ID: 1161760597

View in Genome Browser
Species Human (GRCh38)
Location 19:6168265-6168287
Sequence GTGTGGAAAAATACTTCCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 167}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161760597_1161760602 6 Left 1161760597 19:6168265-6168287 CCGTGGGAAGTATTTTTCCACAC 0: 1
1: 0
2: 1
3: 17
4: 167
Right 1161760602 19:6168294-6168316 TTCCCTCCCCTCCTTCGGGTGGG 0: 1
1: 0
2: 0
3: 15
4: 169
1161760597_1161760599 1 Left 1161760597 19:6168265-6168287 CCGTGGGAAGTATTTTTCCACAC 0: 1
1: 0
2: 1
3: 17
4: 167
Right 1161760599 19:6168289-6168311 GCTTGTTCCCTCCCCTCCTTCGG 0: 1
1: 2
2: 5
3: 41
4: 275
1161760597_1161760600 2 Left 1161760597 19:6168265-6168287 CCGTGGGAAGTATTTTTCCACAC 0: 1
1: 0
2: 1
3: 17
4: 167
Right 1161760600 19:6168290-6168312 CTTGTTCCCTCCCCTCCTTCGGG 0: 1
1: 5
2: 19
3: 89
4: 575
1161760597_1161760601 5 Left 1161760597 19:6168265-6168287 CCGTGGGAAGTATTTTTCCACAC 0: 1
1: 0
2: 1
3: 17
4: 167
Right 1161760601 19:6168293-6168315 GTTCCCTCCCCTCCTTCGGGTGG 0: 1
1: 0
2: 0
3: 15
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161760597 Original CRISPR GTGTGGAAAAATACTTCCCA CGG (reversed) Intronic
900425416 1:2576185-2576207 CTGTGGGAAAATGCTGCCCATGG - Intergenic
900543546 1:3216173-3216195 ATGTGGAAACATTTTTCCCATGG - Intronic
901567511 1:10130722-10130744 TGGTTGAAAAATACTTCTCAGGG + Exonic
904636486 1:31885424-31885446 TTGTTTAAAAATACTTCCCATGG + Intergenic
906656072 1:47549214-47549236 GTGGGGAAAAACACTTGCCCAGG - Intergenic
906858448 1:49332595-49332617 TTGTGGAATAATATTTCACAGGG + Intronic
908142744 1:61204060-61204082 TGGTGGCAAAATACATCCCACGG - Intronic
908153875 1:61332698-61332720 GTGTGTCAAAATTCTTCCAATGG - Intronic
910609435 1:89125825-89125847 GGGTGGGAAAATATTTACCAGGG - Intronic
911105910 1:94131369-94131391 GCGTGGGAAAATATTTCACATGG + Intergenic
913711355 1:121487001-121487023 GTGAGGAGAAATACTCCCAATGG + Intergenic
915235687 1:154479413-154479435 CTTCAGAAAAATACTTCCCATGG - Intronic
916334087 1:163650413-163650435 ATGTGGAAAACTACCCCCCAAGG - Intergenic
916566159 1:165980451-165980473 GTGTGGAAAAAGATATTCCATGG - Intergenic
922495077 1:226050701-226050723 GTTTGGAAAAACACATTCCAGGG + Intergenic
923889051 1:238190844-238190866 GTGGGGAAAAATAATTACCTGGG + Intergenic
1064724703 10:18266928-18266950 CTGTGCAAATATATTTCCCAAGG - Intronic
1065126013 10:22575141-22575163 GTATGTCAAAATACTTCACACGG + Intronic
1066321097 10:34304673-34304695 GTGTGGAGAAGAACTTACCAAGG - Intronic
1069279796 10:66640723-66640745 GGGGGGAAAAATTCTTCCCTGGG - Intronic
1072495626 10:95955644-95955666 TTGTGTAAAAATATTTCACAGGG + Intronic
1073591264 10:104759668-104759690 GTGTAGAAAAAGATATCCCAAGG - Intronic
1073660541 10:105471440-105471462 GTGTTGAAGAAGTCTTCCCAAGG + Intergenic
1075782340 10:125025609-125025631 GTGTGGAAACGTACCTCTCACGG - Intronic
1075971260 10:126655613-126655635 GTGTGGAAATGTCCTTCCCCAGG + Intronic
1078943989 11:16043267-16043289 GTGTGGAAAGCTACAACCCAGGG + Intronic
1079545293 11:21626426-21626448 GAGGTGAAAAATACTGCCCATGG - Intergenic
1080666274 11:34339102-34339124 GTTTTAAAAAATACCTCCCAGGG - Intronic
1080666522 11:34341187-34341209 GTTTTAAAAAATACCTCCCAGGG - Intronic
1080821824 11:35814672-35814694 GTATGGAAAAATCCTTGCCTGGG - Exonic
1081391277 11:42532195-42532217 GAGTGAAAAAATAATTCTCATGG + Intergenic
1081811888 11:45918753-45918775 GTTTGGGAAGATACTCCCCAGGG - Intronic
1085146991 11:74209401-74209423 GTGTTTAAAAATAGCTCCCATGG - Intronic
1087206898 11:95405886-95405908 GTGGGCAAAGATACTACCCAAGG - Intergenic
1088069143 11:105759761-105759783 GTGTGGAAGAAGACTTCCAGAGG - Intronic
1092547092 12:9461636-9461658 TTGATGAAAAAAACTTCCCATGG + Intergenic
1094505846 12:31060428-31060450 CTGATGAAAAAAACTTCCCATGG - Intergenic
1095096397 12:38151741-38151763 GTCTGGGAAAAAACTTCCCATGG + Intergenic
1098027379 12:66218844-66218866 GAGTAGAAAAATAGTTACCAAGG - Intronic
1098286773 12:68915106-68915128 CTATGGAAACATAGTTCCCATGG + Intronic
1100732964 12:97493908-97493930 GTTTGGAAATATAAATCCCATGG + Intergenic
1107165340 13:37276783-37276805 GAGTGGAGAAATAGTTTCCAGGG - Intergenic
1108856892 13:54803781-54803803 GTGTGGAGAAATGCTGGCCAAGG - Intergenic
1109101326 13:58187096-58187118 GTGCTAAAAAATAATTCCCAAGG - Intergenic
1119016413 14:71061034-71061056 GTGAGGAAAATTACTTCACAGGG + Intronic
1119032047 14:71200418-71200440 GTGTGGAAAAATACTTTAGTCGG + Intergenic
1119198498 14:72735138-72735160 GTTTGGAAAAAGACTTTTCAAGG - Intronic
1119229017 14:72965685-72965707 GTGTGGAAATTTACTTTCTAGGG - Intergenic
1120798135 14:88658726-88658748 GTGTAAAAAAATACTTACCATGG + Intronic
1121017739 14:90558627-90558649 TTGTGGAAAAAAATTTTCCAAGG - Intronic
1123167211 14:106337405-106337427 GTTTGGGAAAATAAATCCCAGGG + Intergenic
1123169829 14:106362116-106362138 GTTTGGGAAAATAAATCCCAGGG + Intergenic
1123199199 14:106645780-106645802 GTTTGGGAAAATAAATCCCAGGG + Intergenic
1129558530 15:76540041-76540063 GTCTTTAAAAATAATTCCCAGGG + Intronic
1129967985 15:79753781-79753803 GTGTGGAAACTTATTTCCTAGGG - Intergenic
1130793489 15:87181939-87181961 GTGTGTAAAAAAACTAACCAAGG + Intergenic
1136242685 16:28954094-28954116 CTGAGGTATAATACTTCCCAGGG - Intronic
1137254340 16:46762667-46762689 GTCTGGAACATTTCTTCCCAAGG - Intronic
1137960533 16:52877697-52877719 GTGTGGAAAATAACATGCCATGG - Intergenic
1141354093 16:83327250-83327272 GTGTGCAAAAATATTTTACATGG - Intronic
1142921645 17:3192909-3192931 GTGCAGAAAAATAATTCCCAAGG - Intergenic
1146659532 17:34655258-34655280 ATGTGGAAAAACATTTCCCGGGG - Intergenic
1147044185 17:37741606-37741628 GGATGGAAAAATACTTTCAACGG + Intronic
1150455217 17:65301823-65301845 GTGAGGAACAATGCATCCCAAGG - Intergenic
1153261587 18:3229499-3229521 TTCTGGGCAAATACTTCCCAAGG - Intergenic
1153307934 18:3649910-3649932 GTGTGGAAAGAAATTTCCAAGGG - Intronic
1155683230 18:28515512-28515534 GTTTAGAAAGATACTTCTCAGGG + Intergenic
1156529348 18:37799735-37799757 GAGGGGAAAAACACATCCCAGGG - Intergenic
1157026004 18:43844698-43844720 ATTTGGAAAAACACTTCACATGG + Intergenic
1157084378 18:44564005-44564027 GTATGGAAAAATTCTTTCCCCGG + Intergenic
1157617268 18:48994695-48994717 TTGTGTAGAAATAGTTCCCAGGG + Intergenic
1158636741 18:59165643-59165665 AAGTGGAAAAACACTTCCCATGG + Intergenic
1161740410 19:6017833-6017855 GAGTGGACAGATATTTCCCAGGG - Intronic
1161760597 19:6168265-6168287 GTGTGGAAAAATACTTCCCACGG - Intronic
1164481557 19:28615031-28615053 GTATGGAGAAATACTTGCCTTGG + Intergenic
1165853722 19:38867298-38867320 GTGGGGAAGAATACTCCGCAGGG - Intergenic
925287459 2:2725148-2725170 GTATGGAAAAAGATTTGCCAAGG - Intergenic
925597938 2:5575164-5575186 GTGTGAACAGATACTTCTCATGG - Intergenic
927052169 2:19340931-19340953 CAGTGTAAAAATACTTCCTAAGG - Intergenic
928449384 2:31365064-31365086 GTGAGAAATAAAACTTCCCAGGG - Intronic
930902009 2:56518817-56518839 GTGAGGAAAAAGAATTCACAAGG + Intergenic
931728436 2:65132153-65132175 GTTTGGGAGTATACTTCCCAGGG - Intergenic
936708272 2:115101552-115101574 GTGAGGAAAAATGCTTCGTAGGG - Intronic
942048896 2:172120424-172120446 GTGGAGGAAAATACTTGCCAGGG + Intergenic
943273634 2:185840604-185840626 GTGTAAAAAAATACTTACCATGG + Intergenic
943969429 2:194384909-194384931 GTTTTGCAAAATGCTTCCCAAGG + Intergenic
1171098140 20:22352640-22352662 AGGTGGAAAAAGACTTCTCAAGG - Intergenic
1174374122 20:50114089-50114111 ATTTGCAAAAATATTTCCCAAGG - Intronic
1177107055 21:16970175-16970197 GTTTAGAAAAATAGTTCCCAGGG + Intergenic
1177866214 21:26515880-26515902 GTGTGGAAACAAACTTCTGAGGG - Intronic
1177922436 21:27169345-27169367 GTGTGTAAAAATACATACAAGGG + Intergenic
1178167395 21:29995551-29995573 GTTGGGAAAAATGTTTCCCAAGG + Intergenic
1179354848 21:40649631-40649653 GGGTGGAAAAAAACATGCCAAGG + Intronic
1179425927 21:41278478-41278500 TTGTGGAAAAACACTCCCCTCGG - Intronic
1181749013 22:24976169-24976191 ATGTGGAGCAATCCTTCCCAGGG - Intronic
1182302771 22:29347047-29347069 GAGGGGAAAAACTCTTCCCATGG + Intronic
1182949329 22:34357098-34357120 TTGTGGAAAACTACTACCCTTGG - Intergenic
1183850470 22:40582592-40582614 GTCTAAAAAAAAACTTCCCAAGG + Intronic
1185335905 22:50270717-50270739 GTCTTGAAAAATACTTCCCATGG - Intronic
950665232 3:14491332-14491354 ATGTAGAAAAATACTTTACAAGG + Exonic
950930349 3:16783204-16783226 GTGAGGAGAAGTAGTTCCCAGGG + Intergenic
951228757 3:20151455-20151477 GTGTGGAAAAATAAGTCAAATGG - Intronic
951433024 3:22630137-22630159 GCGTGGAAGTATATTTCCCATGG - Intergenic
952650897 3:35725570-35725592 GGGAGGAAGGATACTTCCCAAGG - Intronic
960704756 3:120471118-120471140 GTGTGGAAAAGCACTCTCCATGG - Intergenic
960818892 3:121705840-121705862 ATGTGAAAAAACACTTCTCAGGG + Intronic
962972606 3:140418157-140418179 TTGTGAAAATATACTTCTCATGG + Intronic
963986415 3:151599516-151599538 GGGTGGAAAATTACAGCCCATGG + Intergenic
965089007 3:164139195-164139217 GTATGGAAAAAGACTTACAAAGG + Intergenic
965846713 3:172970746-172970768 CTGTGGAAAAATTTTTCACATGG + Intronic
966322448 3:178716008-178716030 GTATGGAAAGATACCTCACAGGG - Intronic
966499561 3:180624258-180624280 GGGTGGAAAAAGACATTCCATGG - Intronic
970568088 4:17352042-17352064 GAGAGGAAAGATACTTCCCCGGG - Intergenic
972344818 4:38183786-38183808 GTGTGGAAAGATATTTACCATGG + Intergenic
972710861 4:41593179-41593201 GTGTATAAAAACATTTCCCAAGG - Intronic
974061042 4:57036251-57036273 GTGTGGAAAGATACAAACCAGGG + Intronic
976621783 4:87135725-87135747 ATGTGCAAAAATAGTTCCCAAGG - Exonic
980383510 4:132058112-132058134 GTGGGGAAAAATAGTTCCATGGG + Intergenic
981897696 4:149823371-149823393 GTTTGGAAAAATATTAACCAAGG + Intergenic
982029235 4:151282495-151282517 TTGTTGAAAAATATTTTCCATGG - Intronic
982066181 4:151656800-151656822 CTGTGGAGAGAGACTTCCCAGGG + Exonic
982417187 4:155149161-155149183 CTGGGGAAGAATACTTCCCAAGG + Intergenic
983195446 4:164801241-164801263 CTGTGGATAAGTAGTTCCCATGG - Intergenic
983396079 4:167197166-167197188 GTGTGTAATAATCCATCCCAAGG - Intronic
984563127 4:181294217-181294239 ATTTGGAAAAATACATCCAATGG + Intergenic
986880901 5:12169680-12169702 GTGTGGGAAAAATCTTCTCAGGG + Intergenic
987518478 5:18947103-18947125 GTGCCCACAAATACTTCCCAGGG + Intergenic
988024314 5:25665593-25665615 GTGTGGAGAAATTCGTCACATGG + Intergenic
998495400 5:142584013-142584035 AGGAGGAAAAATTCTTCCCAGGG - Intergenic
999225036 5:150014812-150014834 GTGGGGGAACATATTTCCCAGGG + Intronic
1004873232 6:19928832-19928854 GTGGGAAAAAAAACCTCCCATGG - Intergenic
1007431272 6:41778937-41778959 CTCTGGAGAAACACTTCCCAGGG + Intronic
1008526488 6:52412592-52412614 GTGGAGAAAAATCCCTCCCAAGG - Intergenic
1009346630 6:62620420-62620442 GTCTTGAAAAATGTTTCCCACGG + Intergenic
1010392614 6:75354831-75354853 GTGATGAAAATTACTTTCCAGGG - Intronic
1011151488 6:84278519-84278541 CTGTGGAAATGTACTTCACAGGG - Intergenic
1012859052 6:104537317-104537339 TTGTTTAAAAATACTTTCCAGGG - Intergenic
1013993044 6:116277297-116277319 GAATGGAAAAATACTTTTCAGGG - Exonic
1014568426 6:122979189-122979211 GAGTGGAAAAATACTGGACAAGG + Intergenic
1015886602 6:137924405-137924427 GTGTGGAGAAATAGTTGCAAAGG - Intergenic
1016766810 6:147803997-147804019 GTGTGAAAAAAGCTTTCCCAAGG - Intergenic
1018238560 6:161750304-161750326 GTGTGGAAAGAAATTTCCCTTGG - Intronic
1018287332 6:162254952-162254974 ATGAGGAATAATACTTCCCATGG - Intronic
1021054341 7:16028406-16028428 GTAGGTAAAAATTCTTCCCAGGG + Intergenic
1022201639 7:28123030-28123052 GAGTTGGAAAAAACTTCCCAGGG - Intronic
1022879048 7:34566849-34566871 GGGTGGAAAGCCACTTCCCATGG - Intergenic
1028084400 7:86618355-86618377 GTGTGCAATAATGGTTCCCAGGG + Intergenic
1030789924 7:113711755-113711777 TAGTGGAAAAATACTTTCAAAGG - Intergenic
1031591343 7:123595801-123595823 GTGTAGACAAATACTTTCAAGGG - Intronic
1032682378 7:134198407-134198429 GTCTGGAAAAATACTTCAGCTGG - Intronic
1032861019 7:135879230-135879252 GTGGGGAAAATTTCCTCCCAGGG + Intergenic
1032868078 7:135949257-135949279 GTAAGCAAAAATATTTCCCAGGG + Intronic
1033605080 7:142921128-142921150 GTGTGGACAAATAGATCCCACGG + Intronic
1034087860 7:148336834-148336856 GTGTGGAAAGAAACCTACCAGGG + Intronic
1036133057 8:6134198-6134220 GCATCCAAAAATACTTCCCAAGG + Intergenic
1038102731 8:24396991-24397013 CTATGGAAAAATATTTACCACGG + Intronic
1039416130 8:37395556-37395578 GAGAGGAAAAATACTGCCCTGGG + Intergenic
1042023659 8:64399662-64399684 TAGTGGAAAAATAATTCCCAGGG - Intergenic
1044464946 8:92491916-92491938 GGAGGGAAAAATACTTCCCCTGG - Intergenic
1044931575 8:97257137-97257159 GTGTGGAAGAACACTACACAAGG + Intergenic
1045480227 8:102586074-102586096 GACAGGAAAATTACTTCCCATGG + Intergenic
1045563161 8:103285634-103285656 GTGGGGAAAAATCCAACCCAGGG + Intergenic
1045837647 8:106541768-106541790 GTGGTTAAAAATAGTTCCCAAGG + Intronic
1046235552 8:111420062-111420084 GTGCCGAAATATACTTCCCAAGG - Intergenic
1046411349 8:113847461-113847483 GGATGGAAAAATACCTACCAAGG + Intergenic
1047036622 8:120946640-120946662 GTGGGGAAAAACACTTGCAATGG + Intergenic
1048962898 8:139594916-139594938 ATGTGGAAAGAGGCTTCCCAAGG - Intergenic
1052655063 9:31348466-31348488 GTGTGGAAAAAACCTTCCACAGG + Intergenic
1056956656 9:91087571-91087593 GTGTGGGAGAACACTTCACAAGG + Intergenic
1059495064 9:114702655-114702677 CTGTGGAAAGAGATTTCCCACGG + Intergenic
1062101441 9:134730635-134730657 GGGTGGCGTAATACTTCCCAGGG + Intronic
1062369606 9:136231048-136231070 CTGTGTAAATTTACTTCCCATGG - Intronic
1186937659 X:14468335-14468357 TTGTGGAAAAATGTTGCCCATGG + Intergenic
1188139913 X:26537179-26537201 GAGGGGAAAAATACTTCCTAGGG - Intergenic
1188676809 X:32951568-32951590 CAGTAGAAAAATTCTTCCCATGG + Intronic
1189891340 X:45605569-45605591 GAGGGGAACAATACTTACCAAGG - Intergenic
1191142250 X:57127798-57127820 GTTTGGAAGAATACATACCAGGG - Intergenic
1191652801 X:63559904-63559926 GTGTTGAAAAAAAATTCCTAAGG + Intergenic
1191701383 X:64046316-64046338 GTATGGAACAATGGTTCCCAGGG + Intergenic
1193398038 X:81009371-81009393 GTATGGAGAAATATTTACCAAGG - Intergenic
1195080890 X:101369183-101369205 TTGTGGATAAATATTTCCCAAGG - Intronic
1195487659 X:105427397-105427419 ATTTGGAAAAATCCTTCTCAGGG - Intronic
1197311372 X:124909578-124909600 GAGTGGAATAATACTTCAAAAGG - Intronic
1199922506 X:152423792-152423814 ATGTGGACAAATAATTACCAAGG + Intronic
1201764911 Y:17567126-17567148 GTCCGGGAAAAAACTTCCCACGG - Intergenic
1201836641 Y:18338863-18338885 GTCCGGGAAAAAACTTCCCACGG + Intergenic