ID: 1161757302

View in Genome Browser
Species Human (GRCh38)
Location 19:6143600-6143622
Sequence AGGTGTCACCTGGACACTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 194}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161757302_1161757307 25 Left 1161757302 19:6143600-6143622 CCACAAGTGTCCAGGTGACACCT 0: 1
1: 0
2: 1
3: 13
4: 194
Right 1161757307 19:6143648-6143670 TCTCCACTCCCCCCTGCTTCAGG 0: 1
1: 0
2: 3
3: 46
4: 459
1161757302_1161757310 30 Left 1161757302 19:6143600-6143622 CCACAAGTGTCCAGGTGACACCT 0: 1
1: 0
2: 1
3: 13
4: 194
Right 1161757310 19:6143653-6143675 ACTCCCCCCTGCTTCAGGCTGGG 0: 1
1: 0
2: 0
3: 12
4: 216
1161757302_1161757309 29 Left 1161757302 19:6143600-6143622 CCACAAGTGTCCAGGTGACACCT 0: 1
1: 0
2: 1
3: 13
4: 194
Right 1161757309 19:6143652-6143674 CACTCCCCCCTGCTTCAGGCTGG 0: 1
1: 0
2: 0
3: 19
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161757302 Original CRISPR AGGTGTCACCTGGACACTTG TGG (reversed) Intronic
900446766 1:2685079-2685101 AGCTGTCACGTGCACACCTGGGG - Intronic
900448259 1:2692505-2692527 AGCTGTCACGTGCACACCTGGGG - Intronic
900451733 1:2753457-2753479 AGCTGTCACGTGCACACCTGGGG - Intronic
900453881 1:2764342-2764364 GGCTGTCACCTGCTCACTTGGGG - Intronic
900455327 1:2771604-2771626 GGCTGTCACCTGCTCACTTGGGG - Intronic
901832269 1:11899629-11899651 TGATGTCACCTGGGCCCTTGGGG - Intergenic
905347821 1:37323413-37323435 AGGGGCAACCTGGAGACTTGGGG - Intergenic
907037456 1:51229002-51229024 AACTGTCTCCTGGACACTGGCGG + Intergenic
910630443 1:89347925-89347947 GATTGTCACCTGGACACTTTGGG + Intergenic
911883796 1:103272125-103272147 GATTGTCACCTGGACACTTTAGG + Intergenic
912828388 1:112927237-112927259 AAGGGTCACCTTAACACTTGTGG - Intronic
915535832 1:156534755-156534777 AGGCGGCCCCTGGACACTTCTGG - Intronic
919501814 1:198346842-198346864 AACTGTCACCTGGACATTTTGGG + Intergenic
920914948 1:210251928-210251950 AGGGGTCACCTGCACACGGGTGG + Intergenic
920932613 1:210402640-210402662 AGGTGTCACCTAGAGCTTTGGGG + Intronic
921772086 1:219052211-219052233 AAGTGGCACTTGGACACTTCAGG + Intergenic
1063954449 10:11253332-11253354 ACTTGACACCTGGACACTGGAGG - Intronic
1067344132 10:45425821-45425843 AGAGGCCACCTGGACACCTGGGG - Intronic
1068868035 10:61915611-61915633 AGGTATCATCTAGACACCTGGGG + Intronic
1069671011 10:70203856-70203878 AGGTGCCCGCTGGACACTGGAGG - Intronic
1070693550 10:78544999-78545021 AGGTGTCACCTGTGCACTACTGG + Intergenic
1073077728 10:100835211-100835233 AGGCTACACCTGGGCACTTGAGG - Intergenic
1073563399 10:104515963-104515985 AGGTGTCACCTGGAACCATGGGG + Intergenic
1073918266 10:108430790-108430812 AATTACCACCTGGACACTTGGGG - Intergenic
1075646287 10:124099018-124099040 GGGTGGCACCTGGGCACCTGTGG + Intergenic
1076927035 10:133496550-133496572 GATTGTCACCTGGACACTTCGGG - Intergenic
1077401531 11:2360502-2360524 AGGTGGCACCTGGGCAGTTGGGG + Intergenic
1077873812 11:6285724-6285746 AGGTAAGACCTGGACACATGTGG + Intergenic
1080423432 11:32134077-32134099 AGGGGGCACCAGGAAACTTGGGG + Intergenic
1080638293 11:34142582-34142604 AGGTGTGACCTGGAGCCTTGGGG - Intronic
1081389686 11:42514900-42514922 AGATGGCACCTGGAAAATTGGGG + Intergenic
1086131894 11:83409669-83409691 AGGTGTCAGCAGGGCACTTGAGG + Intergenic
1086278831 11:85162075-85162097 AATTGCCACCTGGACACTTTGGG + Intronic
1087347798 11:96993119-96993141 GGGTGTCATCTGGTCACTTTAGG + Intergenic
1090762461 11:129849445-129849467 TGGTATCACCTGGAGCCTTGGGG - Intronic
1091859933 12:3771967-3771989 AGATGTCACCTACACAGTTGAGG - Intergenic
1093914107 12:24781429-24781451 AGGTGTCAGCAGGGCACTTAGGG + Intergenic
1095856028 12:46862053-46862075 AATTGCCACCTGGACACTTTGGG - Intergenic
1097955076 12:65476190-65476212 AAGTGGCAGCTGCACACTTGAGG + Intronic
1098311653 12:69154771-69154793 AAGTGTCCCCTGGAAACCTGAGG - Intergenic
1100240914 12:92709968-92709990 AATTGCCACCTGGACACTTTGGG - Intergenic
1100776101 12:97976422-97976444 AGGTCTCACCTGTACCCATGGGG - Intergenic
1101428286 12:104605740-104605762 AGGTGTCAACTGCATATTTGTGG + Intronic
1103362486 12:120362136-120362158 AGGTGTCCCCTGGCCAGCTGAGG - Intronic
1104092791 12:125529648-125529670 AGGTGCCACATGGGCCCTTGGGG + Intronic
1104862774 12:131933091-131933113 AGGTCTTCCCTAGACACTTGGGG + Intronic
1105793270 13:23823971-23823993 AGGTGTCAACTGTATCCTTGGGG + Intronic
1106453098 13:29902285-29902307 AGGTTTCAACTGGAGGCTTGAGG - Intergenic
1106987477 13:35372477-35372499 ATGTATCACCAGGATACTTGAGG - Intronic
1107064767 13:36201162-36201184 AGGTGTCTCCTGGAGCCATGGGG - Intronic
1108860746 13:54855582-54855604 ATGTGAAACGTGGACACTTGAGG + Intergenic
1109885923 13:68544513-68544535 TTGTGTCACCTGGAAACTTTAGG - Intergenic
1110185225 13:72666556-72666578 AGGTGGAAGCTAGACACTTGGGG + Intergenic
1110583101 13:77155875-77155897 AGGTGTAACTTGGACACTTGGGG + Intronic
1114743875 14:25125629-25125651 AGGCCTCATCTGGACATTTGAGG + Intergenic
1115056959 14:29140280-29140302 AGGTGTCACGTGAAAACTAGAGG + Intergenic
1117250327 14:53930064-53930086 TGGGGTCACCTGGCCACTAGGGG + Intergenic
1117791134 14:59343316-59343338 AGGTCTCACCTGGACAACAGAGG - Intronic
1118017626 14:61676007-61676029 AGCTGTTACCTGGTCACTTTGGG - Intergenic
1119704330 14:76774538-76774560 AGGGGTCACCTGGTGGCTTGTGG + Intronic
1120782580 14:88499042-88499064 AAGTGTCACATGGAAACTTGAGG - Intronic
1122052676 14:99070750-99070772 GGGTGCCATGTGGACACTTGGGG - Intergenic
1126358795 15:47823962-47823984 AGTTGACACCAGGACACATGGGG + Intergenic
1128242878 15:66113395-66113417 AGATTTCACCTGGAAGCTTGAGG + Intronic
1128245044 15:66127379-66127401 TGGGGTAGCCTGGACACTTGTGG - Intronic
1129109267 15:73328222-73328244 GGGTGTCAGGTGGACACCTGGGG + Intronic
1132335098 15:101043179-101043201 GGGTGTCACCTGGAGACTTCTGG + Intronic
1133125947 16:3646145-3646167 AGGTGGCACTTGGACACTCTGGG - Intronic
1133617697 16:7493728-7493750 AGGTGTCACCAGGGCTCTGGAGG - Intronic
1133750484 16:8721410-8721432 AGGTGTGACCTGGGCACCGGGGG - Intronic
1133895766 16:9927400-9927422 AGGTGTTACCAGCAAACTTGAGG + Intronic
1134310256 16:13070036-13070058 GGGTGTCACTTGGAAATTTGGGG + Intronic
1135534258 16:23280746-23280768 AGGAGGCACATGGTCACTTGGGG - Intronic
1136086937 16:27891992-27892014 CGGACTCACCTGGGCACTTGTGG + Intronic
1138776115 16:59725917-59725939 AGATGCCACCTGGCCACTTGGGG - Intronic
1141559310 16:84856400-84856422 GGTTGCCACCTGGACACTTTGGG - Intronic
1141999954 16:87658634-87658656 CGGTGTCACCTGGACGCCTCTGG - Intronic
1142880086 17:2877313-2877335 AGCTGTCACCTGGATTATTGAGG + Intronic
1143501805 17:7343603-7343625 AAGTGTCACCTCGAGGCTTGGGG + Intronic
1146428642 17:32768612-32768634 GGTTGTCTCCTGGACACTAGAGG - Intronic
1146625844 17:34434916-34434938 AGGTGTCAGCTGGTGACTTTGGG - Intergenic
1147364648 17:39952186-39952208 AGGGGTCCCCTGGACATTGGCGG + Intergenic
1149001946 17:51766305-51766327 AGCTCTCACATGGAGACTTGTGG - Intronic
1151619142 17:75234575-75234597 AGGTGTCACTTGGGCAATTTGGG + Intronic
1151974557 17:77476885-77476907 AGCTGGCTCCTGGGCACTTGTGG + Intronic
1152104101 17:78318874-78318896 AGGGGACCCCTGGACACTTACGG - Intergenic
1152230959 17:79113912-79113934 AGATGCCTCCTGGACACCTGGGG - Intronic
1152475306 17:80513992-80514014 ACGTGCCACCAGGACACCTGGGG - Intergenic
1152620143 17:81359296-81359318 AGGTGACACCGAGACCCTTGTGG - Intergenic
1157477229 18:48031171-48031193 TGGTGTCTCCTGGCCACTAGAGG + Intronic
1161757302 19:6143600-6143622 AGGTGTCACCTGGACACTTGTGG - Intronic
1162106683 19:8373984-8374006 AGGGGCCATCTGGAAACTTGTGG + Exonic
1163904058 19:20135947-20135969 AGGTGTTAACTGCACATTTGTGG + Intergenic
1163936041 19:20444839-20444861 AGGTTTTACCTGCACATTTGTGG - Intergenic
1164094680 19:21996645-21996667 AGGTGTTACCTGAACATTTGTGG + Intronic
1164102268 19:22067383-22067405 AGGTGTTACCTGCATATTTGTGG - Intronic
1164140675 19:22459221-22459243 AGGTGGTACCTGCACATTTGTGG - Intronic
1164198393 19:22993979-22994001 AAGTGTTACCTGAACATTTGTGG + Intronic
1164584348 19:29457004-29457026 AGCTGTCACCCGGTCATTTGGGG + Intergenic
1164943900 19:32274056-32274078 AGGTCTCAGCTGGAGGCTTGGGG - Intergenic
928398978 2:30964491-30964513 AGGTGTCACCGGGAGTCTCGGGG - Intronic
929204974 2:39280538-39280560 TTGTGGCACCTGGAAACTTGTGG - Intronic
929504310 2:42516450-42516472 AGGAGTAACCTGGACACCTATGG - Intronic
930536399 2:52650629-52650651 GGTTGCCACCTGGACACTTTGGG - Intergenic
931048093 2:58379867-58379889 GGGTATCACTTGGTCACTTGGGG - Intergenic
931288139 2:60849762-60849784 AGGTGGCCCCTGGAAACATGGGG - Intergenic
932870462 2:75393453-75393475 GGTTGCCACCTGGACACTTTGGG - Intergenic
938101692 2:128501881-128501903 AGGGGCCACCAGGACACCTGAGG - Intergenic
938770227 2:134495203-134495225 GGGTGTCTCCTAGCCACTTGTGG - Intronic
939469588 2:142602636-142602658 ATGTGTCATCTGGACACCTTAGG - Intergenic
939789618 2:146555554-146555576 AGGTGTCACCTGGTCCTCTGTGG - Intergenic
944657739 2:201892748-201892770 AGTAATCACATGGACACTTGGGG + Intronic
945179679 2:207079157-207079179 AGCTGCCAATTGGACACTTGGGG - Exonic
945775297 2:214100014-214100036 AGGTCTCCCCTCGACACATGGGG - Intronic
946028536 2:216687377-216687399 AGGTGTCACCTTCCCACCTGTGG - Intronic
1171417084 20:24989586-24989608 AGGGATCACCTTGACACATGAGG - Intronic
1172567455 20:35941813-35941835 AGGTGTGGCCGGGACACATGTGG + Intronic
1173808944 20:45944676-45944698 TCGTGTCCCCTTGACACTTGAGG + Intronic
1178864953 21:36319827-36319849 AGGTTTCACATGGACACTGGTGG + Intergenic
1178938327 21:36883455-36883477 ACCAGTCACCTGGACACATGGGG - Intronic
1181549021 22:23625774-23625796 AGGAGTGACCTGCACACTCGGGG + Intronic
1181748157 22:24970293-24970315 TGATGTCACCTGGACACTGCAGG + Intronic
1183503063 22:38192791-38192813 AGGTGGCACCTGAAATCTTGAGG + Intronic
1184138485 22:42563341-42563363 AGGTGTGGTCTGCACACTTGTGG - Intronic
1185057274 22:48587607-48587629 AGGTGTCCCTGGGACACTTCAGG - Intronic
949639130 3:6015155-6015177 GATTGTCACCTGGACACTTTGGG + Intergenic
950391348 3:12699188-12699210 TGGAATCACCTGGACACTTTTGG + Intergenic
950392500 3:12707665-12707687 AGCTGCCACCTGGTCACTTCAGG - Intergenic
951281690 3:20758129-20758151 AAGTGTCACCTGCAAACTTAAGG - Intergenic
954021245 3:47743913-47743935 AGTCCTAACCTGGACACTTGAGG - Intronic
954054438 3:48009898-48009920 GATTGTCACCTGGACACTTTGGG + Intronic
954359292 3:50110546-50110568 GGGTGTCAGAGGGACACTTGGGG + Intronic
956307086 3:67837265-67837287 GGTTGCCACCTGGACACTTTGGG + Intergenic
956703676 3:71981266-71981288 GAGTGCCACCTGGACACTTTGGG - Intergenic
960405338 3:117252875-117252897 AGGTGTCACCTGGACAGGCTAGG + Intergenic
963355431 3:144205229-144205251 GATTGTCACCTGGACACTTTAGG - Intergenic
964295528 3:155228857-155228879 AGGTGTCAGCTGGTCTCTTCTGG - Intergenic
965652751 3:170950802-170950824 AGCTGCCAATTGGACACTTGGGG - Intergenic
969254682 4:5993967-5993989 AGGTGTCACCTGGGAAGTGGGGG + Intergenic
975399266 4:73915907-73915929 AGCTGCCACCTGGTCACTTTGGG + Intergenic
975410446 4:74042870-74042892 AGATGTCACCTGGAAACTCCTGG + Intergenic
975704038 4:77094105-77094127 AAGTGTCTTCTGAACACTTGAGG + Intergenic
977677319 4:99762377-99762399 AGGTTCCACCTGCACTCTTGGGG + Intergenic
980385578 4:132085419-132085441 AGATGCCACCTGGCCACTTTGGG - Intergenic
980957954 4:139447542-139447564 GATTGTCACCTGGACACTTGGGG + Intergenic
984520458 4:180795936-180795958 TGGTTTCACCTTGACACATGAGG - Intergenic
988780952 5:34521488-34521510 AGCTGTCACCTGGGCTCTCGGGG - Intergenic
989609993 5:43281720-43281742 AAGTGTCACATGGTCACTTTGGG - Intergenic
990630941 5:57668127-57668149 GGGTGTCATGTGGATACTTGTGG - Intergenic
992501465 5:77348136-77348158 GGGTGGCACAGGGACACTTGGGG - Intronic
997379341 5:133424122-133424144 AGGTGTCCCCTGAAATCTTGGGG - Intronic
997399806 5:133593491-133593513 AGGTGACACCTAGAGACTTCCGG + Intronic
999653043 5:153785966-153785988 AGGACTCACATGGAAACTTGAGG - Intronic
1002608667 5:180399412-180399434 AAGTGTCACCTGGGGACTAGTGG + Intergenic
1003965751 6:11250620-11250642 AGGTGTCTCCTGGGGACCTGGGG - Intronic
1006001773 6:30970699-30970721 AATTGCCACCTGGACACTTTGGG + Intergenic
1006968384 6:38013747-38013769 AGGTGTAACCTGGACATTGGAGG - Intronic
1007039956 6:38712453-38712475 AGGTGTAACCTGGCCACCTTGGG + Intergenic
1008151818 6:47962450-47962472 TGGTCTCTCCTTGACACTTGGGG - Intronic
1013011488 6:106124838-106124860 CTCTGTCACCTGGACACATGTGG + Intergenic
1015206233 6:130642671-130642693 AGGTCCCTCCTGGACACATGGGG + Intergenic
1020265274 7:6556386-6556408 TGGTGTCACCTGGCCACCAGAGG + Intergenic
1021989044 7:26124558-26124580 AAGTGCCACCTGGACACTTTGGG + Intergenic
1024913182 7:54469464-54469486 AGCTGAAACCAGGACACTTGAGG - Intergenic
1025774742 7:64550508-64550530 AGGTGTCACCTGCAGATTTATGG + Intronic
1025866113 7:65382741-65382763 AAGTGTTACCTGCACATTTGTGG - Intronic
1027487982 7:78786010-78786032 AGGTGTCTACTGGACATTTATGG + Intronic
1027686017 7:81279582-81279604 GGTTGTCACCTGGCCACTTTGGG + Intergenic
1028112870 7:86963863-86963885 AGCTTTCACCTGCCCACTTGAGG + Intronic
1028838233 7:95397455-95397477 AGGTCTCACCTGTAAAATTGGGG - Intergenic
1029478035 7:100796792-100796814 AGATGACACCTGGACTCTAGGGG + Intronic
1030195549 7:106849769-106849791 ATGTGTCACCTAGACAATGGCGG + Intergenic
1030249297 7:107424354-107424376 AGGTTTCACATGGAAACTTTTGG + Intronic
1031669897 7:124529622-124529644 AGGTCCTCCCTGGACACTTGGGG - Intergenic
1033034577 7:137861906-137861928 AGGTGGGAACTGGAGACTTGAGG + Intergenic
1033652393 7:143352875-143352897 GGGAGTAACCTGGACACTGGAGG - Intergenic
1034299036 7:149999028-149999050 AGCTGTCACCTGGGGGCTTGTGG - Intergenic
1037035332 8:14159483-14159505 AGGATTCACCTGGAGACTTAAGG + Intronic
1037164439 8:15810122-15810144 AAGTATCACCTGCAGACTTGGGG + Intergenic
1038891770 8:31733624-31733646 AGGTGTAACCTGGACTTTTCTGG - Intronic
1039373048 8:37005878-37005900 TGGTGGCTCCTGGCCACTTGTGG + Intergenic
1039531540 8:38267716-38267738 AGGTGTCACCTGGAGGACTGAGG + Intronic
1046417433 8:113936171-113936193 GAGTGCCACCTGGACACTTTGGG - Intergenic
1047105568 8:121727249-121727271 TGGGGTCACCTGGAGACTTTGGG - Intergenic
1048179244 8:132180183-132180205 AGGTGGCACCTGGAAGCTTCTGG - Exonic
1048536155 8:135296924-135296946 AGGTCTCAGCTGAATACTTGAGG - Intergenic
1048643927 8:136396432-136396454 AGGGCCCACCTGGACAATTGTGG - Intergenic
1049065259 8:140308482-140308504 AGGAGTCACCAGGACACTTAGGG + Intronic
1049221818 8:141431976-141431998 GGGTGCCACCTGGGCACCTGGGG + Exonic
1049607064 8:143534654-143534676 CGGTATCCCCTGGTCACTTGGGG - Intronic
1049706546 8:144045834-144045856 ATGTGTGACCTGGGCAGTTGTGG - Intronic
1051398805 9:16657196-16657218 GGTTTTCACCTGCACACTTGGGG - Intronic
1052561349 9:30088364-30088386 GGTTGCCACCTGGACACTTTGGG - Intergenic
1052737109 9:32353936-32353958 GATTGCCACCTGGACACTTGGGG - Intergenic
1056148797 9:83764222-83764244 TAGTTTCACCTTGACACTTGGGG - Intronic
1056773238 9:89494929-89494951 ATGTGTCTCATGGACATTTGTGG - Intronic
1058617827 9:106852615-106852637 AGCTGTCACCTGGACATCTCAGG - Intergenic
1059427931 9:114232632-114232654 CGGTGTCACCTGACCACATGAGG - Intronic
1061752097 9:132786166-132786188 AGGTGCCACCTGGGAACTGGTGG + Intronic
1062008275 9:134252661-134252683 AGGTGTCACGGGGACACTGCTGG + Intergenic
1187428842 X:19203362-19203384 AGGTGGCACCCGGACATTTCTGG - Intergenic
1189664736 X:43341892-43341914 TAGTGTCACCTGGAAAGTTGTGG + Intergenic
1191658579 X:63628176-63628198 AATTCTCACCTGGACACTTTGGG - Intergenic
1193288149 X:79737841-79737863 GGTTGCCACCTGGACACTTTGGG + Intergenic
1194457173 X:94119106-94119128 GATTGTCACCTGGACACTTTGGG + Intergenic
1198934259 X:141889481-141889503 GGTTGTCACCTGGACACTCTGGG + Intronic
1199137749 X:144273030-144273052 AGGTGGCACCTTGACTGTTGTGG - Intergenic
1199795597 X:151192301-151192323 AGGTGCCACCTGGACAGTGTTGG - Intergenic
1200020019 X:153195435-153195457 AGGTGGAAACAGGACACTTGGGG + Intergenic