ID: 1161757609

View in Genome Browser
Species Human (GRCh38)
Location 19:6145808-6145830
Sequence GTTGTTGAGGGGGTTGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 6, 3: 19, 4: 275}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161757609_1161757617 30 Left 1161757609 19:6145808-6145830 CCCTCAACAACCCCCTCAACAAC 0: 1
1: 0
2: 6
3: 19
4: 275
Right 1161757617 19:6145861-6145883 TCTTACTCATGTTGTGTGTCTGG 0: 1
1: 0
2: 2
3: 8
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161757609 Original CRISPR GTTGTTGAGGGGGTTGTTGA GGG (reversed) Intronic
900110683 1:1004250-1004272 GTGTGTGAGGGGGGTGTTGAGGG - Intergenic
900423544 1:2566130-2566152 GGTGTTTAGGTGGTTGGTGAAGG - Intergenic
901729349 1:11267600-11267622 GTTTTTAAGGGGATTGTAGAGGG + Intergenic
902645035 1:17792000-17792022 GTTCCTGATGGGGTTGATGAGGG - Intronic
903672161 1:25042974-25042996 GAAGCTGAGGGGGTTGCTGAGGG - Intergenic
904072587 1:27813083-27813105 GTTTTTGAGGTGGAGGTTGAGGG + Intronic
905808313 1:40893111-40893133 GTTGTTGTTGTTGTTGTTGATGG - Intergenic
906782400 1:48584382-48584404 CTGGGTGAGGGTGTTGTTGAAGG - Intronic
907629946 1:56070466-56070488 GTTGTTGAGTGGATAATTGATGG - Intergenic
907840037 1:58148167-58148189 GATGGTGAGGGGGTTGCAGATGG - Intronic
908863940 1:68524434-68524456 GTGGTTGAGTGGGTAGTTTAGGG + Intergenic
911319556 1:96396156-96396178 GTTGTTGTTGTGGTTGTTGGGGG + Intergenic
911439677 1:97909613-97909635 GCTGTTGGGAGGGTAGTTGAGGG - Intronic
911964238 1:104346211-104346233 GTTGTTGTTGTTGTTGTTGATGG + Intergenic
912385384 1:109268782-109268804 GTTGGGGAGGGGTTTGTGGAGGG + Intronic
912547940 1:110464854-110464876 GCTGTAGAGGGGCTTGTTGAAGG - Intergenic
913532980 1:119746158-119746180 GTAGTTGAGGGGGGTGTCTAGGG + Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914846766 1:151287790-151287812 GCTGTTGAGGATCTTGTTGAAGG - Exonic
915487814 1:156234256-156234278 GTTGTTGAGGGGATTAGGGAGGG + Intronic
915737546 1:158094491-158094513 GTGGTTGGGAGGGTTTTTGAAGG + Intronic
915772715 1:158445619-158445641 GTAGTTAAGGGGGTTGCAGATGG + Intergenic
915941356 1:160120501-160120523 GTTTTGTGGGGGGTTGTTGAGGG - Intronic
917528048 1:175806997-175807019 ATTGTTTAGGAGGATGTTGAGGG + Intergenic
917754156 1:178082753-178082775 AGTGTTGAGGGTGTGGTTGAAGG + Intergenic
918284631 1:183040016-183040038 GTTGGTGAGGGTGGTGTTGGAGG + Intronic
918425060 1:184400689-184400711 GTTGTTGTTGTTGTTGTTGATGG + Intronic
920727441 1:208449542-208449564 GTGGTTGTGGGGGTGGTTGCAGG - Intergenic
921627757 1:217396894-217396916 ACTGTTGAGGTGGCTGTTGAAGG - Intergenic
922755451 1:228094116-228094138 GGGGTCGAGGGGGTTGGTGACGG + Intronic
923070647 1:230561630-230561652 GTGGTGGAGGGGGGTGTTGTTGG + Intergenic
923601578 1:235407789-235407811 CTTGTTGAAGGGGTAGTTGAGGG + Intronic
924821170 1:247491976-247491998 GTAGATGAGGGGGTTGATGCTGG - Intergenic
1063805217 10:9631380-9631402 GTTGTTGTTGTTGTTGTTGATGG + Intergenic
1064360839 10:14662864-14662886 GTTGGTGAGGGGGTTGCCAACGG + Intronic
1064828455 10:19433238-19433260 TTTGTTGAGGGGGTCAGTGAAGG + Intronic
1065208030 10:23375530-23375552 GCAGGTGAGGGGGTTGGTGATGG - Intergenic
1065919392 10:30378831-30378853 GCTGTTGAGGATGTTGTGGATGG + Intergenic
1067007910 10:42682132-42682154 GTTGTTTAGGGTGTTTCTGAAGG - Intergenic
1071777090 10:88801308-88801330 CTTTTTGATGGGGTTGTTTAAGG - Intergenic
1073634715 10:105185787-105185809 GTTCTAGAAGGGGTTGTGGAAGG - Intronic
1074570719 10:114621705-114621727 GGTGTTGAGAGGGATGCTGATGG - Intronic
1076557697 10:131339306-131339328 TTTGAAGAGGGGTTTGTTGAAGG - Intergenic
1076659826 10:132048140-132048162 GATGTTGAGGGCGATGTTGCTGG + Intergenic
1077156575 11:1094699-1094721 GTGGTTGTGGTGGTTGTTGGAGG - Intergenic
1077156607 11:1094816-1094838 GTGGTTGTGGTGGTTGTTGGAGG - Intergenic
1077930588 11:6727946-6727968 GGTGGTGAGGGGGATGATGAGGG + Intergenic
1079264508 11:18917560-18917582 GCTGTTGAGGTGGCTGCTGAAGG - Intergenic
1079614983 11:22481056-22481078 CATGTTGAGGGGGTCTTTGATGG + Intergenic
1081479002 11:43466411-43466433 GCTGTTGATGGTGATGTTGAAGG - Intronic
1083423096 11:62567167-62567189 GTTGCTGAGTGTGTTGTTGCTGG - Intronic
1083591273 11:63896591-63896613 GTTGTTGAGGGCGATGCTCATGG + Intronic
1087277816 11:96177860-96177882 GTTTTTGAGGGAATTTTTGAGGG + Intronic
1089255141 11:117190168-117190190 GTTGCTGAGGATGTTGTTGAAGG - Exonic
1089932350 11:122326184-122326206 GTTTTAGAGGGGGTTGTTGATGG + Intergenic
1090127345 11:124101026-124101048 TTTTTTGAGGGGGGTGTGGAAGG + Intergenic
1091139236 11:133221160-133221182 GCTGCTAAGGGGGTGGTTGACGG - Intronic
1092238580 12:6824263-6824285 GTTGCTGAGGCGGTAGTTGACGG - Exonic
1093522606 12:20067714-20067736 GTTGTTGTTGTTGTTGTTGATGG - Intergenic
1095939427 12:47716427-47716449 GTTGTTGAGGAGGTTGATGAAGG + Exonic
1096436356 12:51593172-51593194 GTTGGTGAGGTGGTGGTTGTGGG + Intronic
1097153266 12:56994899-56994921 GGGATTGAGGGGGTTGTTGAGGG + Intronic
1097622927 12:61963528-61963550 CTTTTTGATGGGGTTGTTTAGGG + Intronic
1099621042 12:85003211-85003233 GTTGTTGTTGTTGTTGTTGATGG + Intergenic
1101353567 12:103956216-103956238 GTTGTTGGGGGGGTGGTGGGGGG + Intronic
1101700402 12:107168560-107168582 GTTGCTGTGGGGATTGTTGAAGG + Intergenic
1102844054 12:116159038-116159060 TTTGTTGAAGTTGTTGTTGAAGG - Intronic
1103654059 12:122456417-122456439 GTTGAAGAGGGGGTTGGTGTGGG + Intergenic
1103920483 12:124396775-124396797 GTAGTTGTGGGGGGTGCTGAGGG - Intronic
1104398096 12:128452573-128452595 GTTGGTGGGGGGGTTGTAGGGGG + Intronic
1104730078 12:131100310-131100332 GTTGATGATGGGTTGGTTGATGG + Intronic
1107870732 13:44744327-44744349 GTTGTTGTTGTTGTTGTTGAAGG - Intergenic
1110447807 13:75606781-75606803 GTTGTTCAGTGGGATGATGATGG + Intergenic
1111664254 13:91247019-91247041 GATGTTTTGGGGGTTTTTGAAGG + Intergenic
1111980014 13:95005334-95005356 GTGGCTGAGGGAGTTTTTGAGGG - Intergenic
1112972149 13:105273714-105273736 GGTGGTGGGGGGGTTGTTGGGGG + Intergenic
1117069492 14:52043786-52043808 GGTGTGGCGGGGGTTGTGGATGG + Intronic
1117075778 14:52102696-52102718 GATGAAGAGGGGGTTGTTAATGG - Intergenic
1119464667 14:74846455-74846477 TTTGTGGAGGAGGTTGTAGATGG + Intronic
1119536190 14:75404234-75404256 GTTTCTGAGGGTGCTGTTGATGG + Intergenic
1120324392 14:83006938-83006960 TTTGTTGAGGGACTTCTTGATGG + Intergenic
1120698572 14:87672311-87672333 GTAGTGGAGGGGGTGGGTGAGGG + Intergenic
1128120232 15:65140648-65140670 ATTTTTAAGGGGGTTGTGGAGGG - Intergenic
1129036263 15:72650413-72650435 GCTGTTGAGGATGTTGTGGATGG - Intergenic
1129213626 15:74086811-74086833 GCTGTTGAGGATGTTGTGGATGG + Intergenic
1129396777 15:75254274-75254296 GCTGTTGAGGATGTTGTGGATGG - Intergenic
1129400387 15:75278551-75278573 GCTGTTGAGGATGTTGTGGATGG - Intronic
1129474006 15:75771260-75771282 GCTGTTGAGGATGTTGTGGATGG - Intergenic
1129672586 15:77615544-77615566 GAGGTTGAAGAGGTTGTTGAAGG + Exonic
1129730763 15:77931135-77931157 GCTGTTGAGGATGTTGTGGATGG + Intergenic
1131074107 15:89484071-89484093 GTTGTTGATGGGGTGGGTGGGGG + Intronic
1131187470 15:90287266-90287288 GCTGTTGAGGATGTTGTGGATGG - Intronic
1131368328 15:91858483-91858505 GTTTGTGAGGGGGTTTTTGTTGG + Intronic
1131444405 15:92485177-92485199 GGTGTTGAGGGGATATTTGATGG + Intronic
1133396796 16:5453896-5453918 TTTGTTGGGGTGGTTGGTGAAGG + Intergenic
1134142343 16:11731885-11731907 GTGGTTGATGGGGTTGGTGGTGG - Intronic
1134223334 16:12372544-12372566 GTTCATGAGGGGGTGGTAGATGG + Intronic
1134296782 16:12953205-12953227 GTTGTTGTTGTTGTTGTTGAGGG - Intronic
1135551669 16:23403246-23403268 GTTTTTGAGGGGGCTTTGGAGGG - Intronic
1138313841 16:56051399-56051421 ATTGTTGGGGGGGGTGGTGATGG + Intergenic
1139348090 16:66317426-66317448 GTTGTTAAGAGGGTGGATGAGGG - Intergenic
1139703167 16:68722082-68722104 GTTGTTGATGTTGTTGTTGTTGG - Intronic
1139861566 16:70026098-70026120 TTTGTTGAGGCCGTTGGTGAGGG - Intergenic
1140187616 16:72788681-72788703 GCTGCTGGGGGGGTTGCTGAGGG + Exonic
1140355850 16:74305570-74305592 GTTGTTGATGAGGTTGTGCAGGG - Exonic
1140666034 16:77228428-77228450 CTTGCTGAGGGGGTTCTTGAAGG - Intergenic
1140734240 16:77883918-77883940 GGTGATGATGGGGTTGTTAAAGG - Intronic
1142103546 16:88289326-88289348 GATGATGAGGGTGTTGATGAGGG + Intergenic
1142103548 16:88289338-88289360 GTTGATGAGGGTGTTGATGAGGG + Intergenic
1142123937 16:88400923-88400945 GTTGTTCAGCGGGTTGTTTCTGG - Intergenic
1142411657 16:89920130-89920152 GTAGATGAGGGGGTCGATGATGG - Exonic
1144798536 17:17909664-17909686 GTTCTGGAGATGGTTGTTGATGG + Intronic
1145755041 17:27384276-27384298 GAGGTTAAGCGGGTTGTTGAAGG + Intergenic
1146120409 17:30188975-30188997 TTTTTTGAGGGGGGTGTGGAGGG + Intergenic
1146675409 17:34770157-34770179 GTTGTTGATGGTGATGGTGATGG + Intergenic
1147499272 17:40946827-40946849 GTAGTTTAGAGGGTTGTTGTGGG + Intergenic
1148088146 17:45006823-45006845 GTTGTGGAGGGGGTTGGAGGGGG - Intergenic
1148372285 17:47109484-47109506 GTTGTTGAGGTGTATGTTCAGGG + Intergenic
1150549765 17:66198530-66198552 GTTGTTGATGAGGTTGTGCAGGG - Intergenic
1153479169 18:5529899-5529921 GTTGATGGTGGGGTTGGTGATGG - Intronic
1155270118 18:24132762-24132784 GATGTTGAGGAGGATGATGATGG + Exonic
1155833450 18:30547419-30547441 ATTGTTGTTGTGGTTGTTGAGGG + Intergenic
1156891833 18:42199044-42199066 TTTGGTGAGGGGGCTGTTGCTGG + Intergenic
1157455642 18:47826494-47826516 GTTTTTGTGGAGGTTGTAGAAGG - Exonic
1161757609 19:6145808-6145830 GTTGTTGAGGGGGTTGTTGAGGG - Intronic
1162730465 19:12715455-12715477 GATGTTGAGGGGCCTGTTGAGGG + Exonic
1163626075 19:18390494-18390516 GTCGGGGAGGGGGTAGTTGAGGG + Intergenic
1163809785 19:19423711-19423733 GTTGTAGAGGGGGTTGGGGATGG + Intronic
1164713624 19:30376255-30376277 TTTGTTGAGGGTGATGGTGATGG + Intronic
1166117951 19:40667323-40667345 GTGGTTGTCGGGGTGGTTGAGGG + Exonic
1166596323 19:44053308-44053330 CTTGGTGAGGGGGATGTGGAAGG + Intronic
1167132211 19:47594279-47594301 GTTGGTGAGGGGCTGGTGGAAGG - Intergenic
925841232 2:7994286-7994308 GTTGTTCAGGGGTTTTATGAAGG + Intergenic
925948309 2:8887260-8887282 TTTTTTGAGGGGGTGGTGGAGGG - Intronic
930842699 2:55864926-55864948 GTTGTTGGGGGAGTGGTTGGGGG + Intergenic
930937422 2:56970591-56970613 GTTGTTGAGGTCTTTGGTGATGG - Intergenic
931676013 2:64696940-64696962 GTTGTTGTGAGGGTATTTGAAGG + Intronic
931952070 2:67375626-67375648 GTTGTTGTTGTTGTTGTTGATGG + Intergenic
932020834 2:68084703-68084725 GTTGGTGAGGGTGTGGTTGAAGG - Intronic
933358050 2:81239749-81239771 GTTGTTGAGGGAGTGGAGGATGG - Intergenic
933651820 2:84855828-84855850 GGGGTTGAGGGGGTGGGTGAGGG + Intronic
934509593 2:94926823-94926845 GTTGTTGAGGGCGTTTACGAAGG - Intergenic
935545474 2:104395731-104395753 CTTGGTGATGGAGTTGTTGACGG + Intergenic
936893120 2:117395393-117395415 TTTGTTGAGGGGCTTGTCTAGGG + Intergenic
939391236 2:141571360-141571382 GTTGTTGATGCTGTTGTTGTTGG - Intronic
940025913 2:149207990-149208012 GGGGTTGAGGGGGTAGATGAGGG - Intronic
942414980 2:175748990-175749012 GTTGTTCAGGCTGTTGTTCAAGG - Intergenic
942959756 2:181816026-181816048 GTTTTTGAGTGGCTTATTGAAGG - Intergenic
943356428 2:186861809-186861831 GTTGTTGACGGTGATGGTGATGG - Intergenic
944337830 2:198558322-198558344 ATTTTTGAGGGGCTTTTTGATGG - Intronic
945683802 2:212944801-212944823 GTTGTTGGGGATGTTGTTGATGG + Intergenic
947186689 2:227461662-227461684 GTTGTAGAGGAGGTTGTTGATGG + Intergenic
947451502 2:230212902-230212924 TTGGTTGAGGGGGTTGTGGTGGG + Exonic
947624777 2:231612769-231612791 GTTGTTGGGGGGGTGGTGGGGGG - Intergenic
1172229416 20:33326917-33326939 GGTGTTGAGGGGGTTGTCTATGG - Intergenic
1173596196 20:44259828-44259850 GTTGTTGAGGGGGCTGTTGCTGG - Intronic
1175959360 20:62627387-62627409 GATGATGATGGGGTTGGTGATGG - Intergenic
1176333213 21:5569681-5569703 GATGTTGATGGGGTTTTAGAGGG - Intergenic
1176394544 21:6251271-6251293 GATGTTGATGGGGTTTTAGAGGG + Intergenic
1176442613 21:6737833-6737855 GATGTTGATGGGGTTTTAGAGGG - Intergenic
1176466875 21:7064903-7064925 GATGTTGATGGGGTTTTAGAGGG - Intronic
1176490436 21:7446681-7446703 GATGTTGATGGGGTTTTAGAGGG - Intergenic
1176510206 21:7691702-7691724 GATGTTGATGGGGTTTTAGAGGG + Intergenic
1177445295 21:21187437-21187459 GTTGTTGTTGTTGTTGTTGATGG - Intronic
1177628084 21:23690632-23690654 GTTGGGGAGGGGGTGGTTGTAGG - Intergenic
1177842918 21:26254623-26254645 GTTATTGAAGGAATTGTTGAAGG + Intergenic
1179416407 21:41202211-41202233 TTTGATTAGGGGATTGTTGAAGG + Intronic
1179485130 21:41705203-41705225 GCTTTTGAGGTGGGTGTTGAAGG - Intergenic
1179817665 21:43917938-43917960 GGTGTTGTGGGGGTTGTAGGGGG + Intronic
1179987353 21:44929149-44929171 GTTGCAGAGGGGGTTGGTGAGGG - Intronic
1182697272 22:32205829-32205851 AGTGGGGAGGGGGTTGTTGAGGG + Intergenic
1182929845 22:34162582-34162604 GTTATTGATAGGGTTATTGATGG + Intergenic
1182965803 22:34520006-34520028 GTTGTTGACGACGTTGTTGTTGG - Intergenic
1183176397 22:36227630-36227652 CAGGTTGAGAGGGTTGTTGAAGG - Exonic
1183661582 22:39224633-39224655 GCTGTTGAGGTGGCTGTAGATGG - Exonic
1184263678 22:43334565-43334587 GTTGATGAGGGTGATGATGATGG - Intronic
1185103670 22:48855237-48855259 GTTGTTGGGTGGGTAGATGATGG - Intergenic
1185136162 22:49073977-49073999 GGTGTTGATGGTGGTGTTGATGG - Intergenic
949895754 3:8766697-8766719 GTAGTTGAAGGGGGTGTTGGGGG - Intronic
950670540 3:14522842-14522864 GTCATTCAGGGAGTTGTTGATGG - Intronic
953726479 3:45403637-45403659 GTGGTTGAGGGGCTTGTAGGTGG + Intronic
954197920 3:49007323-49007345 GTAGCTGAGGGCGCTGTTGATGG + Exonic
954541108 3:51393342-51393364 GTTGCTGAGGGAGTTGCTGCTGG - Exonic
955539985 3:59964597-59964619 GATGTTGTGGGGTTTGTTGGGGG - Intronic
955633239 3:60997499-60997521 AGTGTTGAGGGGGGTGTGGATGG + Intronic
956475456 3:69614778-69614800 GCTGTTGAGGTGGTTGTTCCTGG + Intergenic
956960920 3:74399794-74399816 GTTGTGGAGAGATTTGTTGAAGG - Intronic
959255348 3:104004212-104004234 ATTGTTGAGGGAGTTGGGGACGG - Intergenic
960444352 3:117729584-117729606 GGTGGGGTGGGGGTTGTTGAGGG - Intergenic
961232848 3:125334783-125334805 GTGGTGGAGGTGGTCGTTGATGG - Intronic
961613411 3:128159615-128159637 GTCGTTGATGGGATCGTTGATGG - Intronic
962520885 3:136196397-136196419 GCTGTGGAGGGGGTTGTTAGAGG - Intronic
962976038 3:140446665-140446687 GTTCTTGAGCAGGTTATTGAAGG - Intronic
968154860 3:196371832-196371854 TTTGTAGTGTGGGTTGTTGAGGG - Intronic
968615421 4:1575527-1575549 GCTGTCAAGGGGGTTGCTGAAGG + Intergenic
970868610 4:20786864-20786886 GATGTTAAGGGAGTTGTTCAAGG - Intronic
971848372 4:31949210-31949232 TTTGTTGAAGGGGTGGTTGCTGG + Intergenic
975274659 4:72482633-72482655 GTAGTTGAGGATGTTATTGAGGG + Intronic
978582698 4:110248096-110248118 GTTGTTGAGGGGGAGGCAGAAGG + Intergenic
979219530 4:118206131-118206153 GGTGTTGTGGGTGTTGTAGAGGG - Intronic
980166332 4:129232482-129232504 GGTGGGGAGGGGGTTGCTGATGG + Intergenic
980867689 4:138572673-138572695 GTTGTTGAGGGGATTGAATAAGG + Intergenic
982624537 4:157749847-157749869 CTTGTTGATGGGGTTGTTTCTGG - Intergenic
983248077 4:165311544-165311566 GTTGGTGTGGGTGTTGTTGGAGG + Exonic
983491077 4:168390009-168390031 GATGATGAGGTGGTTGTTGAGGG + Intronic
986315176 5:6582379-6582401 GTTATTGATGAGGTTATTGATGG - Intergenic
986875806 5:12107497-12107519 GTTGTTTAGGGAATTGTTTAGGG - Intergenic
989059316 5:37394506-37394528 GTTGTTGTGGGAGTATTTGAAGG + Intronic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
990919481 5:60946084-60946106 GTAGTTGAGCGGGTTGTTTGGGG + Intronic
993092442 5:83442580-83442602 TTTTTTGAGGGGGTTGTTGGAGG + Intergenic
994430370 5:99651368-99651390 GTTGTTGAGATGTTTGTTAAAGG + Intergenic
995169880 5:109095431-109095453 GTTGCTGAGTGGGGTGATGATGG - Intronic
995979285 5:118081885-118081907 GTTGTAGATGGAGTTGTAGATGG - Intergenic
996019555 5:118576600-118576622 GGTGATGAGAGGGTTGGTGAAGG + Intergenic
996877850 5:128259704-128259726 GTTGTTGAGGGGCTGGATGGCGG + Exonic
997197719 5:131990821-131990843 GTTGTGGGGGGGGGTGTGGAGGG - Intronic
998439203 5:142142238-142142260 GCTGTTGAGGAGGTGGTAGATGG - Intronic
999217607 5:149948380-149948402 GTTGTTGAGGGGTGGGTTAAGGG - Intergenic
1000047692 5:157535168-157535190 GTGGTCAAGGGGGTTGTTTAAGG + Intronic
1001105250 5:168847889-168847911 GTTTTTGAGAGGGTCTTTGAAGG - Intronic
1001632917 5:173189913-173189935 GTGGTTGAGGGGGGAATTGAGGG - Intergenic
1001845928 5:174921414-174921436 GCTGTTGAGGATGTTGTGGATGG + Intergenic
1003958753 6:11190297-11190319 CTTGTTCTGGGGCTTGTTGATGG + Exonic
1005040581 6:21596246-21596268 GTTATTGATGTTGTTGTTGATGG + Exonic
1005241515 6:23835230-23835252 GTTGTTGTGGGGACTGTTGTGGG - Intergenic
1006521290 6:34572716-34572738 GTTGGTGAGGGGGTTGGAGGTGG - Intergenic
1006954960 6:37860845-37860867 GGTGTTGAGGTGGATGTAGAAGG + Intronic
1009269978 6:61603305-61603327 GTTGTGGAGGGAGGTATTGAGGG - Intergenic
1012528583 6:100206659-100206681 ATTGGTGAGGGGGTGATTGAGGG - Intergenic
1015256238 6:131182548-131182570 TCTGTTGATGGGTTTGTTGATGG + Intronic
1015473171 6:133629399-133629421 GCAGTTGAGGTGCTTGTTGAAGG + Intergenic
1015914887 6:138205767-138205789 GTTGTTGAGGGGCACGGTGAGGG + Intronic
1016437541 6:144052746-144052768 GTGGGGGAGGGGGTTGTGGAGGG + Intronic
1016789862 6:148056716-148056738 CTTGTTGTGGGGGTTGGGGAGGG - Intergenic
1017666761 6:156726622-156726644 GTTGTTGAGGGAGCAGTGGAGGG + Intergenic
1018841638 6:167521700-167521722 GTTGTTGAGTTGGCTGTGGACGG - Intergenic
1019769315 7:2873549-2873571 GCTGTTGAGGGGGATGTAGCAGG + Intergenic
1022441678 7:30438137-30438159 GTTGCTGATGGGGTTTCTGAAGG - Intronic
1024504623 7:50151520-50151542 TCTGGTGATGGGGTTGTTGATGG - Exonic
1024531818 7:50400008-50400030 GTAGTTGATGGCGTTGTTGATGG - Exonic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027260953 7:76464191-76464213 GTAGTTGAGGGGGGTTGTGAAGG + Intronic
1027312330 7:76962303-76962325 GTAGTTGAGGGGGGTTGTGAAGG + Intergenic
1030701462 7:112646296-112646318 GTTGTTGATGCTGTTGTTGTTGG + Intergenic
1032349265 7:131144982-131145004 GTTGTTGTGGTTGTTGTTGCTGG - Intronic
1032934473 7:136713020-136713042 GTTGATGAGGGAGTTGCTGTTGG - Intergenic
1033538664 7:142335667-142335689 GTTGATGAAGGTGTTGTTTAAGG + Intergenic
1033714633 7:143986845-143986867 TTTGGGGAGGGGGTGGTTGATGG + Intergenic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034299950 7:150006646-150006668 GAGGTTCAGTGGGTTGTTGAGGG - Intergenic
1034806096 7:154090667-154090689 GAGGTTCAGTGGGTTGTTGAGGG + Intronic
1036448657 8:8845923-8845945 CGAGTTGAAGGGGTTGTTGATGG - Intronic
1037205946 8:16320471-16320493 GTTGTTGATGTTGTTTTTGAAGG - Intronic
1037422503 8:18718171-18718193 CTTGTTGAGGGTGTTGTTTTAGG - Intronic
1037784254 8:21893175-21893197 GGTGTTGTGGGGGTTGCAGAGGG - Intergenic
1038130903 8:24730353-24730375 GATGTTAAGGAGGTTGTTCAGGG - Intergenic
1038142785 8:24864842-24864864 GTGGTTGGGTGGGCTGTTGAGGG - Intergenic
1041125639 8:54635841-54635863 TTTCTTGTGGGGGTTGTAGATGG - Intergenic
1041536831 8:58936155-58936177 GTTCTTTAGGTGGTTGTTGAAGG + Intronic
1042839190 8:73106558-73106580 GTTGATGAGGGACTCGTTGAGGG + Intronic
1043339197 8:79217165-79217187 GTTCTGGAGATGGTTGTTGATGG - Intergenic
1044146808 8:88725883-88725905 AGGGTTGAAGGGGTTGTTGAGGG + Intergenic
1044563077 8:93632821-93632843 GTTTTTGTTGTGGTTGTTGATGG - Intergenic
1046509485 8:115183681-115183703 GTTGTGGAGGATTTTGTTGATGG + Intergenic
1048302551 8:133262139-133262161 GTTGAAGAGGGGGTTGTAGCAGG + Exonic
1048395924 8:134013917-134013939 ATTGATGTGGGGGTTCTTGAAGG + Intergenic
1048529743 8:135236448-135236470 GTTTTCAAGGGGGTTATTGATGG + Intergenic
1049543216 8:143218008-143218030 GGTGTTGGGGGTGGTGTTGAGGG - Intergenic
1050747972 9:8899620-8899642 GTTGTTGAGGGTGGTTTTAAAGG + Intronic
1051624609 9:19086870-19086892 TTTGTTGGGGTGGTTGTTGGTGG - Intronic
1052112142 9:24599426-24599448 GTTGTTGTTGTTGTTGTTGAAGG - Intergenic
1052737063 9:32353632-32353654 GATGCTGAGGTGGTTGCTGAAGG - Intergenic
1053054614 9:34987272-34987294 GTTGTTGAGAGGGTTAATTAAGG - Intergenic
1053906167 9:42846656-42846678 GTTGTTGAGGTCGTTTATGAAGG + Intergenic
1055702795 9:78964215-78964237 GTTGTTGAGGGGATTAATGGAGG - Intergenic
1055738907 9:79364294-79364316 GTTGTTAAGTGGGTTGTCCATGG - Intergenic
1056835299 9:89950240-89950262 GTGGTGGAGGGGCTTGGTGATGG + Intergenic
1057372768 9:94489020-94489042 GTTGTTGAGGGTGTTGATGAAGG + Intergenic
1058577590 9:106420562-106420584 GTTGCAGAGGGGGTTGGAGAGGG + Intergenic
1061050591 9:128192451-128192473 GTTGTTAAGGGGGTTCTTGGGGG - Intronic
1062041837 9:134407870-134407892 TGTGTTGGGGGGGGTGTTGAAGG + Intronic
1062726281 9:138075850-138075872 GTTGTTGTGGCGGTTGATGCTGG - Exonic
1203428483 Un_GL000195v1:65541-65563 GATGTTGATGGGGTTTTAGAGGG + Intergenic
1186170090 X:6867601-6867623 GTTGGTGATGGTGATGTTGATGG + Intergenic
1186659291 X:11652386-11652408 GTTTTTGTTGGGTTTGTTGAAGG - Intronic
1189117141 X:38354886-38354908 GTTGTTGAGGGCTTTGTCAAAGG - Intronic
1189304686 X:39978068-39978090 TTTTTTGAGGAGGTTGGTGAAGG - Intergenic
1189944207 X:46160522-46160544 GTTGTTGTTGTGGTTGTTGGTGG - Intergenic
1190390961 X:49931160-49931182 GTTGTTGAGGTGATTGTTGAAGG + Intronic
1192283797 X:69712369-69712391 CTTTTTGATGGGGTTGTTTAAGG - Intronic
1192632171 X:72785743-72785765 ATTGCTGAGGGGGCTGGTGACGG - Intronic
1192649538 X:72935058-72935080 ATTGCTGAGGGGGCTGGTGACGG + Intronic
1193759482 X:85446570-85446592 TTTTCTGATGGGGTTGTTGATGG - Intergenic
1195527685 X:105910678-105910700 GTTTTTAAGGGGATTGTAGAGGG + Intronic
1198766088 X:140080479-140080501 CCTGTTGAGGGGGTTACTGAGGG + Intergenic
1199105203 X:143858152-143858174 GTTGGGGAGGGGGTGGTGGAAGG + Intergenic
1201667519 Y:16475187-16475209 GTTCTTGAGGGTATTGTGGAGGG + Intergenic
1201699621 Y:16866105-16866127 GGTGTTGAGGGTGGTGATGATGG + Intergenic