGATGCAGCAGAGGGAGGCAGG + Intergenic
1033871432 7:145758735-145758757 TGGCTGAAGCTGAGTGAGTAGGG - Intergenic
1034339985 7:150346727-150346749 TGGCGGTAGGAGGGTGAGGAGGG + Intergenic
1034446506 7:151116592-151116614 TGAGTGAAGCAGAGTAAGGATGG - Intronic
1035077273 7:156189004-156189026 TCGCTGCAGCAGAGTGACAGAGG - Intergenic
1035310837 7:157967586-157967608 TGTCTGCCTCTGAGTGAGGACGG - Intronic
1035497092 8:61765-61787 TGGCTGCAGGCCATTGAGGAAGG - Intergenic
1035514272 8:219289-219311 TGGCTGCAGGCCATTGAGGAAGG - Intergenic
1035817953 8:2561534-2561556 TGCCTGTAGCAGTCTGAGGAGGG - Intergenic
1036511523 8:9404668-9404690 TGCCTGCAGCAGAAGGAAGACGG + Intergenic
1036849583 8:12192402-12192424 TGGCTGGAGTGGAGTGAGCAGGG - Intronic
1036870945 8:12434675-12434697 TGGCTGGAGTGGAGTGAGCAGGG - Intronic
1037297815 8:17419683-17419705 TGACTGCAGCAGATAGAGGTTGG + Intergenic
1037431407 8:18817080-18817102 TGGCTGGAGAGGAGTGAGCAAGG + Intronic
1037920910 8:22804843-22804865 TGGCTGCAGCAGGGTGGTCACGG - Intronic
1038406489 8:27326116-27326138 TGGCTGCAGGAGAGTCAGGGTGG - Intronic
1038576892 8:28712267-28712289 TGGCTGAAGCTGAGAGAGCAAGG + Intronic
1038820854 8:30950851-30950873 TGGCTGGAGAAGAGTGACTAAGG + Intergenic
1039393952 8:37206811-37206833 TGGTTGGAGAAGAGTCAGGAGGG + Intergenic
1039894582 8:41707462-41707484 TGGCTGCAGCAGTGTGTGGTGGG - Intronic
1039907042 8:41794281-41794303 TGGTTGAAGCAGAGTGAGGCAGG - Intronic
1039992883 8:42505049-42505071 TGGCTACAGCGGGGAGAGGAAGG + Intronic
1040485209 8:47864637-47864659 GTGCCACAGCAGAGTGAGGAGGG + Exonic
1041207973 8:55517660-55517682 TGGCTGGAGCACAGAGAGGCAGG + Intronic
1041228941 8:55730020-55730042 TGCCTGCAGCAGGGTAGGGAAGG + Intronic
1041727746 8:61033572-61033594 TGGAGGCAGGAGAGTGAGAAAGG - Intergenic
1041804581 8:61836442-61836464 TGGCAGCAGTAGACTGAGCAGGG + Intergenic
1042222293 8:66485494-66485516 TGGTTGCAGAAGAATGAGGCAGG + Intronic
1042226880 8:66521144-66521166 GGGCAGCAGCAGGGTGAGGGTGG + Intergenic
1042333594 8:67608057-67608079 AGGCTGCAGAAGAGGAAGGAAGG + Intronic
1042463736 8:69102063-69102085 TGGCGTCAGCAGACTCAGGAGGG + Intergenic
1042874376 8:73427276-73427298 CGGCAGCAGCAGTGGGAGGAGGG + Intronic
1043737879 8:83769403-83769425 TGGCTGCAGTAGAGGAAGCATGG - Intergenic
1044576287 8:93773268-93773290 TGGCTGGAGCAGAGTGAGCAGGG + Intronic
1044701418 8:94968571-94968593 TGCCTGGAGCTGAGTGAGCAAGG + Intronic
1045152969 8:99429956-99429978 TGGCTTCAGCAGAGTGAGCAAGG - Intronic
1046287164 8:112109154-112109176 TGGCTAATGCAGAGTGAGGAAGG + Intergenic
1046823502 8:118661575-118661597 TGGCTGGAACAGAGAGAGTAAGG + Intergenic
1046890484 8:119416366-119416388 TGGCTGCAGTGCAGGGAGGAGGG - Exonic
1047171062 8:122492626-122492648 TGGCTGCAGCAGAGTTAGCAAGG + Intergenic
1047236817 8:123048900-123048922 AGGCTGGAGCAGAGTGACAAGGG - Intronic
1047241747 8:123096276-123096298 TGGCTAGAGCAGACTAAGGAAGG - Intronic
1047367884 8:124228983-124229005 TGGCTGGAGCAGAGTGAGCTTGG + Intergenic
1047403806 8:124568385-124568407 TGGCCGCAGCATAGAGATGAAGG + Exonic
1047463277 8:125088933-125088955 TGGCTGGAGCAGAGTCAGCTAGG + Intronic
1047599175 8:126409183-126409205 TGGCTGCTGGAGAGTGATGTAGG + Intergenic
1048059088 8:130899034-130899056 TGGCTAGAGCATAGTGAGCAGGG - Intronic
1048206297 8:132417924-132417946 AGAGGGCAGCAGAGTGAGGATGG + Intronic
1048432380 8:134382237-134382259 TGCCTGCTGCAGAGGAAGGAAGG - Intergenic
1048938572 8:139377225-139377247 AGGCTGGATGAGAGTGAGGAGGG - Intergenic
1048967606 8:139625689-139625711 CAGCTGCAGCAGAGAGATGAAGG - Intronic
1049007398 8:139864078-139864100 GGGCTGCAGGAGAGGGAGGGGGG - Intronic
1049012209 8:139894545-139894567 TGCCTGCAGCGGAGGGAGGGGGG + Intronic
1049137470 8:140916367-140916389 TGGCTGGAACAGAGTGAATACGG - Intronic
1049251963 8:141594015-141594037 TAGCTGGAGCAGAGTGAGCCAGG + Intergenic
1049289498 8:141794298-141794320 AGGCTGCAGCTGGGAGAGGAGGG - Intergenic
1049390642 8:142368557-142368579 TCTCTGCAGCAGAGAAAGGACGG + Intronic
1049542169 8:143213588-143213610 CGGCTGCAGGACAGTGAGTAGGG + Intergenic
1049542178 8:143213645-143213667 AGGCTGCAGGACAGTGAGTAGGG + Intergenic
1049713814 8:144080100-144080122 TGGGTGCAGCTGTGTGAGGATGG - Exonic
1049745887 8:144263139-144263161 TGGCTGCAGGAGAGCAAGGCTGG + Exonic
1049753160 8:144295183-144295205 GGGCTGCAGCTGACTCAGGAGGG + Intronic
1049864072 8:144922299-144922321 TGGCAGCACCAGAGTGGGCAGGG + Intergenic
1049889429 9:54840-54862 TGGCTGGAACAGAAGGAGGAGGG - Intergenic
1050105986 9:2167471-2167493 TGGATGCAGCAAAGTGATGGAGG + Intronic
1050292081 9:4165588-4165610 TCACTGCAGCAGAATCAGGAAGG + Intronic
1050333150 9:4565501-4565523 TGGCTGCAGGAGAGAGAGCAAGG + Intronic
1050405926 9:5308746-5308768 TTGCAGGAGCAGAGTGAGGGAGG - Intergenic
1051154913 9:14131761-14131783 AGGCTGCTACAGACTGAGGAAGG - Intronic
1051196244 9:14565347-14565369 TGGCTGCAGCAGAATCACCAGGG + Intergenic
1051225334 9:14892806-14892828 TGCCTGGGGCAGAGTGGGGAAGG - Intronic
1051261425 9:15268974-15268996 TGGCTGGAGTCGAGTGAGTAAGG - Intronic
1051542203 9:18232167-18232189 TGGCTAGAGCAGAGTGAGTGAGG - Intergenic
1051729920 9:20130545-20130567 TAGCTGAAGCAGAATTAGGAAGG + Intergenic
1052030109 9:23618936-23618958 TTGCTGGAGCAGAGTGAGCAGGG - Intergenic
1052707413 9:32010497-32010519 TGGCTGCAGCTGAGACAGGTGGG - Intergenic
1052999810 9:34571717-34571739 TGAGTGCTGCAGAGTGGGGATGG + Intronic
1053634018 9:39976336-39976358 TGGCTGGAGATGAGTGAGGAAGG - Intergenic
1053771729 9:41487168-41487190 TGGCTGGAGATGAGTGAGGAAGG + Intergenic
1054209869 9:62274361-62274383 TGGCTGGAGATGAGTGAGGAAGG + Intergenic
1054315126 9:63574593-63574615 TGGCTGGAGATGAGTGAGGAAGG - Intergenic
1054749176 9:68886921-68886943 TGGCTGTAGCAGAGAGGGCAAGG - Intronic
1056189948 9:84175320-84175342 TGGCTGCAGCCCTGTGAAGAAGG + Intergenic
1056448079 9:86685953-86685975 TGGGTGCAGGAGAGGGAGAAGGG + Intergenic
1056493107 9:87127263-87127285 TGGCTGGAGCAGAGTGAATGTGG - Intergenic
1056552921 9:87665836-87665858 TGGCTGCAGAAGGGTGAGTTGGG - Intronic
1056728286 9:89141860-89141882 TGTCTGCAGCAGGGTGGGGGAGG + Intronic
1056766554 9:89447754-89447776 GGGCTGAGGCAGAGTCAGGAAGG - Intronic
1056795168 9:89654105-89654127 TGGCTGCAGCAGGGAAGGGAGGG + Intergenic
1057445643 9:95112585-95112607 AGGCTGTACCAGAGTGAGGAGGG + Intronic
1057500180 9:95590622-95590644 TGGCTGGAGCAGAGTAAACAAGG - Intergenic
1057743612 9:97733972-97733994 TGGCAGAGGCAGAGGGAGGAGGG + Intergenic
1057952444 9:99380360-99380382 TGGCTCCAGGAGGATGAGGATGG + Intergenic
1057953755 9:99390933-99390955 GGGTTGCAGCTGAGTGAGCAAGG + Intergenic
1057971278 9:99560500-99560522 TGGCTGCAGCATAATGAGCTGGG + Intergenic
1058015805 9:100030864-100030886 TGCCTGCAGCAAGGTGGGGAAGG - Intronic
1058201667 9:102050012-102050034 TGCCTGAAGCACAGTGAGAAAGG - Intergenic
1058597446 9:106630188-106630210 TGGATGGAGCAGAGTGCAGAAGG + Intergenic
1058840989 9:108908916-108908938 TGGCTGCAGCAGAGCAAAGGAGG - Intronic
1059750207 9:117240493-117240515 TGACTGGAGCAGAGTAAGAAAGG + Intronic
1059972972 9:119686336-119686358 TTTCTGCAGCAGAGTGACGGTGG - Intergenic
1060290576 9:122299066-122299088 TGCCTGTAGCAGAGTGAGTGAGG + Intronic
1060431419 9:123554142-123554164 TGGCTGCATCGGGGGGAGGATGG - Intronic
1060706464 9:125806277-125806299 TGGCTGGAGCAGAGGGAGGGAGG + Intronic
1060960978 9:127680455-127680477 TGGCTGATGCAGAGTGAGCGAGG - Intronic
1061085754 9:128397255-128397277 TGGCTGGAGCGCAGTGAGGAAGG + Intergenic
1061350566 9:130061486-130061508 TGGCTGGAGCAGAGTGATCTAGG + Intronic
1062057036 9:134474131-134474153 TGACTGCAGCAGAGTGGGCTGGG + Intergenic
1062238580 9:135524187-135524209 TATCTGCAGCAGAGGCAGGAAGG + Intronic
1062264774 9:135681943-135681965 AGGCTGCAGCAGAGACAGGGTGG - Intergenic
1203579840 Un_KI270745v1:32516-32538 TGGCTGCAGGCCATTGAGGAAGG + Intergenic
1186071739 X:5828277-5828299 ACACTGCAGCAGAGTGAAGAGGG + Intergenic
1186506860 X:10100614-10100636 TGGCTGGAGCAGGGTGAGTGGGG - Intronic
1187549522 X:20287952-20287974 TGGCTGAAGCAGAGACAGCAAGG - Intergenic
1187731379 X:22258642-22258664 TGGCTGGAGCAGAGCGAGCAAGG + Intergenic
1187765462 X:22636920-22636942 TAGCTGGAGCTGAGTGAGAAAGG + Intergenic
1187932240 X:24304048-24304070 GGGCTGGAACAGAGTGGGGAAGG - Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1189290544 X:39882331-39882353 AGGATGAAGCAGAGTGGGGAGGG + Intergenic
1189715500 X:43860794-43860816 TGGCTGTAGTAGAATGAGCAAGG - Intronic
1190216093 X:48480402-48480424 TGGTTGGAACAGAGTGAGGGGGG + Intronic
1190393838 X:49959873-49959895 TTGCTGAAGCAGAGTGAAAATGG - Intronic
1191075144 X:56445032-56445054 TGCCAGCAGCAGAGGGAGCATGG + Intergenic
1191076848 X:56463058-56463080 TGGCTGCAGCTGAATGAGTGAGG + Intergenic
1191135997 X:57066327-57066349 TGGCTGGAGCTGAGTGAGCAAGG - Intergenic
1191613022 X:63136870-63136892 TGCCTGAAGCAGAGTGGGGAAGG - Intergenic
1191623275 X:63242056-63242078 TGCCTGAAGCAGAGTGGGGAAGG + Intergenic
1191713879 X:64180569-64180591 TGGCTGAAGTAGAGTGAGTGAGG - Intergenic
1192034134 X:67545408-67545430 CAGCAGCAGCAGGGTGAGGATGG + Exonic
1192190291 X:68987140-68987162 GGGCAGCAGCAGAGGCAGGATGG - Intergenic
1192273824 X:69610115-69610137 TGACTGGAGCAGAGTGAACAAGG + Intergenic
1192322081 X:70098119-70098141 TGGCTGGAGCAGAGTGAACAAGG + Intergenic
1192452689 X:71253672-71253694 GGGCTCCTGCAGAGTGGGGAGGG - Intronic
1192537899 X:71944150-71944172 TGACAGAAGCAGAGTGAGGTGGG - Intergenic
1192543656 X:71995483-71995505 TGGCTGGTGCAGAGTGCAGAAGG - Intergenic
1192888489 X:75362831-75362853 TGCCTGTGGCAGAGTGGGGAAGG - Intergenic
1194086247 X:89532295-89532317 TGTCTGTAGCAGGGTGGGGAAGG + Intergenic
1194165361 X:90508141-90508163 TTGCTGCAGCTGCGTGGGGATGG - Intergenic
1194643675 X:96432044-96432066 TGGCTGGAACATAGTGAGGAAGG - Intergenic
1194828416 X:98591912-98591934 TGCCTGCAACAGGGTGCGGAAGG + Intergenic
1195005013 X:100677277-100677299 TGGTTGAAGCATAGTGAGCAAGG + Intronic
1195576637 X:106459135-106459157 TGACTGGAGCTGAGTGAGCAAGG - Intergenic
1195738009 X:108033424-108033446 TGGGTGCAGCAGCATGAGGAGGG - Intergenic
1196178876 X:112668929-112668951 AGTTTCCAGCAGAGTGAGGAGGG - Intronic
1196264773 X:113629747-113629769 GGGGTGGAGAAGAGTGAGGATGG + Intergenic
1196704522 X:118705411-118705433 TAGCTGCAGCAGAGAGTGTATGG - Intergenic
1196830611 X:119772786-119772808 TGGCTGGAGCAGAGTGAGGGAGG - Intergenic
1196906754 X:120444541-120444563 CGGCTGGAGGAGAGTCAGGAAGG - Intronic
1197750970 X:129963336-129963358 TGACTCCTGCAGAGTGAGGAGGG - Intergenic
1197798905 X:130328615-130328637 TGGCTGGAGCAGAGCCATGAAGG - Intergenic
1197859622 X:130956533-130956555 TGGCAGCAGCAGAGTAAGTGTGG - Intergenic
1197881736 X:131173772-131173794 TGGCTAAAGCAGAGTGATTAAGG + Intergenic
1197891008 X:131270367-131270389 TGGCTGGAGCATAGTAAGCAAGG - Intergenic
1197916608 X:131542473-131542495 TGACTGGAGCAAAGTGAGCAAGG + Intergenic
1198000824 X:132433787-132433809 TGGCTGGAGCAGAGCCATGAAGG - Intronic
1198182114 X:134220294-134220316 TGCCTGCAGCGGGGTGGGGAAGG + Intergenic
1198433885 X:136596352-136596374 TGGCTGTAGCAGCATGAGTAAGG + Intergenic
1198471120 X:136948139-136948161 TGGCGGCAGCAGAGGCAGAAAGG + Intergenic
1199177060 X:144801633-144801655 TGGCTGAAGCATAATGAGAAAGG - Intergenic
1199222569 X:145334337-145334359 TAGCTGCAGCAGACTAAGTAAGG + Intergenic
1199289764 X:146092925-146092947 TGAGTGCAGGAGAGAGAGGAGGG + Intergenic
1200056695 X:153465339-153465361 TGGCTGCAGCAGAGGCAGAGAGG + Intronic
1200232562 X:154451302-154451324 TGGCTCCAGGAGGCTGAGGAAGG + Intergenic
1200250103 X:154548217-154548239 TAGCTGGAGCAGAGTGAGGGAGG + Intronic
1200251538 X:154556780-154556802 TGGCTACAGCCGAGTGACCAGGG - Intronic
1200259262 X:154603508-154603530 TGGCTGCATCAGCGTGAGCAAGG + Intergenic
1200266229 X:154647636-154647658 TGGCTACAGCCGAGTGACCAGGG + Intergenic
1200276257 X:154735856-154735878 TGGCTGCAGCCCAGGGAGTAAGG - Intronic
1200335581 X:155347837-155347859 TGGCTGGAGCTGAGTAAGCAAGG - Intergenic
1200350887 X:155493388-155493410 TGGCTGGAGCTGAGTAAGCAAGG + Intronic
1200438907 Y:3188172-3188194 TGTCTGTAGCAGGGTGGGGAAGG + Intergenic
1200511629 Y:4085951-4085973 TTGCTGCAGCTGCGTGGGGATGG - Intergenic
1200849618 Y:7869506-7869528 TGGCTCCAGCACAGCCAGGAGGG + Intergenic
1201795068 Y:17887541-17887563 TGGCTGCAGCAGGCTGTAGAAGG + Intergenic
1201798801 Y:17930593-17930615 TGGCTGGAGCAGACCGTGGAAGG - Intergenic
1201802752 Y:17975364-17975386 TGGCTGGAGCAGACCGTGGAAGG + Intergenic
1201806487 Y:18018440-18018462 TGGCTGCAGCAGGCTGTAGAAGG - Intergenic
1201860915 Y:18596371-18596393 TGGCTTCAGCAAAGGGAGGTAGG + Intergenic
1201872408 Y:18724009-18724031 TGGCTTCAGCAAAGGGAGGTAGG - Intergenic
1202138327 Y:21691629-21691651 TGGCTGGAGCAGGCTGTGGAAGG - Intergenic
1202166159 Y:21990990-21991012 TGGCTGAAGCATAGTGTGGAAGG + Intergenic
1202172233 Y:22061981-22062003 TGGATGGAGCAGACTGTGGAAGG - Intergenic
1202219131 Y:22524390-22524412 TGGATGGAGCAGACTGTGGAAGG + Intergenic
1202225199 Y:22595383-22595405 TGGCTGAAGCATAGTGTGGAAGG - Intergenic
1202317915 Y:23600278-23600300 TGGCTGAAGCATAGTGTGGAAGG + Intergenic
1202324049 Y:23671662-23671684 TGGATGGAGCAGACTGTGGAAGG - Intergenic
1202356508 Y:24056616-24056638 TGGCTGCAGCAGGCTGTAGAAGG + Intergenic
1202360102 Y:24099209-24099231 TGGCTGGAGCAGACCGTGGAAGG - Intergenic
1202510675 Y:25570905-25570927 TGGCTGGAGCAGACCGTGGAAGG + Intergenic
1202514270 Y:25613493-25613515 TGGCTGCAGCAGGCTGTAGAAGG - Intergenic
1202546722 Y:25998392-25998414 TGGATGGAGCAGACTGTGGAAGG + Intergenic
1202552851 Y:26069780-26069802 TGGCTGAAGCATAGTGTGGAAGG - Intergenic