ID: 1161761973

View in Genome Browser
Species Human (GRCh38)
Location 19:6180252-6180274
Sequence GTTAGAACGTGGACATCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1508
Summary {0: 2, 1: 8, 2: 140, 3: 416, 4: 942}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161761967_1161761973 10 Left 1161761967 19:6180219-6180241 CCATGAAAGATTACATATTCACA 0: 1
1: 1
2: 54
3: 275
4: 959
Right 1161761973 19:6180252-6180274 GTTAGAACGTGGACATCTTTAGG 0: 2
1: 8
2: 140
3: 416
4: 942
1161761966_1161761973 17 Left 1161761966 19:6180212-6180234 CCTTTTGCCATGAAAGATTACAT 0: 1
1: 1
2: 42
3: 291
4: 977
Right 1161761973 19:6180252-6180274 GTTAGAACGTGGACATCTTTAGG 0: 2
1: 8
2: 140
3: 416
4: 942
1161761965_1161761973 18 Left 1161761965 19:6180211-6180233 CCCTTTTGCCATGAAAGATTACA 0: 1
1: 1
2: 28
3: 245
4: 918
Right 1161761973 19:6180252-6180274 GTTAGAACGTGGACATCTTTAGG 0: 2
1: 8
2: 140
3: 416
4: 942

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161761973 Original CRISPR GTTAGAACGTGGACATCTTT AGG Intronic
900717913 1:4156982-4157004 ATTAGGATGGGGACATCTTTGGG - Intergenic
900726889 1:4222483-4222505 ATTAGAACGGGGACTTCTCTGGG - Intergenic
900783402 1:4632284-4632306 ATGAGGACGTGGACATCTTTGGG + Intergenic
900872570 1:5314539-5314561 ATTAGGACATGGACATCTTTGGG + Intergenic
900890920 1:5449176-5449198 ATTAGGACGTGGACATCTGTGGG - Intergenic
900937903 1:5778553-5778575 ATTAGAATGTGGATTTCTTTGGG - Intergenic
900961195 1:5921930-5921952 GTTAGGACGTGGGTATCTCTGGG - Intronic
901130204 1:6957788-6957810 ATTATGACGTGGACATCTTTAGG + Intronic
901316540 1:8313902-8313924 CTTACAACGTGGACAGCTTGTGG - Intergenic
901758389 1:11455243-11455265 GTTTGAACATGGACGTCTTTGGG + Intergenic
901825997 1:11861697-11861719 ATTAGAATATGGACATCTTTTGG - Intergenic
902180519 1:14684914-14684936 TTTAGGATGGGGACATCTTTGGG + Intronic
902666204 1:17940390-17940412 ATTAGAATGTGGATGTCTTTGGG + Intergenic
902934838 1:19757551-19757573 ATTAGGATGTGAACATCTTTGGG + Intronic
903316988 1:22515770-22515792 ATTAGGACATGGACATCTTTGGG + Intronic
903376927 1:22872471-22872493 ATTAAGACGTGAACATCTTTGGG + Intronic
903456077 1:23487779-23487801 ATTAGGACCTGGATATCTTTGGG + Intergenic
903683657 1:25114934-25114956 ATTAGAATGCTGACATCTTTGGG + Intergenic
903741048 1:25558827-25558849 ATTAGGATGTGGACATCTTGGGG + Intronic
904312505 1:29638083-29638105 ATTAGCATGTGGATATCTTTGGG + Intergenic
904417272 1:30371011-30371033 ATTAGGAAGTGGACCTCTTTAGG + Intergenic
904590617 1:31613437-31613459 GTTAGGACGTGGACATCTTTGGG + Intergenic
905235755 1:36546576-36546598 ATTAGGACATGGACATCCTTAGG - Intergenic
905251357 1:36650782-36650804 ATTCGAACATGGATATCTTTGGG - Intergenic
905541268 1:38762326-38762348 GTTAGAACACAGACATCTTTGGG + Intergenic
906484808 1:46226112-46226134 ATTAGGAATTGGACATCTTTGGG + Intergenic
906770828 1:48480811-48480833 ATAAGGACATGGACATCTTTGGG + Intergenic
906892701 1:49735120-49735142 ATTAGAACGTGGACTTTTGTGGG - Intronic
906935481 1:50210797-50210819 ATTAGAATGTGGACATTTTTAGG - Intergenic
907107051 1:51892810-51892832 ATTAGGACGTAGACATCCTTGGG + Intergenic
907580553 1:55568485-55568507 GTTAGGACATGATCATCTTTAGG - Intergenic
908037942 1:60075838-60075860 ATTAAAAGGTGGACATCTTGAGG - Intergenic
908067315 1:60420994-60421016 ATTAGAATGTGGACATCTTTGGG - Intergenic
908632021 1:66119705-66119727 GTTAGGACTTCAACATCTTTTGG - Intronic
908854722 1:68412504-68412526 GTTAGGATGTGAACACCTTTGGG + Intergenic
908979880 1:69942826-69942848 ATTAGGATGTGAACATCTTTGGG + Intronic
909026249 1:70485674-70485696 ATTAGGATATGGACATCTTTGGG - Intergenic
909157932 1:72104170-72104192 ATTAGGACATAGACATCTTTGGG - Intronic
909363749 1:74796116-74796138 ATTAGGACGTGGACATCTTTGGG - Intergenic
909410455 1:75344392-75344414 ATTAGGATGTGAACATCTTTGGG - Intronic
909600153 1:77453124-77453146 TTCAGAACGGGGACATCTCTGGG - Intronic
909686416 1:78354188-78354210 ATTAGAATATGGACATCCTTAGG + Intronic
909859525 1:80587526-80587548 AATAGGACATGGACATCTTTGGG + Intergenic
909973786 1:82022017-82022039 ATTAGGACATGGACATCTTTGGG - Intergenic
910144799 1:84067245-84067267 ATTAGGACATGGACATCTTTGGG + Intergenic
910202538 1:84714157-84714179 ATTAGAATGTGGACATTTTGGGG + Intergenic
910207828 1:84765399-84765421 TTTAGGACATGGACATCTTTGGG + Intergenic
910425797 1:87119113-87119135 TTAGGAATGTGGACATCTTTGGG - Intronic
910810967 1:91235920-91235942 ATTAGAATGTGGACATCTTCAGG + Intergenic
911217168 1:95207527-95207549 ATTAGGACATGGACATCTTTGGG - Intronic
911701029 1:100951802-100951824 ATTAGGACTTGGCCATCTTTGGG - Intronic
911716838 1:101142847-101142869 ATTTGGACATGGACATCTTTGGG + Intergenic
911722123 1:101202819-101202841 TTTTGAATGTAGACATCTTTAGG + Intergenic
912144697 1:106778941-106778963 ATCAGAACATGCACATCTTTGGG + Intergenic
912154157 1:106896793-106896815 GTTAAAATGTGTACTTCTTTAGG - Intergenic
912254919 1:108048631-108048653 ATTAGAATGTGGACGTCTTGAGG - Intergenic
912336042 1:108863842-108863864 ATTAGTACTTAGACATCTTTTGG + Intronic
912465604 1:109871361-109871383 ATTAGGACATAGACATCTTTGGG - Intergenic
912553584 1:110500089-110500111 ATTAGGATCTGGACATCTTTGGG + Intergenic
912819748 1:112857326-112857348 ATTAAAACATGGACATCTTTGGG - Intergenic
913387666 1:118277480-118277502 ATTAAGATGTGGACATCTTTAGG + Intergenic
913390637 1:118307716-118307738 ATTAGAATGTGGACATCTTTAGG - Intergenic
913968443 1:143395661-143395683 GTTAGGACGTGGACATCTTTGGG - Intergenic
914062821 1:144221257-144221279 GTTAGGACGTGGACATCTTTGGG - Intergenic
914116329 1:144745097-144745119 GTTAGGACGTGGACATCTTTGGG + Intergenic
914324768 1:146601816-146601838 GTCAGGACCTGGACATCTTTGGG - Intergenic
914349543 1:146828376-146828398 ATTAGGATGTGGACATCTTTCGG + Intergenic
915157959 1:153893984-153894006 GTTAGTATGGGGACATTTTTTGG - Intronic
915743326 1:158136920-158136942 ACTAGGATGTGGACATCTTTGGG - Intergenic
915775398 1:158479549-158479571 ATTAAAACATAGACATCTTTGGG - Intergenic
915922158 1:159984144-159984166 ATTAGAATGTGGACATCCTGGGG - Intergenic
916034808 1:160912395-160912417 ATTAGAATGTGGACATCTTTGGG + Intergenic
916337977 1:163694620-163694642 ATTAGGATGTGGACATATTTGGG - Intergenic
916345945 1:163791667-163791689 ATTAGAATGTGGACATCTCTGGG - Intergenic
916378283 1:164180057-164180079 GTGAGTATGTGAACATCTTTGGG + Intergenic
916475097 1:165161785-165161807 GATAGGATGTGGACATCTTTTGG - Intergenic
916632909 1:166636150-166636172 ATTAGGACATGGATATCTTTTGG + Intergenic
916867647 1:168877766-168877788 ATTAGGACATGGAGATCTTTGGG - Intergenic
916885717 1:169065781-169065803 GTAAGGATGTAGACATCTTTGGG + Intergenic
917017372 1:170548438-170548460 ATTAGAAAGTGAATATCTTTGGG + Intronic
917134713 1:171778474-171778496 ATTAGGAGGTAGACATCTTTAGG + Intergenic
917137324 1:171800189-171800211 ATTAGGACATGGACATCTTTGGG - Intronic
917141343 1:171839012-171839034 ATTAAAATGTGGACATCTTTGGG + Intergenic
917278668 1:173357949-173357971 ATTAGGACATGAACATCTTTTGG - Intergenic
917593577 1:176503466-176503488 ATTAGGAAGTAGACATCTTTGGG + Intronic
917644949 1:177020675-177020697 ATGAGAATGTGGACATTTTTGGG + Intronic
918057286 1:181032991-181033013 ATTAGGTTGTGGACATCTTTGGG + Intergenic
918153793 1:181823475-181823497 GTTAGGACATGGATATCTTTAGG - Intergenic
918191387 1:182178259-182178281 ATTACAACATGGACATCCTTTGG - Intergenic
918308138 1:183265767-183265789 ATTAGAACCTGGATATCTTTCGG - Intronic
918436398 1:184517833-184517855 GTTAGAACCATGAGATCTTTGGG - Intronic
918489355 1:185064048-185064070 ATTAGGACGTGGACACCTTTGGG + Intronic
918555419 1:185793559-185793581 GTTAGGATGTGGACATCTTTGGG + Intronic
918861505 1:189832139-189832161 ATTACAACCTGGATATCTTTTGG + Intergenic
919126820 1:193404936-193404958 ATTAGGACGTGAACATCTTTGGG - Intergenic
919281884 1:195500733-195500755 ATTTGGACTTGGACATCTTTGGG - Intergenic
919500887 1:198336996-198337018 ATTAGGCCATGGACATCTTTAGG + Intergenic
919559381 1:199098115-199098137 ATTAAAACCTGGATATCTTTGGG - Intergenic
920521691 1:206632208-206632230 ATTAGGATGCGGACATCTTTGGG + Intergenic
921130563 1:212216032-212216054 GTTGGTAAGTGAACATCTTTTGG - Intergenic
921151548 1:212407012-212407034 ATTAACACTTGGACATCTTTGGG - Intronic
921493420 1:215807004-215807026 ATTAGGATGTGGACATCTTAGGG - Intronic
921732264 1:218591634-218591656 ATTAGAACATGGACATCACTGGG - Intergenic
922073379 1:222218111-222218133 ATTAGGACCTGGAAATCTTTTGG - Intergenic
922121943 1:222679859-222679881 ATTGGGATGTGGACATCTTTGGG + Intronic
922340243 1:224649076-224649098 ATTAGGACATGAACATCTTTGGG - Intronic
922591705 1:226782295-226782317 GTGAGAACGTGGACGTCTCTGGG + Intergenic
922999781 1:229997364-229997386 ATTAGAACGTGAATATCTTTGGG + Intergenic
923181252 1:231521963-231521985 ATAAGGATGTGGACATCTTTGGG + Intergenic
923230100 1:231977659-231977681 ATTAGAACATGGACATATCTGGG + Intronic
923436042 1:233969040-233969062 GTTAGAATTTTGACATATTTTGG + Intronic
923573144 1:235134664-235134686 GAAAGAACTGGGACATCTTTTGG + Intronic
923629273 1:235639235-235639257 ATTAGAGGGTGGCCATCTTTGGG + Intronic
923899367 1:238309175-238309197 ATTAGAACATGAACATCTTTGGG - Intergenic
924039690 1:239972188-239972210 GTGAGAAAGTGGACATCTCATGG - Intergenic
924238897 1:242022509-242022531 ATTAGGATGTGAACATCTTTGGG + Intergenic
924322007 1:242859960-242859982 ATTAGGACATGGGCATCTTTGGG - Intergenic
924661041 1:246017066-246017088 GTCAGAACATGAACATTTTTAGG + Intronic
1063180129 10:3590789-3590811 ATTAGAAAGTGGATATTTTTGGG - Intergenic
1063562621 10:7143528-7143550 AGTAGAAAGTGGACATCTATGGG + Intergenic
1063736567 10:8762092-8762114 GTAAGAATGTGAACATCTTGGGG + Intergenic
1063793159 10:9478402-9478424 ATTAGGATTTGGACATCTTTAGG + Intergenic
1064204687 10:13313080-13313102 ATTAGGGCGTGAACATCTTTGGG - Intergenic
1064504467 10:16013962-16013984 ATTAGAAGGTGGACATCTTTTGG + Intergenic
1064540211 10:16397471-16397493 ATTAGGACATGGACATCTCTGGG + Intergenic
1064618150 10:17185115-17185137 AATAGGACATGGACATCTTTGGG + Intronic
1064722550 10:18244730-18244752 ATTGGAACATGGACATCTTTGGG - Intronic
1064897113 10:20249728-20249750 ATTAGGACATGGACATCTTTGGG + Intronic
1065241646 10:23711204-23711226 ATTAGAATGTGGACATCTTCTGG - Intronic
1065404383 10:25347466-25347488 ATTAGGATGTGGCCATCTTTGGG + Intronic
1065694992 10:28371497-28371519 ATTAGGATGTGGACATCTTTCGG + Intergenic
1065841526 10:29705284-29705306 ATTAGAATGTGGATATCTTTTGG - Intronic
1065859597 10:29860811-29860833 ATTAGGACGTGGACATCTTTGGG - Intergenic
1066021894 10:31312234-31312256 ATTAGGACGTGGACATCGTTGGG - Intergenic
1066031780 10:31434981-31435003 ATTAGGACATGGACATATTTGGG - Intronic
1066317191 10:34259622-34259644 ATTAGGGCGTGGGCATCTTTGGG + Intronic
1066434970 10:35389104-35389126 ATTAGGACGAGGACATCTTTGGG + Intronic
1066589127 10:36973885-36973907 ATTAGAATGTGGACATCTTTTGG - Intergenic
1066674412 10:37873328-37873350 ATTAGGACGTGGATATCTGTGGG + Intergenic
1067132325 10:43575849-43575871 GTTAGGACATGGACATATTTGGG + Intergenic
1067930151 10:50552690-50552712 ATTAGGACATGGATATCTTTTGG - Intronic
1068043436 10:51856278-51856300 ATTATGACATGGACATCTTTGGG + Intronic
1068291420 10:55006441-55006463 GTTTTAACTTGGACATATTTAGG + Intronic
1068372521 10:56136407-56136429 ATTAGGACATTGACATCTTTGGG - Intergenic
1068445964 10:57123921-57123943 ACTAGGACGTAGACATCTTTGGG - Intergenic
1068554257 10:58440305-58440327 ATTAGAATGTGGTCATCTCTGGG + Intergenic
1068564180 10:58553152-58553174 ATTTGAATATGGACATCTTTGGG - Intronic
1068581527 10:58745851-58745873 GTTAGGATGTGGAGATCTTTGGG + Intronic
1068680155 10:59810763-59810785 ATTAGCATGTGGACATCTTTAGG - Intronic
1069018694 10:63462445-63462467 ATTAGGACATGGATATCTTTGGG - Intronic
1069086552 10:64146625-64146647 ATTAGGACATGGACATCATTGGG - Intergenic
1069321435 10:67176578-67176600 ATTTGAATGTGGACATCTCTGGG - Intronic
1069510217 10:69036537-69036559 ATTAAGACATGGACATCTTTGGG + Intergenic
1069802685 10:71091879-71091901 ATTAGGATGTGGACATCTTTTGG - Intergenic
1070170649 10:73930247-73930269 ATTAGGATGTGTACATCTTTGGG + Intergenic
1070379620 10:75868935-75868957 CTTAAAACCTGTACATCTTTGGG - Intronic
1071370745 10:84949046-84949068 TTTAGGATGTAGACATCTTTGGG + Intergenic
1071528907 10:86374385-86374407 ATTAGCATGTGGACATCTGTTGG - Intergenic
1071776027 10:88789082-88789104 ATTAGAATATGGACATCATTGGG - Intergenic
1071805597 10:89117063-89117085 ATTAGGATGTAGACATCTTTGGG - Intergenic
1071943965 10:90619632-90619654 GTGAGGACCTGGACATCTTTAGG + Intergenic
1071967184 10:90863718-90863740 TTCAGAAGGTGGACAACTTTTGG + Intergenic
1071976024 10:90956180-90956202 GTTAGGACCTGGATACCTTTGGG - Intergenic
1073816105 10:107209196-107209218 GTTAGGATGTGGACACTTTTGGG - Intergenic
1073987031 10:109221389-109221411 ATTGGGATGTGGACATCTTTAGG - Intergenic
1074303803 10:112257291-112257313 ATCAGGACATGGACATCTTTAGG - Intergenic
1074471041 10:113726921-113726943 GTTAGGGCGTGGACATCTTTGGG + Intronic
1074845095 10:117390774-117390796 ATTAGGATGTGGACAACTTTGGG - Intergenic
1075272769 10:121067757-121067779 GTTAGAAGGTGGACATTTGGGGG - Intergenic
1075283135 10:121158447-121158469 ATTAGGACATGGACACCTTTGGG + Intergenic
1075476646 10:122741093-122741115 ATTAGAATGTGGATATCTTTGGG + Intergenic
1075611929 10:123861446-123861468 ATTAGAGCGTGGACATCTTTGGG - Intronic
1075923418 10:126232076-126232098 ATTAGAATGTGTACATCTTTGGG - Intronic
1076291840 10:129351501-129351523 ATCAGGACATGGACATCTTTGGG - Intergenic
1076420088 10:130325309-130325331 ATCAGGACATGGACATCTTTGGG - Intergenic
1076427380 10:130377179-130377201 GTTAGGACTTGGACATAGTTTGG - Intergenic
1077289587 11:1782710-1782732 ATTAGAATGTAGACATCTTCGGG - Intergenic
1077671487 11:4161759-4161781 AGTAGAACATGGGCATCTTTAGG - Intergenic
1077933570 11:6758870-6758892 GTAGGAATGTGAACATCTTTGGG + Intergenic
1078120775 11:8506710-8506732 ATTAGGACGTGGACACCTTTGGG + Intronic
1078360174 11:10661846-10661868 GTTAGGATGTAGACATCTTGGGG + Intronic
1078451207 11:11442413-11442435 ATTAGGATGTGGACCTCTTTGGG + Intronic
1078451505 11:11443995-11444017 ATTAGGATGTGGACATCTTTGGG + Intronic
1078457738 11:11488528-11488550 ATTAGGATGTGGACCTCTTTGGG + Intronic
1078472193 11:11598639-11598661 ATTGGAACATGGATATCTTTTGG + Intronic
1078485643 11:11720900-11720922 ATTAGGATGTGCACATCTTTGGG + Intergenic
1078703523 11:13715285-13715307 CTTAGAATTTGGAGATCTTTGGG + Intronic
1078815169 11:14813668-14813690 TTTAGGATATGGACATCTTTGGG + Intronic
1078836226 11:15032908-15032930 GTTAGAACTAGGACTTCTATTGG + Intronic
1078837063 11:15041058-15041080 ATTAGGACATGGACATCTTTGGG + Intronic
1078841587 11:15080652-15080674 ATTAGGACATGGACACCTTTTGG - Intronic
1078919310 11:15813505-15813527 ATTAGGACGTAGACTTCTTTGGG + Intergenic
1079022132 11:16917745-16917767 ATTAGCACATGGACATCTTTTGG + Intronic
1079147857 11:17869793-17869815 ATTAGGACATGGACATCTTTAGG - Intronic
1079386970 11:19989114-19989136 ATTAGAATGTGGCCATCTTTGGG - Intronic
1079461257 11:20680223-20680245 ATTAGCACCTGGACATTTTTGGG + Intronic
1079684507 11:23340920-23340942 GTTAGGAAGTGGATATCTTTGGG - Intergenic
1079946644 11:26751313-26751335 CATAGAATGTGGACATTTTTAGG - Intergenic
1079986549 11:27206222-27206244 GTTAGAACATGGACATCTTTGGG - Intergenic
1080048668 11:27836269-27836291 GTTAGCACATGGATATATTTGGG + Intergenic
1080050093 11:27850902-27850924 ATCAGGATGTGGACATCTTTGGG + Intergenic
1080269321 11:30434197-30434219 ATTAGGATGTGGACATCTTTAGG + Intronic
1080449004 11:32363376-32363398 ATTAGGACATGGACATCTGTGGG + Intergenic
1080688250 11:34533799-34533821 GTTAGAACTTCAACATCTTTTGG - Intergenic
1081101578 11:39008409-39008431 CATAGGATGTGGACATCTTTAGG - Intergenic
1081252810 11:40856912-40856934 GTTTGAAAGTGTACATCTTATGG + Intronic
1081346056 11:41987904-41987926 ATTAGGATGTGGATATCTTTGGG - Intergenic
1081350503 11:42046077-42046099 ATTAGGACGTTGACATCTTTGGG - Intergenic
1081417841 11:42837036-42837058 ATTATGACATGGACATCTTTGGG - Intergenic
1081762840 11:45589114-45589136 ATTAGAACATGGATCTCTTTTGG - Intergenic
1082285162 11:50310089-50310111 GTTAGCACGTGAAGATTTTTTGG - Intergenic
1082993172 11:59226433-59226455 GTTAGAATGTAGACATCTTTGGG + Intergenic
1083384115 11:62295099-62295121 ATTAGAATGTGTATATCTTTTGG - Intergenic
1083549942 11:63580248-63580270 ATTAGGACATGGACACCTTTTGG - Intronic
1084081987 11:66833442-66833464 GTTAGGATTTGGACATATTTGGG + Intronic
1084673190 11:70619603-70619625 ATAAGCACGTGGACATCTTGGGG + Intronic
1084688725 11:70712380-70712402 ATTAGGACGTGAACATCTCTGGG + Intronic
1085273172 11:75282296-75282318 ATTAGGGTGTGGACATCTTTGGG - Intronic
1085789421 11:79484307-79484329 ATTAGGACATAGACATCTTTGGG + Intergenic
1085898948 11:80674048-80674070 ATTAGGTTGTGGACATCTTTTGG + Intergenic
1085985843 11:81786870-81786892 ATTAGGATGTGGACATCTTTAGG + Intergenic
1086726289 11:90188903-90188925 GTTAGAAAATAGAGATCTTTGGG - Intronic
1087021893 11:93611354-93611376 ATTAGGACATGGACATCTTTGGG + Intergenic
1087110336 11:94459873-94459895 TTTAAGACGTGGACATCTTTAGG - Intronic
1087332950 11:96805813-96805835 ATTAGAATGTGGACATCTTTGGG + Intergenic
1087358251 11:97122621-97122643 GTTATGGCATGGACATCTTTGGG + Intergenic
1087974932 11:104532950-104532972 ATTAGGACGTGAAGATCTTTGGG + Intergenic
1088266950 11:107996991-107997013 ATTAGGATGTGGTCATCTTTAGG - Intergenic
1088340390 11:108758871-108758893 ATTAGCATGTGGACATTTTTTGG + Intronic
1088572543 11:111237050-111237072 GTTAGGATTTGGACATCTTTGGG + Intergenic
1088947090 11:114525320-114525342 ATTAGGATGTGGATATCTTTGGG - Intronic
1089068782 11:115682486-115682508 ATTAGGACATGGACATCCTTGGG - Intergenic
1089754537 11:120676841-120676863 TTTAGGATGTGGGCATCTTTGGG + Intronic
1090104651 11:123839618-123839640 GTCAGAACCTGGATATCTTTAGG + Intergenic
1090229699 11:125092679-125092701 ATTAGGATGTGGACATCTTATGG - Intergenic
1090230374 11:125098635-125098657 ATTAGGATGTGGATATCTTTGGG - Intronic
1090467850 11:126951108-126951130 GTTAGGATGTGGATATCTTTTGG + Intronic
1090671842 11:128953098-128953120 ATTAGAACATAGACATCTTTGGG + Intergenic
1090819272 11:130326420-130326442 TTTAGGACATGGACATCATTGGG + Intergenic
1091049582 11:132355322-132355344 ATTAGGATGTGGAGATCTTTAGG + Intergenic
1091939701 12:4467608-4467630 ATTAGAACATGGACATCTTGGGG - Intergenic
1092293157 12:7177184-7177206 AGTACGACGTGGACATCTTTGGG - Intergenic
1092581107 12:9842981-9843003 ATTAGAATGTGGACATCTTTGGG - Intronic
1092654487 12:10670949-10670971 ATTAGGACATGGACATCTTTGGG - Intronic
1093168002 12:15828094-15828116 ATTAGGACATGGACATCTTTGGG - Intronic
1093386892 12:18568180-18568202 ATTAGGACATGAACATCTTTTGG + Intronic
1093518507 12:20019914-20019936 ATTAGAATGTGGACATCTTTAGG + Intergenic
1093556007 12:20474902-20474924 ATTAGAATGTGGCTATCTTTGGG + Intronic
1093558253 12:20504926-20504948 TTTAGAACATGGACATCTTTGGG + Intronic
1093636316 12:21473981-21474003 ATTAGGACGTGAACATCTTTGGG + Intronic
1094383470 12:29868562-29868584 ATTAGCACTTGGACACCTTTGGG + Intergenic
1094574709 12:31674617-31674639 ATTAGAACGTGGATATCATTGGG + Intronic
1095302832 12:40606805-40606827 TTTAGGACGTGCACATCTTTGGG - Intergenic
1095948983 12:47771438-47771460 ATGAGGACGTGGACATCTTTGGG - Intronic
1096055826 12:48651124-48651146 ATTAGGATGTGGACATCTTTGGG + Intergenic
1096524324 12:52201540-52201562 ATTAGGATGTGGACAGCTTTGGG - Intergenic
1096883236 12:54689958-54689980 ATTAGGATGTGGACATCTTTTGG - Intergenic
1097290506 12:57910483-57910505 ATTAGGGCTTGGACATCTTTGGG - Intergenic
1097339057 12:58417024-58417046 TTTAGGACATGGATATCTTTGGG - Intergenic
1097580915 12:61455117-61455139 ATTAGATCATGGATATCTTTGGG + Intergenic
1097631094 12:62063125-62063147 ATTAGGACATGGACATATTTGGG + Intronic
1097677551 12:62619357-62619379 GTTAGGACGTGAACATCATTAGG - Intergenic
1097927209 12:65142226-65142248 ATTAGGATGTGGACATATTTGGG - Intergenic
1098030642 12:66249932-66249954 ATTGGGACGTGGACATCTTCGGG + Exonic
1098202426 12:68069728-68069750 ATTAGAATGTGGGCACCTTTGGG + Intergenic
1098209820 12:68151812-68151834 ACTAGGATGTGGACATCTTTGGG - Intergenic
1098445948 12:70565753-70565775 GTTAGGACATGGACATCTTTGGG - Intronic
1098675111 12:73280063-73280085 ATTAGGACATGGACATATTTGGG + Intergenic
1098936068 12:76480817-76480839 ATTAGGGTGTGGACATCTTTGGG - Intronic
1098976480 12:76907601-76907623 ATTAGGATGTGGACATCTTTGGG - Intergenic
1099030500 12:77520359-77520381 ATTAGAACTTGAACATCTTTGGG + Intergenic
1099811452 12:87587550-87587572 ATTAGAACATGGACATCTTAGGG + Intergenic
1099841776 12:87975546-87975568 ATCAGGATGTGGACATCTTTGGG - Intergenic
1099863477 12:88248861-88248883 ATTAGTATGTGGACATCTTTTGG - Intergenic
1099864617 12:88264096-88264118 ATTAGGATGTGGACATATTTGGG - Intergenic
1099887657 12:88551752-88551774 ATTAGGACATGGACATCTTTGGG - Intronic
1099927939 12:89040789-89040811 ATTAGATCTTGGATATCTTTGGG - Intergenic
1100397493 12:94197682-94197704 ATTAGGACCTGGACATCTTTGGG + Intronic
1100580182 12:95931445-95931467 ATTAGAATGTGGACACATTTGGG + Intronic
1100595122 12:96065022-96065044 ATTAGGACTTGGACGTCTTTGGG - Intergenic
1100777856 12:97991929-97991951 ATTAAGACATGGACATCTTTGGG + Intergenic
1101258876 12:103008844-103008866 GTTAGAGTGTGTACATCTTTGGG + Intergenic
1101481619 12:105103531-105103553 ATTAGGACATGAACATCTTTGGG - Intergenic
1101568180 12:105929276-105929298 GTTAGGACTTCAACATCTTTTGG - Intergenic
1101740852 12:107498833-107498855 ACTAGGACATGGACATCTTTGGG + Intronic
1101841611 12:108331547-108331569 ATTAGGATGTGGACATCTTTGGG - Intronic
1102125652 12:110478358-110478380 ATTAGAGTGTGAACATCTTTGGG - Intronic
1102281884 12:111624916-111624938 GTGAGGACATGGATATCTTTGGG + Intergenic
1102314138 12:111872916-111872938 ATTATAACATGGACATCTTGGGG + Intronic
1102399130 12:112613444-112613466 ATTAGGACATGGACATCTTTGGG - Intronic
1102418744 12:112787257-112787279 ATGAAAATGTGGACATCTTTTGG + Intronic
1102447752 12:113016647-113016669 ATTAGGATATGGACATCTTTGGG - Intergenic
1102591922 12:113962814-113962836 ATTAGGATGTGGGCATCTTTTGG - Intronic
1102963247 12:117107365-117107387 ATTAGGACGTGGGCGTCTTTGGG - Intergenic
1102975043 12:117200782-117200804 ATTAGAACCTGGACATGTTTGGG - Intergenic
1103027684 12:117587158-117587180 ATCAGGACGTGGGCATCTTTTGG - Intronic
1103157848 12:118702161-118702183 ATTAGGATGTGGAAATCTTTGGG - Intergenic
1103285616 12:119798867-119798889 GGTACAAATTGGACATCTTTGGG - Intronic
1103833022 12:123795711-123795733 ATTAGGACGTGGACATCTTTGGG + Intronic
1103895280 12:124269125-124269147 ATTAGAACATGGACATCTGCAGG - Intronic
1103901474 12:124305803-124305825 GTTAGGGTGTGGACAGCTTTGGG + Intronic
1103981590 12:124740294-124740316 ATTAGGACATGGACATCTTTGGG + Intergenic
1104043355 12:125144916-125144938 ATTAGGATGTGGATATCTTTGGG + Intergenic
1104054062 12:125215958-125215980 ATTAGGACATGCACATCTTTGGG + Intronic
1104063514 12:125287367-125287389 ATTGGGACGTGGGCATCTTTTGG + Intronic
1104111633 12:125710152-125710174 ATTAGGATGTGGACATCTTTTGG - Intergenic
1104135348 12:125932478-125932500 ATTAGGATGTAGACATCTTTGGG - Intergenic
1104289090 12:127452134-127452156 ATTAGAATGTGGACATCTTTGGG + Intergenic
1104368284 12:128197984-128198006 ATTAGGACATGGACATCTTTGGG - Intergenic
1104453045 12:128886767-128886789 ATTAGGATGTGGACATCTCTGGG + Intronic
1104595504 12:130117609-130117631 ATTAGGATGTGGACATCCTTTGG - Intergenic
1105403250 13:20113706-20113728 GTTAGGTCGTAGACATTTTTGGG - Intergenic
1105731824 13:23225169-23225191 GTTAGGATGTGGACATCCTTGGG - Intronic
1106001382 13:25726742-25726764 ATTAGGGTGTGGACATCTTTGGG + Intronic
1106245836 13:27949308-27949330 ATTAGGACATGGATATCTTTTGG + Intergenic
1106454694 13:29916921-29916943 ATGAGGATGTGGACATCTTTGGG - Intergenic
1106473346 13:30077195-30077217 GTTAGGATGGGGACATCTTTGGG + Intergenic
1107173746 13:37376419-37376441 GTTAGCACGTGGGTATCTTTGGG - Intergenic
1107418396 13:40222507-40222529 ATTAGGACTTGGACATCTTTGGG + Intergenic
1107614486 13:42150792-42150814 ATTAGGATGTGAACATCTTTGGG - Intronic
1107631803 13:42350471-42350493 ATTAGGACCTGGATATCTTTGGG - Intergenic
1107691814 13:42961004-42961026 GATAAAACGTGGACATCTTGGGG + Intronic
1107752601 13:43584980-43585002 ATTAGGACGTTCACATCTTTGGG - Intronic
1107950350 13:45455712-45455734 ATTAGCACCTGGGCATCTTTGGG + Intergenic
1108033045 13:46256893-46256915 GGTAGAATATGAACATCTTTGGG - Intronic
1108047384 13:46396074-46396096 ATTAAAATGTGGACATCTTTGGG - Intronic
1109011241 13:56947812-56947834 AGTAGAATGTGGACATCTTGGGG + Intergenic
1109349087 13:61153844-61153866 ATTAGGACATGAACATCTTTTGG - Intergenic
1109481310 13:62958358-62958380 ATTAGGACATGGGCATCTTTGGG - Intergenic
1109815431 13:67576022-67576044 ATTAAGATGTGGACATCTTTGGG + Intergenic
1110305909 13:73986542-73986564 ATTAGGACATGGACATCTTTAGG - Intronic
1110441962 13:75536389-75536411 ATTAGCATGTGGACATATTTGGG - Intronic
1111323085 13:86655932-86655954 ATTAGGGCATGGACATCTTTGGG + Intergenic
1111377887 13:87404341-87404363 ATTAGAGTGTGGAAATCTTTGGG + Intergenic
1111466980 13:88626209-88626231 ATTAGTACATGGACATTTTTGGG - Intergenic
1111768603 13:92567413-92567435 ATTAGAATATGGACATCTTTGGG - Intronic
1111960805 13:94807923-94807945 ATTAGGGCATGGACATCTTTGGG + Intergenic
1112191778 13:97185389-97185411 ATTGGGATGTGGACATCTTTGGG - Intergenic
1112257844 13:97851064-97851086 ATTAGGATGTGGACATCTTTGGG - Intergenic
1112419102 13:99231197-99231219 ATTAGGACGTGGACCTCCTTGGG + Intronic
1112463381 13:99622280-99622302 ATAAGGACGTGGACATCTTTGGG + Intronic
1112491761 13:99872151-99872173 GGTTGAATGTGGACATCCTTAGG - Intronic
1112586474 13:100723042-100723064 ATTAGAATGCGGACATCTTTGGG - Intergenic
1112647304 13:101349366-101349388 GTTAGAATGGGGACATCTTTAGG - Intronic
1112746776 13:102535753-102535775 GTTAGAACACGGACATCTTTTGG + Intergenic
1112834524 13:103497784-103497806 ATTAGGACATAGACATCTTTGGG + Intergenic
1112958295 13:105088797-105088819 GTTAGGATGTAGACATCTTGAGG + Intergenic
1113106170 13:106773757-106773779 ATGAGAACATGGATATCTTTAGG - Intergenic
1113283307 13:108815250-108815272 ATTAGGACATGGACATCGTTGGG - Intronic
1113658101 13:112082718-112082740 GTTAGGACGTCAACATTTTTGGG + Intergenic
1114446068 14:22789253-22789275 ATTAGGGGGTGGACATCTTTGGG - Intronic
1114899414 14:27038010-27038032 ATTAGGATGTGGATATCTTTTGG + Intergenic
1115100106 14:29688364-29688386 TATAGAACATGGACATCTCTGGG + Intronic
1115992971 14:39168725-39168747 GTTAGAAAGTGGAATTCTGTAGG - Intronic
1116062490 14:39941487-39941509 ATTAGGACATGGACATCTTTGGG + Intergenic
1116248617 14:42453446-42453468 ATTAGAATATGGACAACTTTTGG + Intergenic
1116402893 14:44530918-44530940 ATTAGGACATGGACATATTTGGG - Intergenic
1116712549 14:48386673-48386695 ATAAGAACATAGACATCTTTGGG + Intergenic
1116802283 14:49455327-49455349 AATAGAATGTGGACATCTTTGGG - Intergenic
1116845388 14:49860589-49860611 GTTAGCACATAGATATCTTTGGG + Intergenic
1117192253 14:53304666-53304688 TTTAGGACGTGGGCATCTTTGGG + Intergenic
1117669662 14:58093566-58093588 GTTAGGACATAGACATCTTCGGG + Intronic
1118150405 14:63182972-63182994 ATTAGCATGTGGCCATCTTTGGG + Intergenic
1119206160 14:72795110-72795132 ATTAGGACATGGACATCTTTGGG + Intronic
1119637149 14:76283221-76283243 ATTAGGACATGGACATCTCTGGG - Intergenic
1120090286 14:80324124-80324146 GTGAGGATGTGGACATTTTTGGG - Intronic
1120125398 14:80736043-80736065 GTTAGGTTGTGGACATCTTTTGG + Intronic
1120234309 14:81873528-81873550 ATTAGGATATGGACATCTTTGGG + Intergenic
1120721213 14:87891449-87891471 ATTAGGACTTGGACATTTTTGGG - Intronic
1120761552 14:88290047-88290069 ATCAGGACATGGACATCTTTGGG - Intronic
1120827528 14:88969181-88969203 ATTAGGACATGGACATCTTTGGG - Intergenic
1120836498 14:89042509-89042531 ATTAGGATGTGGACATCTTTGGG - Intergenic
1121066238 14:90968470-90968492 ATTAGAATGTGGGCATCTCTGGG + Intronic
1121077571 14:91082081-91082103 ATTAGGATGTGGACATCTTTTGG + Intronic
1121284038 14:92720715-92720737 ATTAGGATGTGGACATCCTTTGG - Intronic
1121454693 14:94030660-94030682 ATTAGGACGTGGACATCATTGGG - Intronic
1121472951 14:94170459-94170481 ATTAGGATGTGGACGTCTTTGGG + Intronic
1121571195 14:94947766-94947788 ATTAGGACATGGACATCTTTGGG - Intergenic
1121660423 14:95631258-95631280 AGTAGAACATGGACATCTCTGGG - Intergenic
1121688436 14:95856945-95856967 ATTAGGACCTGGACGTCTTTGGG + Intergenic
1121929390 14:97958591-97958613 ATTAGAATTTGGACGTCTTTGGG - Intronic
1121988808 14:98534254-98534276 ATTAGAATGTGGATATCTGTGGG + Intergenic
1122349907 14:101083095-101083117 ATTAGGACGTGCACATCTTTGGG - Intergenic
1122349926 14:101083181-101083203 ATTAGGACATGGACATCTTTGGG - Intergenic
1122448691 14:101785712-101785734 ATTAGGATGTGGACATCTTTAGG + Intronic
1122753555 14:103958438-103958460 ATTAGAACATGGACCTCTTTAGG - Intronic
1122866809 14:104609654-104609676 ATTGGGATGTGGACATCTTTGGG + Intergenic
1123690268 15:22832871-22832893 GTGAGGACGTGGATATCTTTGGG + Intergenic
1123759120 15:23419216-23419238 ATTAGGATGTGGACCTCTTTGGG - Intergenic
1124069696 15:26379895-26379917 ATTAGGACATGGAAATCTTTGGG + Intergenic
1124393302 15:29278954-29278976 GTGAGAACGTGGTCATCTGCAGG - Intronic
1125103227 15:35940321-35940343 GTTAGAACGTGAACATCCTTGGG - Intergenic
1125214838 15:37259696-37259718 ATTAGAACATGGACATCTTTGGG + Intergenic
1126275151 15:46869297-46869319 ATTAGAGTGTGCACATCTTTGGG + Intergenic
1126290081 15:47065629-47065651 ATGAGGATGTGGACATCTTTGGG - Intergenic
1126869168 15:52969337-52969359 ATTAGGATGTGGACATCTTTAGG - Intergenic
1126899686 15:53302099-53302121 GTTACAACATGGACATATTGAGG + Intergenic
1127485456 15:59413933-59413955 ATTAGAATGTGGACGTCTTTGGG - Intronic
1128091638 15:64923106-64923128 ATTAGGATATGGACATCTTTGGG - Intronic
1128113306 15:65089865-65089887 ATTAGGACGTGGATGTCTTTGGG - Intergenic
1128480181 15:68030725-68030747 ATTAGGACATGGACATCTTTGGG - Intergenic
1128612498 15:69085165-69085187 ATTAGGACATGGACATATTTGGG - Intergenic
1128934298 15:71732212-71732234 ATTAGGATGTGGACATCTTTAGG + Intronic
1129128555 15:73468154-73468176 ATTAGGACATAGACATCTTTAGG + Intronic
1129157151 15:73725488-73725510 ATTAGAACATGGACATCTTTGGG - Intergenic
1129914217 15:79254172-79254194 ATTAGGATGTGGACATCTTTGGG - Intergenic
1130066465 15:80609008-80609030 GTTAGAACTTGGACATATTTGGG + Intergenic
1130067586 15:80617435-80617457 ATTAGGATGTGGACGTCTTTGGG + Intergenic
1130202538 15:81845545-81845567 GTTAGAATGTGGACACCTTTGGG - Intergenic
1130320537 15:82837324-82837346 ATTAGGATGTGGACATCTTTGGG + Intronic
1130426981 15:83811200-83811222 GTTAGGTCATGGACATCTTGTGG + Intronic
1130712127 15:86293639-86293661 GTGAGAACGTGAACATCTTTGGG + Intronic
1130923766 15:88369971-88369993 ATTAGGATGTGAACATCTTTGGG - Intergenic
1131764723 15:95663060-95663082 GTTAGTACGTGGAAATACTTGGG - Intergenic
1131997450 15:98145937-98145959 ATTAGGAGGTGGACATCTTTTGG - Intergenic
1132018538 15:98339967-98339989 ATTAGGATGTGGACATCTTTGGG + Intergenic
1132018553 15:98340109-98340131 ATTAGGATGTGGACATCCTTGGG + Intergenic
1132181929 15:99761698-99761720 ATTAGAATATGGACATCTTTGGG + Intergenic
1132208954 15:100006278-100006300 ATTAGAATGTGGACACCTGTGGG + Intronic
1132247997 15:100312086-100312108 ATTAGGATGTGGACATCCTTGGG - Intronic
1133384206 16:5355652-5355674 GTTAGGACTTGGACCTATTTTGG - Intergenic
1133790556 16:9006461-9006483 ATTAGGACGTGAACACCTTTTGG - Intergenic
1133904816 16:10012558-10012580 ATTAGGACATGGACACCTTTGGG - Intronic
1133922026 16:10162039-10162061 ATTAGAATGTGGATGTCTTTGGG + Intronic
1134042750 16:11080945-11080967 ATTAGGTCGTGGGCATCTTTGGG + Intronic
1134150562 16:11801444-11801466 GTCAGCATGTGGACATCTTTGGG + Intergenic
1134284234 16:12846258-12846280 ATTAGGACGTGAACATCTTTGGG + Intergenic
1134457229 16:14403652-14403674 ATTAGGATGTGGACCTCTTTGGG + Intergenic
1134864081 16:17589464-17589486 ATTAGAACTTGGATATCTTTGGG - Intergenic
1134905813 16:17978573-17978595 ATTAGGATGTGGACGTCTTTGGG - Intergenic
1135073506 16:19373173-19373195 ATTAGAACGTGTCCATCTTTGGG - Intergenic
1135141575 16:19926577-19926599 ATTAGGATGTAGACATCTTTGGG + Intergenic
1135286005 16:21193741-21193763 GTTAGCACGTGAATATCTTTGGG + Intergenic
1135353070 16:21746340-21746362 GTTCAGACATGGACATCTTTCGG - Intronic
1135451556 16:22562463-22562485 GTTCAGACATGGACATCTTTGGG - Intergenic
1135532290 16:23265105-23265127 ATTAGGACATGGACATCGTTGGG + Intergenic
1136054045 16:27674726-27674748 GCTAGGATATGGACATCTTTGGG + Intronic
1136054259 16:27676482-27676504 ATTAGGATGTGGACATCTTTGGG + Intronic
1136288691 16:29258952-29258974 ATTAGGATGTGGGCATCTTTGGG + Intergenic
1136901034 16:34038280-34038302 ATTAGGACGTGAACATTTTTGGG + Intergenic
1137583256 16:49647390-49647412 GTTAAGACTTGGACATCTTTGGG - Intronic
1138475300 16:57267222-57267244 GTTAGAACTTGAACATATTTTGG - Intronic
1138779765 16:59768957-59768979 ATTAGGACATGGACATCATTGGG + Intergenic
1138795487 16:59963254-59963276 ATTAGGACATGGACATCTTCTGG - Intergenic
1138823067 16:60285265-60285287 ATTAGGATGTAGACATCTTTGGG - Intergenic
1139287321 16:65827201-65827223 TTTAAGACGTGGACATCTTTGGG + Intergenic
1139305236 16:65980160-65980182 ATTAGGGCCTGGACATCTTTGGG - Intergenic
1139309494 16:66016414-66016436 GTTAGGACATGGACATCACTGGG + Intergenic
1139562472 16:67752146-67752168 ATTAGACCATGGACATCTTTGGG - Intronic
1139984494 16:70887178-70887200 ATTAGGATGTGGACATCTTTCGG - Intronic
1140008795 16:71109130-71109152 GTCAGGACCTGGACATCTTTGGG + Intronic
1140218959 16:73029724-73029746 GTTCCTGCGTGGACATCTTTAGG + Intronic
1140345455 16:74208884-74208906 TTAAGATTGTGGACATCTTTGGG - Intergenic
1140657078 16:77151922-77151944 ATTAGGAGGTAGACATCTTTGGG - Intergenic
1140735607 16:77895319-77895341 ATTAGGATGTGGACATCTTTAGG - Intronic
1140793020 16:78410392-78410414 GTTAGGATGTGGACTTCTTTGGG + Intronic
1140959967 16:79902368-79902390 ATTAGGATGTGGACATCTTTGGG + Intergenic
1140987619 16:80173699-80173721 ATCAGGACATGGACATCTTTGGG - Intergenic
1140998458 16:80284483-80284505 ATTAGAACATGGGCATCTTTTGG + Intergenic
1140999444 16:80294894-80294916 ATGAGGCCGTGGACATCTTTGGG + Intergenic
1141191040 16:81824774-81824796 ATTAGGACATGGACACCTTTGGG - Intronic
1141206285 16:81935396-81935418 ATTAGGGCCTGGACATCTTTGGG + Intronic
1141235626 16:82213346-82213368 ATTAGGATGTGGACAACTTTGGG - Intergenic
1141317282 16:82974508-82974530 ATTAGAATGTGGATATCATTGGG - Intronic
1141486155 16:84341652-84341674 GTTAGACTGTGGACTTCTCTGGG + Intergenic
1141487359 16:84349657-84349679 ATTAGGACATGGACATCTTTTGG - Intergenic
1141726392 16:85791931-85791953 ATTAGGATGTGGACATATTTGGG + Intronic
1141862784 16:86729377-86729399 ATTAGGATGTGGACATCGTTTGG + Intergenic
1141910396 16:87054619-87054641 TTTAGGATGTGGACATCTCTTGG - Intergenic
1141978694 16:87535719-87535741 GTTAAGATATGGACATCTTTGGG + Intergenic
1142094412 16:88231857-88231879 ATTAGGATGTGGGCATCTTTGGG + Intergenic
1142396740 16:89836319-89836341 GTTAGAACACAGACAGCTTTAGG + Intronic
1142833396 17:2566129-2566151 GTTGGGACATGGACATCTTTGGG - Intergenic
1142947643 17:3446279-3446301 ATTAGAATGTAGACATTTTTAGG + Intronic
1142996911 17:3765944-3765966 ATTAGGACGTGGCCTTCTTTGGG - Intronic
1143269223 17:5663557-5663579 GTGAGGATGTGGACATCTTTGGG - Intergenic
1143304559 17:5935855-5935877 ATTAGAATGTGGCCATCTTAGGG + Intronic
1143893114 17:10117406-10117428 ATTAGAAGGTAGACATCTTCAGG + Intronic
1144005567 17:11096164-11096186 ATTAGGATGGGGACATCTTTGGG - Intergenic
1144047776 17:11469139-11469161 ATTAGGAAGTGGACATCTTTGGG - Intronic
1144350658 17:14392712-14392734 GTTAGAATTTGCACATCTCTTGG - Intergenic
1144395183 17:14836471-14836493 CTTAGGACATGTACATCTTTAGG - Intergenic
1144592264 17:16534649-16534671 ATTAGGACCTGGATATCTTTGGG + Intergenic
1145054908 17:19696022-19696044 GTTAGAATTTCAACATCTTTTGG - Intronic
1145112593 17:20176894-20176916 ATTAGGATGTGGACATATTTGGG + Intronic
1145357505 17:22174377-22174399 ATTAGGACATGGGCATCTTTGGG + Intergenic
1146312417 17:31779394-31779416 ATTAGGACTTGGATATCTTTGGG - Intergenic
1146826801 17:36030184-36030206 GCTTGAACGAGGACAACTTTGGG - Intergenic
1147764899 17:42827851-42827873 GTTAGGACTTCAACATCTTTTGG - Intronic
1148625433 17:49065738-49065760 TTTAGTACCTGGACACCTTTGGG + Intergenic
1149456103 17:56789776-56789798 ATTAGGACCTGGACATCTTTGGG - Intergenic
1149850810 17:60032570-60032592 ATTAGGACGTGGCCATCTCTGGG + Intergenic
1149859356 17:60113954-60113976 ATTAGGACGTGGCCATCTCTGGG - Intergenic
1150050075 17:61953322-61953344 ATTAGGATGTGGACATCTTTGGG - Intronic
1150154188 17:62836693-62836715 GTTGAAACTTGGACATTTTTGGG - Intergenic
1150170897 17:62993227-62993249 GTTAGAATGTGGTCACCTTTGGG + Intergenic
1150248452 17:63692863-63692885 ATTAGGCAGTGGACATCTTTGGG - Intronic
1150330843 17:64293093-64293115 ATTAGAATGTGAATATCTTTCGG - Intergenic
1151285005 17:73104514-73104536 ATTAGGACATGGACATCTTTAGG - Intergenic
1151382876 17:73737625-73737647 ATTAGAACATGGGTATCTTTAGG + Intergenic
1151867371 17:76812995-76813017 ATTAGGACATGGGCATCTTTGGG - Intergenic
1151874772 17:76861284-76861306 ATTAAGAGGTGGACATCTTTGGG + Intergenic
1152066304 17:78114451-78114473 CTTAGGACGGGGACATCTTTGGG + Intronic
1152211821 17:79006461-79006483 GGTAGGACGTGGACATCTCGGGG + Intronic
1152323673 17:79623352-79623374 GTTAGGACGTGGACATTTTGGGG - Intergenic
1152395434 17:80030167-80030189 ATTAGGACATGGGCATCTTTGGG + Intronic
1153505264 18:5790343-5790365 ATTAGGACATGGACATATTTGGG - Intergenic
1153545960 18:6205014-6205036 ATTAGAATTTCGACATCTTTGGG - Intronic
1153590936 18:6673708-6673730 ATTTGAATGTGGACATCTTCAGG - Intergenic
1153842386 18:9018522-9018544 ATTAGCACATGGACATTTTTGGG - Intergenic
1153922717 18:9805620-9805642 ATTAGGACATGGACCTCTTTGGG + Intronic
1154151632 18:11910704-11910726 ATTAGAATGTGGGCATGTTTGGG - Intergenic
1154301897 18:13201400-13201422 ATTACCACATGGACATCTTTGGG + Intergenic
1155026647 18:21946649-21946671 GTTAGAATGTTAACATCATTGGG + Intergenic
1155102923 18:22630966-22630988 ATTAGGATGTGGACATCTTGGGG + Intergenic
1155254125 18:23979769-23979791 GTTAGGATGTGGACATCTTTGGG - Intergenic
1155364841 18:25039518-25039540 ATTAGGACGTGGACACCTTTGGG + Intergenic
1155561285 18:27080024-27080046 GTTAGATTGTGGATATCTTTGGG + Intronic
1155831906 18:30526500-30526522 ATTAGGACATGGACATCTTTAGG + Intergenic
1156014693 18:32534326-32534348 ATTAGGGTGTGGACATCTTTGGG + Intergenic
1156307038 18:35886864-35886886 ATTAGAATGTGGACATCTTTGGG + Intergenic
1156417492 18:36912546-36912568 ATTAGGATGTGGACATCTGTGGG + Intronic
1157245933 18:46055298-46055320 ATTAGGATTTGGACATCTTTGGG - Intronic
1157305380 18:46513329-46513351 TTTAGAACACGGATATCTTTTGG - Intronic
1157327979 18:46682600-46682622 ATTAGGACATGGACACCTTTGGG - Intronic
1157422195 18:47556453-47556475 ATCAAAGCGTGGACATCTTTGGG - Intergenic
1157434814 18:47659476-47659498 ATTAGTACTTGGATATCTTTGGG - Intergenic
1157502153 18:48198808-48198830 ATTAGGATGTGGACATCTTTGGG + Intronic
1157584223 18:48790962-48790984 GTGAGAAGGTGGACAGGTTTGGG - Intronic
1157651990 18:49342444-49342466 ATTAGAGCATGTACATCTTTGGG + Intronic
1157884640 18:51354828-51354850 AATAGAATGTGGGCATCTTTGGG - Intergenic
1158301141 18:56054751-56054773 ATTAAAATGTGGATATCTTTTGG - Intergenic
1158590461 18:58774635-58774657 ATCAGAATGTGGACATATTTGGG - Intergenic
1159124563 18:64208099-64208121 ATTAGAATGGGGAGATCTTTGGG - Intergenic
1159173936 18:64810494-64810516 ATTAGAACCTGAATATCTTTGGG - Intergenic
1159180447 18:64895151-64895173 GTTTGCACATGGACATTTTTAGG + Intergenic
1159325873 18:66916580-66916602 ATTAGGACATGTACATCTTTGGG + Intergenic
1159421373 18:68225062-68225084 ATTAGGATGTGGACCTCTTTGGG - Intergenic
1159491958 18:69148173-69148195 ATTAGGATGTAGACATCTTTGGG + Intergenic
1159618320 18:70608235-70608257 ATTAGGGCCTGGACATCTTTGGG - Intergenic
1159692468 18:71505879-71505901 GTTAGGACATGGACATTTTGGGG + Intergenic
1160053684 18:75459985-75460007 ACTAGGATGTGGACATCTTTGGG - Intergenic
1160269261 18:77369165-77369187 TTTAGGATGTGGACATCTTTGGG + Intergenic
1160286060 18:77544590-77544612 ATTATGATGTGGACATCTTTTGG + Intergenic
1160325677 18:77945260-77945282 ATTAGGACATGGACATCTTGGGG + Intergenic
1160336010 18:78040236-78040258 ATTAGGATGTGGACATATTTAGG + Intergenic
1161066786 19:2242565-2242587 ATTAGGATGTGGACATCTTTTGG + Intronic
1161340699 19:3740478-3740500 GGTAGGACGAGGACGTCTTTGGG + Intronic
1161567961 19:5013801-5013823 GTTAGGATGGGGACATCTTTGGG + Intronic
1161649492 19:5475613-5475635 ATTAGGATGTGGACATCTTTGGG - Intergenic
1161655429 19:5511478-5511500 ATTAGGATGTGGACATCTTTGGG + Intergenic
1161692239 19:5742925-5742947 ATTAGGATGTGGACACCTTTGGG - Intronic
1161761973 19:6180252-6180274 GTTAGAACGTGGACATCTTTAGG + Intronic
1161995625 19:7709668-7709690 ATTAGAATGTGGACATCTTTGGG + Intergenic
1164960749 19:32427308-32427330 GTTGGAACATAAACATCTTTCGG + Intronic
1165476541 19:36033965-36033987 GTGAGATCCTGGAAATCTTTTGG - Intergenic
1166031708 19:40136089-40136111 GTTAGGATGTGAACATCTTTGGG - Intergenic
1166145029 19:40828221-40828243 ATAAGGACCTGGACATCTTTTGG - Intronic
1166264803 19:41673034-41673056 ATTAGGATGTGGACATTTTTAGG - Intronic
1166273331 19:41732624-41732646 ATTAGGATGTGGACATTTTTAGG + Intronic
1166278397 19:41772448-41772470 ATTAGGATGTGGACATTTTTAGG + Intergenic
1166425905 19:42677406-42677428 GTCAGGATGTGGACATTTTTAGG + Intronic
1166625591 19:44351327-44351349 ATTAGGATATGGACATCTTTAGG + Intronic
1166820577 19:45576901-45576923 ATAAGGATGTGGACATCTTTGGG + Intronic
1166932851 19:46311958-46311980 ATTAGGATGTGGACATCTTTGGG + Intronic
1167758434 19:51427709-51427731 ATTAGCAAGTGGACATCTTTGGG - Intergenic
1168098226 19:54127530-54127552 ATTAGAACATGGGCCTCTTTGGG + Intronic
1168207259 19:54860170-54860192 GCTAGGACATGGACATTTTTGGG + Intronic
1168225800 19:54994087-54994109 GTTGGGACTTGGACATCTTTAGG + Intronic
1168412774 19:56149992-56150014 ATCAGACCGTGTACATCTTTGGG + Intronic
1168660504 19:58162122-58162144 ATGAGGATGTGGACATCTTTTGG + Intergenic
1168666418 19:58208380-58208402 GTCAGGACATGGACACCTTTGGG - Intronic
1202702231 1_KI270712v1_random:173129-173151 GTTAGGACGTGGACATCTTTGGG - Intergenic
925515921 2:4681665-4681687 GTTAGGAGGGGGACATCTTGGGG + Intergenic
925630601 2:5889068-5889090 GTGAGGACTTGAACATCTTTGGG + Intergenic
926124764 2:10265305-10265327 ATTAGGACGCGGACATCTTTGGG + Intergenic
926448197 2:12970293-12970315 ATTAGGATGTGAACATCTTTGGG - Intergenic
926591038 2:14740632-14740654 ATTAGGACATGGACATCTTTAGG - Intergenic
926665040 2:15512435-15512457 ATTAGGATGTGGACATCTTTTGG - Intronic
926845070 2:17127796-17127818 ATTAGAACATGGACATTTTTGGG - Intergenic
927231993 2:20833467-20833489 ATTAGGACATGGACATCTTTGGG - Intergenic
927293393 2:21426126-21426148 ACCAGAATGTGGACATCTTTGGG + Intergenic
927479622 2:23441947-23441969 ATTAGGACATGGACATCTTTGGG - Intronic
927828666 2:26328922-26328944 ATTTGCACATGGACATCTTTGGG - Intronic
928340588 2:30439873-30439895 ATTAGGACAGGGACATCTTTGGG - Intergenic
928350807 2:30552020-30552042 ATTAAGATGTGGACATCTTTTGG + Intronic
928395136 2:30937810-30937832 ATTAGGGTGTGGACATCTTTGGG + Intronic
928423578 2:31159362-31159384 ATTAGAACATGAACATCATTGGG + Intergenic
928700695 2:33895822-33895844 ATTAGTATCTGGACATCTTTGGG - Intergenic
929055031 2:37869258-37869280 ATTGGGACGTGGACATCTTTGGG + Intergenic
929338756 2:40786044-40786066 ATTAGAATGTGGATATCTTTGGG - Intergenic
929571565 2:43026350-43026372 ATTAGGATGTGGACATCTTCAGG + Intergenic
930035363 2:47082001-47082023 GTTAGAACATGGACACTTTTGGG - Intronic
930268019 2:49222700-49222722 ATTAGGACATGAACATCTTTGGG + Intergenic
930535283 2:52638150-52638172 ATTAGAATGTAGACATCTTGAGG + Intergenic
930726001 2:54681920-54681942 ATTAGGATGTGGACATCTTTGGG + Intergenic
930800334 2:55437296-55437318 ATTAGGAGGTGTACATCTTTGGG - Intergenic
931687458 2:64806729-64806751 ACTAGGACATGGACATCTTTGGG - Intergenic
931940389 2:67245743-67245765 ATTAGGACTTGGATATCTTTTGG - Intergenic
932269294 2:70395441-70395463 ATTAGCATGTGGACATATTTAGG + Intergenic
932553356 2:72795659-72795681 ATTAGGACATGGGCATCTTTGGG - Intronic
932558672 2:72848174-72848196 ATTAGGATGTGGACATCTTTTGG + Intergenic
932938265 2:76132037-76132059 ATTAGGATGGGGACATCTTTAGG + Intergenic
933244313 2:79958254-79958276 ATTAGGGCATGGACATCTTTGGG - Intronic
933266719 2:80188852-80188874 ATTAGGATGTGGATATCTTTGGG + Intronic
933527110 2:83455750-83455772 ATTAAGACATGGACATCTTTGGG - Intergenic
933616216 2:84484811-84484833 ATGAGAATGTGGATATCTTTGGG + Intergenic
933647951 2:84827591-84827613 GCTAGGTCATGGACATCTTTGGG - Intronic
933840080 2:86279497-86279519 ATTAGGACATGGACATCTTTGGG - Intronic
934032888 2:88064408-88064430 ATTAGAATCTGCACATCTTTGGG + Intergenic
934066221 2:88344580-88344602 ATTAGGATGTGAACATCTTTTGG - Intergenic
934173145 2:89556576-89556598 GTTAGGACGTGGACATCTTTGGG - Intergenic
934283461 2:91630933-91630955 GTTAGGACGTGGACATCTTTGGG - Intergenic
934719360 2:96562596-96562618 ATTAGGATGTGGACATCTTTAGG - Intergenic
934843962 2:97649757-97649779 TTTATGACGCGGACATCTTTGGG - Intergenic
935109245 2:100076872-100076894 ATTAGGAGGTGGGCATCTTTGGG - Intronic
935141568 2:100357742-100357764 ATTAGGGTGTGGACATCTTTGGG + Intergenic
935261662 2:101361282-101361304 ATTCGGATGTGGACATCTTTGGG - Intronic
935270104 2:101427185-101427207 ATTAGGACGTGGACATTTTTGGG - Intronic
935403052 2:102680675-102680697 ATTAGGATGTGGACATCTTTGGG - Intronic
935621850 2:105136808-105136830 ATTAGGTTGTGGACATCTTTGGG + Intergenic
935674309 2:105581068-105581090 GTTTCAAGGTGGACATCTTGTGG - Intergenic
935725900 2:106023817-106023839 ATTAGGATGTGGACATCTTTGGG + Intergenic
935786089 2:106550080-106550102 GTTAGGATGTGAACATCTTTGGG + Intergenic
935946542 2:108291439-108291461 ATTAGGACGTGGACATCTTTAGG + Intronic
936485276 2:112920056-112920078 ATTAGAATGTGGACATTTTCGGG + Intergenic
936502275 2:113075449-113075471 ATTAGGATGTGGACATATTTCGG - Exonic
936924357 2:117721570-117721592 TTTAGGAGGTGGATATCTTTGGG - Intergenic
937015513 2:118601860-118601882 ATTAGAACATGGACTTCTTTGGG - Intergenic
937080922 2:119139162-119139184 ATGAGAACATGGACATCTTTGGG + Intergenic
937157475 2:119731260-119731282 ATTAGAAAGTGGACATCTTTAGG - Intergenic
937489873 2:122355492-122355514 ATTAGGACTTGGAAATCTTTAGG - Intergenic
937583205 2:123514390-123514412 ATTAGAACCTGGACATCTTTGGG - Intergenic
937600117 2:123721399-123721421 GTTAGGATGTCGACATCTTTGGG + Intergenic
938681831 2:133699964-133699986 ACTAGGAAGTGGACATCTTTGGG + Intergenic
939073263 2:137568908-137568930 ATTAGGATGTGGACATCTTTGGG - Intronic
939233732 2:139464650-139464672 ATTAGATCATGTACATCTTTTGG - Intergenic
939478365 2:142715738-142715760 ATTAGAACGTGGACATCTTAGGG + Intergenic
940180122 2:150922811-150922833 ATTAGGATGTAGACATCTTTGGG - Intergenic
940208818 2:151235455-151235477 GTTAGGATGTGGACATCTTTGGG - Intergenic
940274270 2:151922561-151922583 ATTAGTATGTGGACATCTTTGGG + Intronic
940768655 2:157817396-157817418 GGTAGAACACGGAGATCTTTAGG + Intronic
941063844 2:160878575-160878597 ATTAGCATGTGGACATCTTTTGG + Intergenic
941114238 2:161452969-161452991 ACTAGAACATGGACATCTTTGGG + Intronic
941304012 2:163838748-163838770 ATTAGGACATGAACATCTTTGGG - Intergenic
941356889 2:164504723-164504745 ATGAGGATGTGGACATCTTTGGG - Intronic
941548032 2:166878360-166878382 ATTAGAACATGGATATTTTTAGG - Intergenic
941573701 2:167203183-167203205 ATTAGGATGTGAACATCTTTGGG + Intronic
941985867 2:171511185-171511207 ATTAGGAAGTGGCCATCTTTGGG - Intergenic
942030537 2:171954741-171954763 ATTAGGACATGGATATCTTTTGG - Intronic
942413966 2:175739002-175739024 ATTAGGATGTGGACATCCTTGGG - Intergenic
942614352 2:177774815-177774837 ATTAGGACATGGACATCTTGTGG - Intronic
942803980 2:179908393-179908415 GTTAGAACTTGGACAGTTTTTGG - Intergenic
943120728 2:183731960-183731982 ATTAGGATGTGAACATCTTTTGG + Intergenic
943179136 2:184521147-184521169 ATTAGGAAATGGACATCTTTGGG - Intergenic
943280353 2:185924263-185924285 GTTAGAAGGTGAACATCTTTGGG + Intergenic
943388572 2:187232718-187232740 ATTAGGATGTGGACATCTTCAGG + Intergenic
943426330 2:187740003-187740025 ATTAGAATGTGGACATTTTTAGG + Intergenic
943536415 2:189156187-189156209 ATTAGAGCATGGACATCTTTGGG + Intronic
943779802 2:191810577-191810599 ATAAGGACGTGGACATCTTTGGG + Intergenic
943919173 2:193680170-193680192 GTAATATCTTGGACATCTTTTGG + Intergenic
944108299 2:196103228-196103250 ATTAGGACATTGACATCTTTGGG - Intergenic
944314318 2:198269022-198269044 GTTAAAATGTGGACATCTTTAGG - Intronic
944427242 2:199596017-199596039 ATTAGGACATGGACATCTGTGGG - Intergenic
944482563 2:200172665-200172687 ATTAGGAAGTGGACATCTTTGGG + Intergenic
944630879 2:201622772-201622794 ATTAGGACATGGACATCTTTAGG + Exonic
944701582 2:202250788-202250810 ATTAGGACATGGATATCTTTTGG - Intergenic
945121614 2:206463121-206463143 ATTAGGATGTGGACATCTTTAGG - Intronic
945222380 2:207498028-207498050 GTGAGGACATGGACACCTTTTGG + Intergenic
945230982 2:207589539-207589561 ATTAGTACATGGACACCTTTGGG + Intronic
946033110 2:216720742-216720764 ATTAGGACATGGACATCTTTGGG + Intergenic
946150991 2:217770522-217770544 ATTAGGACATGGACGTCTTTGGG + Intergenic
946447678 2:219753734-219753756 ATTAGGTGGTGGACATCTTTGGG + Intergenic
946502566 2:220265370-220265392 GTCAGGACATGGACATCTTTAGG - Intergenic
946566531 2:220971795-220971817 ATTGGGATGTGGACATCTTTGGG - Intergenic
946585653 2:221184684-221184706 ATTAGGACATAGACATCTTTAGG - Intergenic
946893970 2:224304091-224304113 ATTAGGGCGTGGATATCTTTGGG - Intergenic
947259789 2:228208234-228208256 ATTAGAACATAGACACCTTTAGG - Intergenic
947425937 2:229982871-229982893 ATTAGGACATGGACATCTTTGGG + Intronic
947435688 2:230069991-230070013 ATTAGGATGTGGACATCTTTGGG + Intergenic
947504956 2:230701039-230701061 ATTAGGATGTGGACATCTTGGGG + Intergenic
947954815 2:234179522-234179544 ATTAGGATGTGGACATCCTTTGG + Intergenic
947982579 2:234423175-234423197 ATTAGGACATGGACATCTTTTGG - Intergenic
948026549 2:234782593-234782615 ATTAGGATGTGGACATCTTTGGG - Intergenic
948121063 2:235530823-235530845 ATTAGGACTTGGGCATCTTTGGG + Intronic
948193935 2:236081001-236081023 ATTAGGACGTTGACATCTTTGGG + Intronic
948436824 2:237959449-237959471 ATTAGGACAAGGACATCTTTAGG + Intergenic
948557136 2:238820871-238820893 ATTAGAATGTGGGCATCTTGGGG + Intergenic
948743577 2:240067570-240067592 ATTAAAATGTGGACATCATTAGG - Intergenic
1168802214 20:650880-650902 ATTCGGGCGTGGACATCTTTGGG - Intronic
1168914364 20:1474276-1474298 ATTAGGACATGGATATCTTTGGG + Intronic
1168970740 20:1929180-1929202 GTCAGATCGTGTCCATCTTTTGG - Intronic
1169256247 20:4101873-4101895 ATTAGGGCATGGACATCTTTGGG + Intergenic
1169314062 20:4573404-4573426 ATTAGGATGTGCACATCTTTGGG + Intergenic
1169409579 20:5356227-5356249 ATTAGGATGTAGACATCTTTGGG - Intergenic
1169499459 20:6145506-6145528 ATTAGGACAGGGACATCTTTGGG - Intergenic
1169780173 20:9301248-9301270 GTTAGGAGGTGGGTATCTTTTGG + Intronic
1169853747 20:10080887-10080909 ATTAGAATGTGGATGTCTTTGGG - Intergenic
1170032128 20:11954922-11954944 ATAAGGACGTGGGCATCTTTTGG - Intergenic
1170648091 20:18214390-18214412 ATCAGTACGTGAACATCTTTAGG - Intergenic
1171395372 20:24829588-24829610 ATTAGGAGGTGGACATCTTTGGG - Intergenic
1171539371 20:25934034-25934056 ATGAGGATGTGGACATCTTTGGG + Intergenic
1171801666 20:29626250-29626272 ATGAGGATGTGGACATCTTTGGG - Intergenic
1171842300 20:30229246-30229268 ATGAGGATGTGGACATCTTTGGG + Intergenic
1172886586 20:38235332-38235354 ATTAGGGCATGGACATCTTTGGG - Intronic
1172933746 20:38604057-38604079 ATTAGGATGTGGACATCTTGGGG + Intronic
1173013623 20:39205038-39205060 ATTAGGACGTAAACATCTTTGGG + Intergenic
1173127759 20:40355732-40355754 ATTAGGATGTGGACATCTTTGGG - Intergenic
1173190713 20:40873609-40873631 ATGAGGACATGGACATCTTTGGG - Intergenic
1173409539 20:42797595-42797617 ATTAGGATATGGACATCTTTGGG - Intronic
1173474869 20:43351935-43351957 ATTAGGACATGGGCATCTTTGGG - Intergenic
1173488059 20:43456187-43456209 ATTAGGACATAGACATCTTTAGG + Intergenic
1173565373 20:44034801-44034823 ATTAGGATGTAGACATCTTTTGG - Intronic
1173888191 20:46480254-46480276 GTTAGGATGTGGACATGTTTGGG + Intergenic
1174539742 20:51279605-51279627 ATTAGGACATAGACATCTTTGGG - Intergenic
1175039619 20:56035897-56035919 ATTAGGATGTGAACATCTTTAGG + Intergenic
1175231158 20:57474249-57474271 ATTAGGACATGGACATCTTTGGG - Intergenic
1175294530 20:57899244-57899266 GTCAGAATGCAGACATCTTTGGG + Intergenic
1175478731 20:59296325-59296347 ATTAGGACATGGACATCTTTGGG + Intergenic
1175496007 20:59414717-59414739 TTTAAGACATGGACATCTTTGGG + Intergenic
1175667627 20:60873602-60873624 ATTAGGACATGGACATCTTTAGG + Intergenic
1175690938 20:61065619-61065641 ATCAGGATGTGGACATCTTTGGG + Intergenic
1176720579 21:10389634-10389656 ATTAGGACATGGATATCTTTGGG - Intergenic
1176720597 21:10389735-10389757 ATTAGGACATGGACATCTCTGGG - Intergenic
1176720607 21:10389784-10389806 ATTAGGATGTGGACATTTTTGGG - Intergenic
1176720632 21:10389934-10389956 ATTAGGATGTGGACATCTTTGGG - Intergenic
1176720641 21:10389982-10390004 ATTAGGACATGGACATCTTTGGG - Intergenic
1176720664 21:10390127-10390149 ATTAGGATGTGGACATCTTTGGG - Intergenic
1176720679 21:10390224-10390246 ATTAGGACGTGGACATCTTTGGG - Intergenic
1176720686 21:10390273-10390295 ATTAGGATGTGTACATCTTTGGG - Intergenic
1176720695 21:10390322-10390344 ATTAGGATGTGGACATCTTTGGG - Intergenic
1176720704 21:10390371-10390393 ATTAGGATGTGTACATCTTTGGG - Intergenic
1176720713 21:10390420-10390442 ATTAGGACGTGGACATCTTTGGG - Intergenic
1176720722 21:10390469-10390491 ATTAGTATGTGGACATCTTTGGG - Intergenic
1176720738 21:10390567-10390589 ATTAGGATGTGGACATCTTTGGG - Intergenic
1176720756 21:10390665-10390687 ATTAGGCCATGGACATCTTTGGG - Intergenic
1176978621 21:15353401-15353423 AATAGAATGTGGAAATCTTTGGG - Intergenic
1177006976 21:15685829-15685851 ATTTGAGCATGGACATCTTTAGG + Intergenic
1177036754 21:16054210-16054232 ATTAAGACATGGACATCTTTGGG - Intergenic
1177036908 21:16055662-16055684 ATTAGAACATGGACATCTTTGGG - Intergenic
1177100170 21:16891390-16891412 ATTAGGACATGGGCATCTTTGGG - Intergenic
1177117288 21:17101753-17101775 ATTAGAATATGGACATTTTTGGG + Intergenic
1177141532 21:17363021-17363043 ATTAGGATGTGGACATCTTTGGG - Intergenic
1177276701 21:18921547-18921569 AATAGAACATAGACATCTTTGGG + Intergenic
1177453815 21:21308001-21308023 GTTAGGGCATTGACATCTTTGGG + Intronic
1177694257 21:24552085-24552107 ATTAGGACGTGGATATGTTTTGG + Intergenic
1177699020 21:24612635-24612657 ATTAGAATGTGAATATCTTTTGG + Intergenic
1177700181 21:24628989-24629011 GTTACAACAGGGAGATCTTTTGG - Intergenic
1177874285 21:26612016-26612038 ATTAGAACCTGGATATCTTTGGG + Intergenic
1177955543 21:27593882-27593904 TTTAGAGAGTGAACATCTTTAGG + Intergenic
1178517185 21:33257932-33257954 ATTAGGATGTAGACATCTTTGGG - Intronic
1178533305 21:33392875-33392897 GTTAGGTTGTGGACATCTCTGGG - Intergenic
1178536092 21:33411490-33411512 ATGAGGGCGTGGACATCTTTGGG - Intronic
1178795880 21:35743904-35743926 ATGAGGACGTGGACATCTTTGGG - Intronic
1179041020 21:37802290-37802312 GTTAGGAAGTGGACATCTTTGGG - Intronic
1179167091 21:38943829-38943851 ATTAGGACGTGGACATCTTTGGG - Intergenic
1179224193 21:39438957-39438979 ATTAGGACATGGACATCCTTAGG - Intronic
1179281429 21:39937497-39937519 TTTTGGACATGGACATCTTTAGG - Intergenic
1179596809 21:42448456-42448478 ATTAGGACATGAACATCTTTGGG + Intergenic
1179893414 21:44349212-44349234 GTGAGATGGTGGACATCCTTGGG + Intergenic
1180301798 22:11042578-11042600 ATTAGGACATGGACATCTCTGGG - Intergenic
1180301808 22:11042627-11042649 ATTAGGATGTGGACATCTTTGGG - Intergenic
1180301833 22:11042777-11042799 ATTAGGATGTGGACATCTTTGGG - Intergenic
1180301842 22:11042825-11042847 ATTAGGACATGGACATCTTTGGG - Intergenic
1180301863 22:11042970-11042992 ATTAGGATGTGGACATCTTTGGG - Intergenic
1180301878 22:11043067-11043089 ATTAGGATGTGTACATCTTTGGG - Intergenic
1180301887 22:11043116-11043138 ATTAGGACGTGGACATCTTTGGG - Intergenic
1180301896 22:11043165-11043187 ATTAGGATGTGTACATCTTTGGG - Intergenic
1180301905 22:11043214-11043236 ATTAGGACGTGGACATCTTTGGG - Intergenic
1180301914 22:11043263-11043285 ATTAGTATGTGGACATCTTTGGG - Intergenic
1180301930 22:11043361-11043383 ATTAGGATGTGGACATCTTTGGG - Intergenic
1180301947 22:11043459-11043481 ATTAGGACATGGACATCTTTGGG - Intergenic
1180606450 22:17062420-17062442 ATTAGGATGTGAACATCTTTGGG + Intergenic
1181753543 22:25006966-25006988 ATTAGGACCTGGACATTTTTGGG + Intronic
1181881367 22:25982844-25982866 ATTAGATCATAGACATCTTTGGG + Intronic
1181883720 22:26002055-26002077 GTTAGAATGTGAACATCTTTGGG + Intronic
1182275919 22:29188571-29188593 GTTAGGACTTCAACATCTTTTGG + Intergenic
1182409107 22:30167364-30167386 TTTAGGACATGAACATCTTTGGG + Intronic
1182517286 22:30866112-30866134 ATTAGGACATGGACATCTTTGGG - Intronic
1182883329 22:33752788-33752810 ATTAGGATGTGGACATCTTTTGG - Intronic
1183125139 22:35771095-35771117 ATTAGGATGTGGACAACTTTGGG - Intronic
1183170275 22:36182740-36182762 GTTAGGACATGCACATCTGTAGG + Intergenic
1183208278 22:36433957-36433979 ATCAGGACATGGACATCTTTGGG + Intergenic
1183245136 22:36687587-36687609 ATTGGGATGTGGACATCTTTGGG - Intronic
1183415835 22:37681372-37681394 GTTAGAATGAGAACATCATTAGG + Intergenic
1183514869 22:38259305-38259327 GTTAGGATGTCAACATCTTTGGG - Intronic
1183607569 22:38874928-38874950 GCTAGGACACGGACATCTTTCGG + Intergenic
1184124199 22:42475508-42475530 ATTAGGACATGGACATCTTGGGG - Intergenic
1185063071 22:48617082-48617104 ATTAGAACCCGGACATCTTTTGG - Intronic
949096769 3:95636-95658 GTTAGAACATGGACATCTCTTGG + Intergenic
949135124 3:555101-555123 AGTAGCACATGGACATCTTTGGG - Intergenic
949238629 3:1842251-1842273 ATTAGGACTTGGACATCTTTGGG - Intergenic
949286352 3:2410359-2410381 GTTAGAAGATGGAAATCTTCTGG - Intronic
949644544 3:6077871-6077893 ATTAGGATGTAGACATCTTTTGG - Intergenic
949676234 3:6456472-6456494 GTTAGGACTTCAACATCTTTTGG + Intergenic
949724274 3:7025306-7025328 ATTAGGATGTGGACATCTCTGGG + Intronic
950741546 3:15056381-15056403 GTTAGGATGTGGACATCTCTGGG - Intronic
951057820 3:18168346-18168368 GTTAGAGCATGGACATCTTTTGG + Intronic
951307329 3:21081461-21081483 ATTAGAAGATGGACATCTTTGGG + Intergenic
951512989 3:23525296-23525318 ATTAGGATGTGGACATCTTTGGG + Intronic
951737321 3:25882253-25882275 GTTAGGACATGGGCATCTTTGGG + Intergenic
952196803 3:31084470-31084492 ATTAGGACATGAACATCTTTGGG - Intergenic
952258967 3:31720907-31720929 ATCAGGACTTGGACATCTTTGGG - Intronic
952349574 3:32521490-32521512 ATTTGAATGTGGACATTTTTGGG - Intergenic
952397744 3:32935908-32935930 ATTAGAACATGGACACCCTTGGG - Intergenic
952483166 3:33783065-33783087 ATTAGAATGTGGACATTTTAGGG - Intergenic
952721633 3:36539875-36539897 GTTAGGACCCGGGCATCTTTGGG - Intronic
952840239 3:37640102-37640124 ATTAGGGCATGGACATCTTTGGG - Intronic
952853587 3:37749418-37749440 ATGAGGACATGGACATCTTTGGG + Intronic
953191709 3:40693979-40694001 GTGAAAACTTGGCCATCTTTTGG - Intergenic
953542901 3:43838058-43838080 ATCAGCACGTGGACATCTTTGGG + Intergenic
953852315 3:46473847-46473869 ATTAGGACATGGACATCTTTGGG + Intronic
953953811 3:47214688-47214710 GTTAGGACATGGGCATCTTCGGG - Intergenic
954732029 3:52672393-52672415 ATTAGAATGTGGAAATATTTGGG + Intronic
954850590 3:53596439-53596461 ATTAGGATGTGGAAATCTTTTGG - Intronic
954894111 3:53961104-53961126 ATTAGGACTTGGACATCTTCAGG - Intergenic
954924334 3:54219023-54219045 ATTAGGACATGGACATCTTTGGG + Intronic
955218346 3:57003561-57003583 ATTAGGATGGGGACATCTTTTGG - Intronic
955325447 3:58006688-58006710 GTTAGGATGTGAACGTCTTTGGG - Intergenic
955567840 3:60268720-60268742 ATTAGGACATGGACATCTATAGG - Intronic
955598528 3:60618626-60618648 ATTAAAACGTTGACATCTTTAGG - Intronic
955863642 3:63358570-63358592 ATTAGAACATGAACATCTTTAGG + Intronic
955888406 3:63624651-63624673 GTTAGAATGTGAACATCTTTGGG + Intergenic
956106866 3:65828638-65828660 ATGAGAACGTGGACATCATTAGG - Intronic
956315753 3:67934533-67934555 ATTAGAATCTGGACATCTTTGGG - Intergenic
956380560 3:68660486-68660508 GTTAGAACATGAACATCTTTGGG - Intergenic
956393392 3:68799114-68799136 ATTAGGACGTGAACATCTTGAGG - Intronic
956928347 3:74014286-74014308 ATTAGGACATGGACATCTTAAGG - Intergenic
957277277 3:78106999-78107021 GTTAGCACATGTACATCTTTGGG + Intergenic
957691526 3:83576967-83576989 ATCAGAACATGGACATCCTTGGG + Intergenic
957940440 3:86996491-86996513 ATTAGAATGTGGACATCTTTGGG - Intergenic
957978430 3:87476235-87476257 ATTAGAATATGGACATCTTTGGG + Intergenic
958736171 3:98011658-98011680 ATTAGGACATGGATATCTTTTGG + Intronic
959010823 3:101074102-101074124 ATTAGAATGTGGACATCTTGGGG - Intergenic
959099780 3:101997218-101997240 ATTAGGACCTGGACATCTTTTGG - Intergenic
959149192 3:102588263-102588285 ATTAGGACATGGATATCTTTAGG + Intergenic
959231531 3:103659952-103659974 GTTAGAAAATGAACATTTTTTGG - Intergenic
959239634 3:103773181-103773203 ATTAAAACATGGATATCTTTCGG + Intergenic
959284394 3:104389827-104389849 ATTAGGACATGGACATCTTAAGG - Intergenic
959412411 3:106041071-106041093 ATTAGGGAGTGGACATCTTTGGG + Intergenic
959492161 3:107003136-107003158 GTTAGAGCTTGAACATTTTTAGG - Intergenic
959687106 3:109159379-109159401 ATTAGGATGTGGACATCTTTGGG + Intergenic
959908022 3:111731818-111731840 ATTAGGATGTGGACATTTTTGGG + Intronic
959911810 3:111771815-111771837 GTTAGGACTTCAACATCTTTTGG + Intronic
959980278 3:112508234-112508256 ATTAGGCTGTGGACATCTTTGGG + Intergenic
960027105 3:113021838-113021860 ATTAGCATGTGAACATCTTTGGG + Intergenic
960170937 3:114460299-114460321 ATTAGGACATGGATATCTTTTGG - Intronic
960237048 3:115295707-115295729 ATTAGGATGTGGACATCTTCTGG - Intergenic
960247486 3:115415260-115415282 ATTAGGACGTGGACATCTTTGGG + Intergenic
960883953 3:122375439-122375461 GTTAGAAAGTTGTAATCTTTTGG + Intronic
961170633 3:124795532-124795554 ATTAGGATGTGGACATCTCTGGG - Intronic
963075753 3:141344902-141344924 ATTAGGACCTGGACATCTTTGGG + Intronic
963417062 3:145010179-145010201 ATTAGAAAGTGGGCTTCTTTGGG - Intergenic
963417820 3:145020869-145020891 ATGAGCACGTGGACATCTTTGGG - Intergenic
963665608 3:148181505-148181527 ATTAGAATGTGAACATCATTGGG + Intergenic
964143796 3:153434146-153434168 ATTAGGATGTGGAAATCTTTGGG + Intergenic
964239054 3:154570091-154570113 ATTATTACATGGACATCTTTGGG + Intergenic
964292725 3:155199464-155199486 GTTAGGACTTCAACATCTTTTGG - Intergenic
964295498 3:155228532-155228554 ATTAGAATGTGGACATCTTCAGG - Intergenic
964509200 3:157431616-157431638 ATTAGAACATGGACATCTTTGGG + Intronic
964817363 3:160731098-160731120 ATTAGGATGTGGACATCTTTGGG + Intergenic
964939817 3:162144055-162144077 GATTGGACGTAGACATCTTTAGG + Intergenic
965348037 3:167576438-167576460 ATTAGGACATGGACATCTTTGGG - Intronic
965373299 3:167891239-167891261 ATTAAGATGTGGACATCTTTGGG + Intergenic
965610393 3:170537458-170537480 ATTAGAACATGGACATCTCTGGG + Intronic
965837840 3:172870722-172870744 ATGAGAACTTGGACATCTTCGGG + Intergenic
966018536 3:175176478-175176500 GTTAGAATGTGGCCATCAATTGG - Intronic
966164105 3:176997865-176997887 ATTAGGATGTGGACATATTTAGG - Intergenic
966323416 3:178727392-178727414 ATTAGGACATAGACATCTTTAGG - Intronic
966335912 3:178868061-178868083 ATTAAAATGTGAACATCTTTGGG - Intergenic
966501494 3:180646504-180646526 GTTAGAACGTCTTCATCTTTAGG - Intronic
966538594 3:181063531-181063553 TTCAGAACTTGGACATATTTGGG + Intergenic
966562615 3:181340557-181340579 ATTAGAATGTAGACATCTTTGGG - Intergenic
966990460 3:185224982-185225004 ATTAGGACGTGGACATCTTTGGG + Intronic
967103086 3:186233045-186233067 ATCAGAACGTGGACATCTTCAGG - Intronic
967288973 3:187900892-187900914 ATTAGGACATGGGCATCTTTGGG + Intergenic
969072842 4:4553183-4553205 ATTAGGACTTGGACATTTTTGGG + Intergenic
969118988 4:4893182-4893204 ATCAGGAAGTGGACATCTTTGGG - Intergenic
969143342 4:5099320-5099342 ACTAGAATGTGGGCATCTTTGGG + Intronic
969222671 4:5771530-5771552 ATTGGGACGTGGACATCTTTAGG + Intronic
969302587 4:6305957-6305979 ATTAGGACCTGGACACCTTTGGG - Intergenic
969342771 4:6552741-6552763 ATTAGAATGTGGACATCTTTGGG + Intronic
969496115 4:7527236-7527258 ATTAGGACGTGGACGTCTGTGGG - Intronic
969827001 4:9765438-9765460 GTTAGGACATGGACATCTTTGGG - Intergenic
969917596 4:10505845-10505867 ATTAGAATGTGAACATCTTTGGG + Intronic
970063963 4:12069686-12069708 ATTATAACGTAAACATCTTTGGG - Intergenic
970314345 4:14815167-14815189 ATTGGGACGTGCACATCTTTGGG + Intergenic
970573061 4:17401484-17401506 ATTAGGACATGGACATCTTCAGG + Intergenic
970658000 4:18253364-18253386 CTTAGAACATGGGCTTCTTTGGG - Intergenic
970680669 4:18503946-18503968 GTTAGGATGTGGACACCTTTGGG + Intergenic
970815399 4:20150372-20150394 ATTAGAATGTGGATATCTTTGGG + Intergenic
970906522 4:21223004-21223026 ATTAGGATGTGGACATCTTTGGG - Intronic
971264250 4:25084226-25084248 ATTAGGACATGGGCATCTTTGGG - Intergenic
971443243 4:26712982-26713004 ATTAGGATGTGGACATCTTCGGG + Intronic
971506066 4:27367703-27367725 ATTAGGACATGGACATCTTTGGG + Intergenic
971759567 4:30747769-30747791 ATTAGGATGTGGACATCTTAGGG + Intronic
971766083 4:30833614-30833636 GTAAGGATGTGGGCATCTTTGGG + Intronic
971797025 4:31241597-31241619 ATTAGGATGTGGACATCCTTGGG - Intergenic
972118645 4:35671586-35671608 ATTGGAATGTGAACATCTTTGGG + Intergenic
972279350 4:37587356-37587378 ATTAGGATGTGGATATCTTTGGG + Intronic
972298933 4:37766929-37766951 ATGAGAATGTTGACATCTTTGGG + Intergenic
972908549 4:43784119-43784141 ATTAAAACGTGGATATCCTTTGG - Intergenic
972955101 4:44379188-44379210 ATTAGATCATGGACATCTTTGGG + Intronic
973219420 4:47708542-47708564 TTTAGGACATGGACATCTTTGGG + Intronic
973334052 4:48938202-48938224 ATTAGGAGGTGGATATCTTTGGG - Intergenic
974313513 4:60245620-60245642 CTTATAATGTGAACATCTTTGGG - Intergenic
974480893 4:62441602-62441624 ATTAGAACCTAGACATCTTTGGG + Intergenic
974802849 4:66841004-66841026 ATTAGAATGTAGATATCTTTGGG + Intergenic
974854021 4:67437993-67438015 ATTAGTATGTGGACATCTTTCGG - Intergenic
975196199 4:71527096-71527118 ATTAGGACGTGGGCATCTTTAGG + Intronic
975211398 4:71704227-71704249 ATTAGAATGTGGACATCTTTGGG + Intergenic
975385069 4:73747784-73747806 GTTAGAGCATGAACATCTCTTGG - Intergenic
975454996 4:74579570-74579592 ATTAGGACATGGACATCTTTAGG + Intergenic
975559744 4:75698052-75698074 ATTAGAACATGGACACCTTTGGG - Intronic
975960636 4:79899945-79899967 ATTAGGATGTGGACATCTTGAGG - Intergenic
976179412 4:82384974-82384996 ATTTGGATGTGGACATCTTTGGG - Intergenic
976471497 4:85434357-85434379 ATTAGGGCATGGACATCTTTAGG + Intergenic
977095370 4:92735994-92736016 ATTAGAAAGTGGGTATCTTTGGG - Intronic
977239333 4:94547610-94547632 ATTAGGACAGGGACATCTTTGGG + Intronic
977442003 4:97079626-97079648 ATTAGAATGCAGACATCTTTAGG + Intergenic
977847873 4:101787473-101787495 ATGAGAATGTGGACCTCTTTGGG + Intronic
978303584 4:107296886-107296908 GATTGAATGTGGACATATTTAGG + Intergenic
978352361 4:107833364-107833386 ATTAGGATGTGAACATCTTTGGG - Intronic
978490392 4:109305539-109305561 ATTAGGACATGGACATCTTTGGG - Intergenic
978630131 4:110734507-110734529 ATTGGGATGTGGACATCTTTGGG + Intergenic
978661010 4:111126388-111126410 ATTACAGCATGGACATCTTTGGG - Intergenic
978963175 4:114709117-114709139 ATTAGGACATTGACATCTTTGGG + Intergenic
979006209 4:115300455-115300477 ATTAGGATGTGGATATCTTTGGG + Intergenic
979079314 4:116313519-116313541 GTTAGGACATGGACATATTTGGG - Intergenic
979155379 4:117381223-117381245 ATTAGGATGTGGACATCTTTGGG + Intergenic
979158740 4:117430712-117430734 ATTAGAATGTGGACTTCTTTGGG + Intergenic
979344530 4:119571243-119571265 ATTAGGACAAGGACATCTTTGGG - Intronic
979663066 4:123280839-123280861 ATTAGAAGGTGGATATCTTGGGG + Intronic
979672704 4:123377491-123377513 ATTAGGACATGGACCTCTTTGGG + Intergenic
979761030 4:124405235-124405257 ATTAGGACATGGACATCTTTGGG - Intergenic
979902339 4:126237837-126237859 ACTAGAAGGTGGACATCATTGGG - Intergenic
979937216 4:126713011-126713033 ATTAGGATGTGAACATCTTTGGG + Intergenic
980296763 4:130929264-130929286 GATAGCACTTGGACATCATTTGG - Intergenic
980555034 4:134392793-134392815 GTTAGAACCTTAACATCTTTTGG + Intergenic
980841532 4:138266930-138266952 ATTAGGATATGGACATCTTTAGG + Intergenic
981291575 4:143082492-143082514 ATGAGAATGTAGACATCTTTGGG - Intergenic
981339797 4:143608193-143608215 GTTAGAATGTGGATATCTTTGGG + Intronic
981452477 4:144914286-144914308 ATTAGGACAGGGACATCTTTGGG + Intergenic
981496413 4:145398417-145398439 ATTAGGACCTGGATATCTTTGGG - Intergenic
981517752 4:145628714-145628736 ATTCGGACGTGGACATGTTTGGG + Intronic
981605483 4:146536020-146536042 ATTAGAATGTGGAGATCTTTGGG + Intergenic
981661735 4:147175409-147175431 ATTAGGACCTGGACATCGTTGGG - Intergenic
981701320 4:147610165-147610187 ATTGGGACATGGACATCTTTTGG - Intergenic
981830756 4:148998429-148998451 CTTATAACCTGGACAACTTTGGG + Intergenic
981962752 4:150561332-150561354 AATAGAATGTGGACATCTTTGGG - Intronic
982320577 4:154072862-154072884 ATTGGAACTTAGACATCTTTGGG - Intergenic
982527894 4:156502791-156502813 GTTAGAACATGGACATTTCTAGG + Intergenic
982889956 4:160835007-160835029 ATTAGGATGTGGACATCTTTGGG - Intergenic
982942364 4:161574236-161574258 ATTAGGATGTGGAAATCTTTTGG + Intronic
982990217 4:162264003-162264025 ATTAGAATTTGGACATCCTTGGG + Intergenic
983141107 4:164150785-164150807 ATTAGTACGTGAACATCTTTCGG - Intronic
983672168 4:170250667-170250689 ATCAGCACATGGACATCTTTCGG - Intergenic
983855303 4:172636348-172636370 ATTAGGACATGGACATCTTTGGG - Intronic
983862351 4:172723257-172723279 ATGAGAATGTGGACATCTTTTGG + Intronic
984053539 4:174897221-174897243 ATTGGAATGTGGACATATTTGGG + Intronic
984218896 4:176948948-176948970 ATTACAATGTGGATATCTTTGGG - Intergenic
984242358 4:177232993-177233015 ACTAGAATGTGAACATCTTTGGG - Intergenic
985968963 5:3360433-3360455 GTTACGATGTGGACATATTTGGG - Intergenic
986205088 5:5616514-5616536 ATTAGGACATGGACATCCTTGGG - Intergenic
986417599 5:7544683-7544705 ATTAGAACGTGGACATCTTGTGG + Intronic
986460573 5:7966925-7966947 ATTAAGACGTGGACATCTTTGGG - Intergenic
986788524 5:11138374-11138396 ATTAGGATGTAGACATCTTTGGG + Intronic
987017576 5:13836084-13836106 GTTCGGACATGGACATCTTTTGG + Intronic
987022815 5:13892299-13892321 ATTAGGATGTGGACATCCTTGGG - Intronic
987038304 5:14039126-14039148 GTTAGAACTTGGACATATTTTGG + Intergenic
987150905 5:15038686-15038708 ATTAGAATGTGAACATCTTTAGG + Intergenic
987431394 5:17838445-17838467 ATTAGGATGTGGACATATTTGGG - Intergenic
987442136 5:17968707-17968729 ATTAGAACTTGGACATATTTAGG + Intergenic
987588434 5:19890403-19890425 ATTAGGATGTGGAAATCTTTGGG + Intronic
987950522 5:24669333-24669355 ATTAGGATGTGGATATCTTTGGG - Intergenic
988081900 5:26425828-26425850 GTTAGGATGTGATCATCTTTGGG + Intergenic
988091476 5:26545704-26545726 ATTAGAGCCTGGACATCTTTGGG + Intergenic
988445585 5:31282617-31282639 ATTAGGACATGGACATCTTTGGG + Intronic
988468310 5:31512555-31512577 ATTAGGACATGGACATCTTTGGG - Intronic
988600178 5:32632384-32632406 ATTAGGGTGTGGACATCTTTTGG + Intergenic
988709943 5:33763141-33763163 ATTAGGACGTTGACAGCTTTGGG - Intronic
988875299 5:35438633-35438655 ATTAAGACATGGACATCTTTGGG + Intergenic
988995008 5:36706350-36706372 GTTAGGATGTGGATATGTTTGGG - Intergenic
988999086 5:36742612-36742634 ATCAGGATGTGGACATCTTTGGG - Intergenic
989328622 5:40228967-40228989 ATTAGGATATGGACATCTTTGGG + Intergenic
989585486 5:43071288-43071310 GTTAACACGCTGACATCTTTCGG + Intronic
989729646 5:44633393-44633415 GTTTAAATGTGGACATCTTTGGG - Intergenic
990157946 5:52900979-52901001 ATTAGGACATGGACATCTTTGGG - Intronic
990276459 5:54202232-54202254 GTTAGGATATGGATATCTTTTGG - Intronic
990312919 5:54556640-54556662 ATTAGAATATGGACATCTTTGGG + Intergenic
990564360 5:57014677-57014699 ATTAGAATGTGGACATATCTGGG - Intergenic
990568872 5:57057452-57057474 ATTACATCGTGGACATCTTTAGG - Intergenic
990616553 5:57514412-57514434 ATTAGGACCTGGATATCTTTGGG + Intergenic
990624623 5:57597563-57597585 ATTAGGATGTGGACATCTTGAGG + Intergenic
990724353 5:58736775-58736797 GTTATAACGTCAACATCTTTTGG + Intronic
990737294 5:58878284-58878306 ATTAGAACATGGACATCTTTGGG - Intergenic
990925838 5:61021554-61021576 ATTAGTACATAGACATCTTTAGG + Intronic
991025219 5:62021851-62021873 ATTAGGATGTGGATATCTTTAGG + Intergenic
991094060 5:62720620-62720642 TTGAGGATGTGGACATCTTTGGG + Intergenic
991216650 5:64163991-64164013 ATTAGAATGTGGACATTTTGGGG + Intergenic
991221387 5:64223399-64223421 ATTAGGACCTGGACATCTTTGGG + Intronic
991272045 5:64795795-64795817 ATTAGGACATGGACATCTTAGGG + Intronic
991386630 5:66098125-66098147 ATTAGAACATGCACATCTTTAGG - Intergenic
991417971 5:66411132-66411154 ATTAGGACATGGCCATCTTTGGG - Intergenic
991626092 5:68602392-68602414 ATTAGAACCTGGATAACTTTTGG + Intergenic
992165618 5:74047956-74047978 ATTAGAACACAGACATCTTTGGG + Intergenic
992318773 5:75588963-75588985 ATTAGGATGTGGACATCTTTAGG + Intronic
992385654 5:76281952-76281974 ATTAGGATGAGGACATCTTTAGG + Intronic
992591847 5:78303683-78303705 ATTAGAATTTGGACATATTTGGG + Intergenic
992596849 5:78355975-78355997 ATTATAGCATGGACATCTTTGGG + Intergenic
992647831 5:78828747-78828769 ATTGGGACGTGGATATCTTTAGG - Intronic
993411148 5:87574854-87574876 ATTAGAATGTGGACATTTTGGGG - Intergenic
993878439 5:93336315-93336337 GTTAGGACATGGACATCTTTGGG + Intergenic
993880535 5:93355662-93355684 ATTAGTACATGGATATCTTTGGG - Intergenic
993884942 5:93405106-93405128 ATTAGAACATGAACATTTTTCGG - Intergenic
994667813 5:102728031-102728053 ATTGGAATGTGGACATCTTTGGG - Intergenic
995234234 5:109807763-109807785 ATTAGGACATGGACATCTTGGGG + Intronic
995262150 5:110116671-110116693 GTTAGGATGTGGATATATTTAGG + Intergenic
995272350 5:110236006-110236028 ATTAGAATGTGGACAACTTTGGG + Intergenic
995387161 5:111600696-111600718 ATTAACACGTGGACATCTTTGGG + Intergenic
995405980 5:111796416-111796438 ATTAGAATGTGAATATCTTTAGG + Intronic
995936688 5:117524683-117524705 ATTAGAATGTGAAGATCTTTGGG + Intergenic
995958483 5:117810249-117810271 ATAAGGATGTGGACATCTTTGGG - Intergenic
996382533 5:122876961-122876983 GTTAGAGAGTGGAAATATTTTGG + Intronic
996442193 5:123504186-123504208 ATTAGGATGCGGACATCTTTGGG - Intergenic
996541363 5:124632761-124632783 ATTAGGACATGGACATCTTTGGG - Intergenic
996945755 5:129065713-129065735 ATTAAGACGTAGACATCTTTTGG - Intergenic
997320115 5:132970970-132970992 ATTAGTACATGAACATCTTTGGG + Intergenic
997460161 5:134046557-134046579 ATTAGGATGTGGACATCTTGGGG + Intergenic
997604149 5:135162059-135162081 ATTAGGACATGGACATCTTTGGG + Intronic
997624232 5:135320702-135320724 ATTAGGATGTGGACATCTTTAGG - Intronic
997715322 5:136038270-136038292 ATTAGGATGTGGACATTTTTGGG - Intronic
997927832 5:138047205-138047227 GTCTGAATGTGGACATCTTTGGG - Intronic
997966904 5:138364929-138364951 GTTAGAAAGTAGAAAACTTTGGG + Intronic
998675527 5:144403719-144403741 ATTAGAACATGGGCATCTTTGGG + Intronic
998942714 5:147302099-147302121 ATTATAATGTGGACAGCTTTGGG + Intronic
998977966 5:147669020-147669042 GTTAAAAAGTGGAAACCTTTGGG - Intronic
999063116 5:148656181-148656203 ATTAGGACATGGATATCTTTGGG - Intronic
999194051 5:149769998-149770020 ATCAGGACGTGGACATCTGTGGG + Intronic
999240747 5:150125987-150126009 CTTAGAATGTTGACATCTTAAGG + Intronic
999403466 5:151285578-151285600 ATTAGGATGTGAACATCTTTGGG - Intronic
999446036 5:151640109-151640131 ATCAGGACATGGACATCTTTGGG + Intergenic
999736209 5:154515263-154515285 GTTAGAAAGTGAACACCTCTCGG + Intergenic
999804512 5:155069405-155069427 GATTGGACATGGACATCTTTGGG - Intergenic
999889154 5:155957829-155957851 GTTAGGACATGGACATCTTTGGG + Intronic
999966537 5:156816319-156816341 ATTAGAACGGGGACATCTTTGGG - Intergenic
999977973 5:156930849-156930871 ATTAGGACATGGACATATTTGGG - Intronic
1000123927 5:158225135-158225157 ATTAAAACATGGACATATTTGGG - Intergenic
1000276871 5:159745631-159745653 GTTAGGATATGGACATCTTTGGG - Intergenic
1000285609 5:159823820-159823842 GTTAGAACTTGAAAATATTTGGG + Intergenic
1000287394 5:159838409-159838431 TTTAGGATGTGGACATCTCTGGG - Intergenic
1001233883 5:170013313-170013335 ATTAGGACATGGACATCTTTGGG - Intronic
1001234013 5:170014263-170014285 ATTAGGACATGGACATCTTTGGG - Intronic
1001698138 5:173687858-173687880 ATTAAGACATGGACATCTTTGGG + Intergenic
1001770724 5:174293907-174293929 ATTAGAATGTGGAAATCTTTAGG - Intergenic
1002072863 5:176690779-176690801 ATTAGACTGAGGACATCTTTGGG + Intergenic
1002871150 6:1168438-1168460 ATTAGAACATGGGCATCCTTGGG - Intergenic
1002949087 6:1790845-1790867 GTTAGGGCATGAACATCTTTGGG - Intronic
1003373281 6:5549756-5549778 ATTAGGACGTAGATATCTTTGGG + Intronic
1003487651 6:6593444-6593466 GTTAAGAGGTAGACATCTTTGGG + Intronic
1003580458 6:7335298-7335320 ATTAGAACTTGGATATCTTTGGG + Intronic
1003878367 6:10458224-10458246 GTTAAGATGTGGATATCTTTTGG + Intergenic
1003981281 6:11392530-11392552 ATTAGGATGTGGACATGTTTAGG + Intergenic
1004003533 6:11618557-11618579 ATTAGGATGTAGACATCTTTAGG + Intergenic
1004019018 6:11759668-11759690 ATTAGGACATAGACATCTTTGGG - Intronic
1004080227 6:12385389-12385411 ATTAGGATGTAGACATCTTTTGG - Intergenic
1004222376 6:13757956-13757978 ATTCGGATGTGGACATCTTTGGG - Intergenic
1004576455 6:16900384-16900406 TTTAGGATGTGGACATCTTTGGG - Intergenic
1004999229 6:21224132-21224154 ATTAGGATATGGACATCTTTGGG - Intronic
1005163947 6:22897696-22897718 ACTAGCACATGGACATCTTTAGG - Intergenic
1005347463 6:24904575-24904597 ATTAGGACATGGACATCTTTGGG + Intronic
1005520244 6:26594913-26594935 GTTTGAATGTGGTCATCCTTAGG + Intergenic
1005604817 6:27465925-27465947 GTTGGGACATGGACATCTTTGGG - Intronic
1005678670 6:28182934-28182956 ATTAGGACATAGACATCTTTGGG + Intergenic
1005702310 6:28414380-28414402 GTTAAAACTTGGTCATCTTATGG + Intergenic
1005708158 6:28477575-28477597 ATTAGAGCATGGATATCTTTTGG + Intergenic
1005902468 6:30228930-30228952 ATTAGGACATGGACATCTTGGGG + Intergenic
1007736284 6:43984320-43984342 GTTAGAACATGGACATTTTGGGG + Intergenic
1007743686 6:44029214-44029236 ATTAGGGTGTGGACATCTTTGGG - Intergenic
1007977731 6:46118793-46118815 ATTAGGATGTAGACATCTTTGGG - Intergenic
1007984673 6:46196306-46196328 ATTAGGATGTGGATATCTTTTGG - Intergenic
1008828667 6:55731047-55731069 ATTAGGACTTGGACGTCTTTTGG - Intergenic
1008873493 6:56301110-56301132 ATTAGGATGTGGACATCTTTGGG - Intronic
1008918553 6:56817801-56817823 ATTAGGATGTGCACATCTTTGGG - Intronic
1008997471 6:57675469-57675491 ATTATAATGTGGACATTTTTAGG - Intergenic
1009185974 6:60574802-60574824 ATTATAATGTGGACATTTTTAGG - Intergenic
1009231102 6:61062046-61062068 ATTAGAATATGGAAATCTTTGGG - Intergenic
1009303268 6:62054437-62054459 ATTAGAACATGGACATCTTTAGG - Intronic
1009596064 6:65738626-65738648 ATTAAAATGTGGACGTCTTTGGG - Intergenic
1009685247 6:66948953-66948975 GTTAGACGGGGGAAATCTTTTGG + Intergenic
1009785524 6:68333372-68333394 GTTAGAAGGTAGACATCTATGGG + Intergenic
1009947317 6:70354782-70354804 ATTAGAGCGTGAAAATCTTTGGG - Intergenic
1010014698 6:71090845-71090867 ATTAGGACATGGATATCTTTGGG + Intergenic
1010106662 6:72177854-72177876 GTTTGAACATGGACATATTAAGG - Intronic
1010450550 6:75997423-75997445 GTTAGGAAGTGTACATTTTTGGG + Intronic
1010536299 6:77036063-77036085 ATTAGGACATAGACATCTTTGGG - Intergenic
1010865063 6:80966222-80966244 TTTAGGACATGGACATCTTCAGG + Intergenic
1011834453 6:91413850-91413872 GTTAGGATGTGAATATCTTTGGG - Intergenic
1011997758 6:93614806-93614828 ATTAGCACATGGACATCTTTGGG - Intergenic
1012013605 6:93825924-93825946 ATTAGGACATGGAAATCTTTGGG - Intergenic
1012121143 6:95367955-95367977 ATAAGAACATGGATATCTTTGGG - Intergenic
1012466283 6:99520093-99520115 TGTAGAACATGAACATCTTTGGG - Intronic
1012946596 6:105472961-105472983 ATTGGGACATGGACATCTTTGGG - Intergenic
1012972933 6:105750762-105750784 GTTAGGACTTACACATCTTTGGG + Intergenic
1013303531 6:108826705-108826727 ATTAGGACATGAACATCTTTAGG - Intergenic
1013749705 6:113390375-113390397 TTTAGAATTTGGACAGCTTTTGG + Intergenic
1014187868 6:118456457-118456479 ATTAGGATGTGAACATCTTTGGG - Intergenic
1014512545 6:122341975-122341997 GTTAGGACGTAGACATCTTTGGG - Intergenic
1014524354 6:122483602-122483624 GTTAGAACTTGGACTTATATAGG + Intronic
1014809443 6:125869464-125869486 AATAGGACATGGACATCTTTAGG - Intronic
1015107462 6:129553575-129553597 CTTAGGACTTGAACATCTTTTGG + Intergenic
1015353833 6:132253906-132253928 ATTAGGACATGGAAATCTTTGGG - Intergenic
1015673112 6:135713404-135713426 ATTAGGACATGGACATCCTTGGG - Intergenic
1016026527 6:139292953-139292975 AGTAGGACGTGGAGATCTTTTGG - Intergenic
1016363519 6:143292185-143292207 TTTAGGATGTGGATATCTTTGGG - Intronic
1016509937 6:144831170-144831192 ATTAGGATGTGGACATCTTTGGG - Intronic
1017035933 6:150267286-150267308 GTTAGAACTTTAACATCTTTTGG + Intergenic
1017468685 6:154718779-154718801 ATTAGGATGTGGACATCTTGTGG - Intergenic
1017519801 6:155191908-155191930 ATTCGAATGTGGACATGTTTGGG - Intronic
1017533531 6:155321970-155321992 ATTAGAATGTGAACATCTTTGGG - Intergenic
1017955439 6:159173877-159173899 ATTAGGACAAGGACATCTTTGGG + Intronic
1018772455 6:166983257-166983279 ATTAGGATGGGGACATCTTTGGG + Intergenic
1018785421 6:167104323-167104345 GTCAGGACCTTGACATCTTTTGG + Intergenic
1018823719 6:167393691-167393713 ATTAGGATGTGGACATCTCTGGG - Intergenic
1018854749 6:167667421-167667443 GTCAAACCATGGACATCTTTAGG + Intergenic
1018939202 6:168297213-168297235 ATTAGGACGCGGACATCTCTGGG - Intronic
1019739864 7:2667294-2667316 GTGAGGACATGGACAGCTTTGGG + Intergenic
1019836376 7:3389181-3389203 ATTAGAACCTGGACATCATTGGG - Intronic
1020218772 7:6217789-6217811 ATTAGGACCTGGATATCTTTGGG - Intronic
1020571451 7:9868466-9868488 ATTAGGATGTAGACATCTTTAGG + Intergenic
1020911516 7:14137727-14137749 ATTGGGATGTGGACATCTTTTGG + Intergenic
1020999510 7:15311087-15311109 ATTAAAACATGGACATATTTGGG + Intronic
1021131880 7:16921449-16921471 ATTAGGATGTGGACATCTTCGGG + Intergenic
1021160239 7:17263776-17263798 ATTAGGTCATGGACATCTTTGGG - Intergenic
1021288304 7:18810373-18810395 GTTAGTATGTGGGCACCTTTGGG + Intronic
1021763515 7:23924413-23924435 ATTAGAATGTGGATATCTTCTGG - Intergenic
1021897705 7:25252854-25252876 ATTAGGATGTGGACATTTTTGGG - Intergenic
1022256880 7:28667141-28667163 GTTTGAAGGTGTATATCTTTCGG - Intronic
1022514708 7:30968228-30968250 ATTAGGATGTGGACATCTTTGGG + Intronic
1022828187 7:34038074-34038096 ATTAGGACATGGACATCTTGGGG - Intronic
1022831579 7:34072711-34072733 ATTAGGAGGTGGACATGTTTGGG + Intronic
1022874182 7:34511793-34511815 ATTTAGACGTGGACATCTTTTGG - Intergenic
1022911121 7:34900333-34900355 ATTAGTGCGTGGACTTCTTTTGG - Intergenic
1023310488 7:38881476-38881498 ATTAGGATGTAGACATCTTTGGG + Intronic
1023391457 7:39715178-39715200 ATTAGGACATGGACATCTTTGGG - Intergenic
1023546690 7:41325142-41325164 ATTAGGGCCTGGACATCTTTGGG + Intergenic
1023617081 7:42030372-42030394 ATTAGGATGTGGACATCTTTGGG + Intronic
1023981279 7:45071935-45071957 ATTAGGATGTGGACGTCTTTGGG + Intronic
1024283553 7:47738358-47738380 GTTAGAAAGTCCACAACTTTAGG + Intronic
1024690825 7:51801165-51801187 TTTATAATGTGGACATTTTTAGG + Intergenic
1024866788 7:53912295-53912317 ATTAGGACATGGATATCTTTGGG + Intergenic
1026315141 7:69221299-69221321 CTGAGGAGGTGGACATCTTTGGG + Intergenic
1026539328 7:71266672-71266694 GTTAGAATGTGGATATCTATAGG + Intronic
1026607502 7:71828330-71828352 ATTAGGATGTGGATATCTTTGGG - Intronic
1026884953 7:73935320-73935342 ATTAGAGCATGGATATCTTTAGG - Intergenic
1027549990 7:79579098-79579120 ATTAGGATGTGGACATCTTCGGG - Intergenic
1027600026 7:80228441-80228463 ATTAGAACATGGACAACTTTTGG + Intergenic
1027724030 7:81780645-81780667 ATTAGGACATGGACATCTTTGGG - Intergenic
1027920007 7:84381032-84381054 ATTAGAACATGGACATCTCTGGG + Intronic
1027943605 7:84717448-84717470 ATTAGGATGTGGACATCTTTGGG - Intergenic
1028150594 7:87367064-87367086 ATTAGAAAGTAGACATCTATGGG - Intronic
1028291112 7:89065971-89065993 ATTAGAAAGTAGACATCTTGGGG + Intronic
1028460394 7:91085569-91085591 GTTAACAGGTGGACATCTTTGGG + Intronic
1028923187 7:96329065-96329087 ATTGGGACGTGGACATATTTGGG + Intergenic
1029190821 7:98770890-98770912 GTTAGAACCTCCACATCTTTTGG + Intergenic
1030168119 7:106574779-106574801 ATTGGGATGTGGACATCTTTGGG - Intergenic
1030251244 7:107447389-107447411 AATAGGACATGGACATCTTTAGG + Intronic
1030267231 7:107632826-107632848 ATTAGAATGTGAACATCCTTGGG + Intergenic
1030284522 7:107811960-107811982 ATTAGGATGTGGGCATCTTTGGG + Intergenic
1030300357 7:107968401-107968423 ATGAGGATGTGGACATCTTTGGG - Intronic
1030306027 7:108019502-108019524 ATTAGGATGTGGACGTCTTTTGG + Intergenic
1030360492 7:108590382-108590404 ATTAGGACATGGACATCTTTGGG - Intergenic
1030386418 7:108872676-108872698 ATTAGGATGTGGATATCTTTGGG + Intergenic
1030895292 7:115052391-115052413 ATTAGGACATGGATATCTTTGGG - Intergenic
1031132034 7:117843841-117843863 ATTAGGATGTGGACATCTTTGGG - Intronic
1031137514 7:117901059-117901081 ATTAGGACATGGACATCTTTGGG + Intergenic
1031161658 7:118176140-118176162 ATTAGGATGTGGACATCTTTGGG + Intergenic
1031534093 7:122912379-122912401 GTTAGCATGTAGACATCTTTAGG + Intergenic
1031680220 7:124664208-124664230 TTCAGGATGTGGACATCTTTGGG - Intergenic
1031822130 7:126515896-126515918 ATTAGAATGTTCACATCTTTGGG + Intronic
1032297207 7:130650303-130650325 ATTGGGACGTGGACATCTTTGGG + Intronic
1032510756 7:132470514-132470536 ATTAGGATGTGGACATCTTTGGG - Intronic
1032538296 7:132683021-132683043 ATTAGCACATGGACATCTCTCGG - Intronic
1032658809 7:133960958-133960980 ATTAGGACGTGGACATCGTTGGG - Intronic
1033126950 7:138714803-138714825 ATTAGGATGTAGACATCTTTGGG - Intronic
1033591930 7:142816164-142816186 ATTAGAATGTGGACATCCTTGGG - Intergenic
1033594643 7:142849544-142849566 ATTAGGATGTAGACATCTTTGGG - Intergenic
1033765306 7:144483118-144483140 ATTAGAAGGTAGACATCTTTGGG - Intronic
1033814757 7:145058083-145058105 ATAAGAATATGGACATCTTTGGG + Intergenic
1033856557 7:145568498-145568520 GTTAGGACGTGGGCATCTTTGGG + Intergenic
1034045032 7:147918854-147918876 ATTAGAATGTGAACATCTTGGGG - Intronic
1034341411 7:150358860-150358882 ATTAGGACCTGGATATCTTTGGG - Intergenic
1034501014 7:151451203-151451225 ATTAAGACGTGGACATCTTTGGG + Intergenic
1035139602 7:156745101-156745123 ATTAGGACTTGGACATCTTTAGG + Intronic
1035186446 7:157129769-157129791 ATTAGGACATGGACATATTTAGG - Intergenic
1035555829 8:566406-566428 CTTAGGACGGGGACATCTTTGGG - Intergenic
1036279542 8:7388519-7388541 ATTGGGACATGGACATCTTTGGG + Intergenic
1036282302 8:7410978-7411000 ATAAGGACATGGACATCTTTGGG + Intergenic
1036339166 8:7900592-7900614 ATAAGGACATGGACATCTTTGGG - Intergenic
1036341976 8:7923358-7923380 ATTGGGACATGGACATCTTTGGG - Intergenic
1036633083 8:10529125-10529147 ATTGGAACTTGGACCTCTTTGGG + Intronic
1037066906 8:14593092-14593114 ATTGGAATCTGGACATCTTTGGG - Intronic
1037420602 8:18697943-18697965 GTTAGGACATGGACATCTTTGGG - Intronic
1037574107 8:20184724-20184746 ATTAGGAGGTGGACATCTCTGGG + Intergenic
1038127060 8:24686115-24686137 ATTAGGACATGGACATCTTTAGG + Intergenic
1038410518 8:27355099-27355121 ATTAGGATGCGGACATCTTTGGG - Intronic
1038424402 8:27455085-27455107 CTTAGGATGTGGACATCTTTGGG - Intronic
1038724757 8:30070949-30070971 TTTATAAGGTGGACATTTTTGGG - Intronic
1038747306 8:30265850-30265872 GTTAAAAAGTGGACATTCTTGGG - Intergenic
1038813060 8:30871252-30871274 AGTAGGATGTGGACATCTTTGGG + Intronic
1039077407 8:33704238-33704260 ATTAGGATGTGGACATCTTTGGG - Intergenic
1039134592 8:34306498-34306520 ATTAGGATGTGAACATCTTTGGG + Intergenic
1039398684 8:37248866-37248888 ATTAGAACATGAACATCTTCAGG - Intergenic
1039741177 8:40384277-40384299 ATCAGGATGTGGACATCTTTGGG - Intergenic
1039997955 8:42550756-42550778 GTTAAGATGTGGACATCTTTGGG + Intronic
1040398007 8:47018140-47018162 GTAAGCATGTGGACCTCTTTGGG - Intergenic
1040715173 8:50242613-50242635 GTTGGAATGTGTACATATTTGGG - Intronic
1040849757 8:51887225-51887247 ATTAGAACATGGACCTCTTTGGG + Intronic
1040982913 8:53263928-53263950 GTTAGGACATGCACATATTTGGG - Intergenic
1041213902 8:55580675-55580697 ATTAGAACATGGACATCCTTGGG + Intergenic
1041799258 8:61781012-61781034 ATTTGAACTTGGACATCTTCAGG - Intergenic
1041807806 8:61872656-61872678 GTTAGGACATGAATATCTTTAGG - Intergenic
1041865395 8:62567409-62567431 ATTCGGACATGGACATCTTTGGG - Intronic
1041895083 8:62915186-62915208 ATGAGGACGTGGAAATCTTTAGG - Intronic
1042062847 8:64840099-64840121 ATTAGAGCGTGGACATCTTTGGG - Intergenic
1042227839 8:66528400-66528422 ATTAGGACATGGACATCTTTGGG + Intergenic
1042244293 8:66695168-66695190 ATGAGAACATGGACATCTTCAGG + Intronic
1042366474 8:67942884-67942906 GTTAGGACTTCAACATCTTTTGG - Intergenic
1042482454 8:69319467-69319489 ATTAGGATATGGACATCTTTGGG + Intergenic
1042767709 8:72344400-72344422 GTTAGGACTTCAACATCTTTTGG - Intergenic
1042781534 8:72496100-72496122 ATGAGGATGTGGACATCTTTGGG - Intergenic
1042817657 8:72895136-72895158 ATTAGGATATGGACATCTTTAGG - Intronic
1042875471 8:73437162-73437184 ATTAGGACATGGGCATCTTTGGG - Intronic
1043510716 8:80947626-80947648 ATTAGGATGTGGACATCTTTGGG + Intergenic
1043536806 8:81214094-81214116 GTTAGAACAAGGACATCTTTGGG - Intergenic
1043802288 8:84624688-84624710 ATTAGGACATGGACGTCTTTGGG + Intronic
1044355303 8:91215202-91215224 ATTAGGATGTGGACATCTTTGGG + Intronic
1044513533 8:93111935-93111957 ATTAGGATGTTGACATCTTTGGG - Intergenic
1044966112 8:97575525-97575547 ATTAGGACATGGACATCTTTGGG - Intergenic
1045078974 8:98603854-98603876 ATTAGAACGTAGACATCTTGCGG - Intronic
1045245152 8:100436136-100436158 ATTAGAATGTGAACATCTTTAGG + Intergenic
1045297983 8:100888945-100888967 GTTAGGACTTCAACATCTTTTGG + Intergenic
1045784881 8:105909218-105909240 GTTAGAACATGGAGATTTTGTGG - Intergenic
1046414798 8:113898736-113898758 ATTAGAAGGAGGACTTCTTTGGG + Intergenic
1046501556 8:115084583-115084605 ATTAGGTTGTGGACATCTTTGGG - Intergenic
1046610961 8:116425031-116425053 ATGAGGACATGGACATCTTTGGG + Intergenic
1046692211 8:117298657-117298679 TTTAGAACATGCACATCTTTTGG - Intergenic
1046704284 8:117433635-117433657 ATTAGGGCATGGACATCTTTGGG + Intergenic
1046711706 8:117518204-117518226 ATTAGGATGTGGACATCTTCGGG - Intergenic
1046796718 8:118381408-118381430 ATGAGAACATGGACATCTTTAGG - Intronic
1047201545 8:122771748-122771770 ACTAGGACGTGGACCTCTTTGGG + Intergenic
1047222116 8:122927031-122927053 GTTAGGACCTGGGTATCTTTTGG + Intronic
1047243421 8:123115932-123115954 ATTAGAGCATGGACATCTTTTGG + Intronic
1047319443 8:123765853-123765875 ATTAGGATGTGAACATCTTTGGG + Intergenic
1047407221 8:124595726-124595748 GTTAGAACGTGGACATCTTTGGG + Intronic
1047700892 8:127448387-127448409 GTTAAGATGTGGACATCTTTGGG - Intergenic
1047850440 8:128851604-128851626 GTTAGGACATGGACATCCTTGGG - Intergenic
1048230308 8:132633607-132633629 ATTAGAACATGGACATTCTTGGG - Intronic
1048445759 8:134491856-134491878 ATGAGGACGTGGACATCTCTGGG + Intronic
1048455561 8:134575172-134575194 ATTAGAACCTGGATATCTTTGGG - Intronic
1048495509 8:134932440-134932462 ATTAGGACCTGCACATCTTTGGG - Intergenic
1048518976 8:135136601-135136623 GTTTAGATGTGGACATCTTTGGG - Intergenic
1048555842 8:135475206-135475228 GTTAGTATGTGGATGTCTTTAGG + Intronic
1048903957 8:139068958-139068980 ATTATGACTTGGACATCTTTGGG + Intergenic
1049042697 8:140124543-140124565 ATCGGGACGTGGACATCTTTGGG + Intronic
1049117572 8:140702824-140702846 ATTAGAACATGGGTATCTTTGGG - Intronic
1049416050 8:142495835-142495857 GTTAGGACTTGGACATATATTGG + Intronic
1049647872 8:143744291-143744313 GGCAGGAGGTGGACATCTTTGGG + Intergenic
1050071869 9:1823513-1823535 ATTAGGATGAGGACATCTTTTGG + Intergenic
1050344180 9:4669842-4669864 ATTAGGATGTGGATATCTTTGGG + Intergenic
1050429837 9:5551160-5551182 ATTAGAATATGGACATCTTTGGG + Intronic
1050457539 9:5848107-5848129 ATTAGGATGTGGACATCTTGAGG - Intergenic
1051687172 9:19669887-19669909 ATGAGGATGTGGACATCTTTCGG + Intronic
1051723039 9:20059071-20059093 ATTAGGAAGTGGACATCTTTAGG - Intergenic
1051724160 9:20071537-20071559 ATTAGAACATGGACACATTTTGG - Intergenic
1051741625 9:20258113-20258135 GTTAGGACTTGGACATCTTTGGG - Intergenic
1051873730 9:21768715-21768737 TTTAGAATTTGGACATCTTTTGG - Intergenic
1051954681 9:22677397-22677419 ATTAGAAAATGGACATATTTGGG + Intergenic
1051972736 9:22910707-22910729 ACTAGGACATGGACATCTTTGGG - Intergenic
1052293239 9:26868159-26868181 ATTAGAATGTGGGCATATTTGGG - Intronic
1052355983 9:27505134-27505156 ATGAGAATGTGGACATCTTTGGG + Intronic
1052509419 9:29396373-29396395 ATTAGAACATGGACATTTTTGGG + Intergenic
1052994349 9:34542515-34542537 ATTAGGATGTGGACATCTTGGGG + Intergenic
1053405355 9:37870469-37870491 TTAAGGATGTGGACATCTTTAGG + Intronic
1053476791 9:38387899-38387921 GTTAGGACATTGACGTCTTTAGG + Intergenic
1054165687 9:61725416-61725438 ATGAGTATGTGGACATCTTTGGG - Intergenic
1054734506 9:68736873-68736895 ATTAGGATGTGGACATCTTTGGG + Intronic
1054735839 9:68749096-68749118 ATTAGGATGTGGATATCTTTGGG - Intronic
1054736856 9:68761887-68761909 GTAAGGATGTGGACATCTTTTGG + Intronic
1054744502 9:68840872-68840894 GTTAGGATGTGGACATCTTTGGG + Intronic
1054919239 9:70525291-70525313 ATTAGGACATGGACATCTTTGGG + Intergenic
1055058995 9:72049452-72049474 ATTAGATTGTGGACATCTTTGGG + Intergenic
1055086332 9:72317860-72317882 ATTAGAAGGTGGACATCTTCAGG - Intergenic
1055086945 9:72324042-72324064 GTTAGGATGTAGACATGTTTGGG + Intergenic
1055254771 9:74356053-74356075 GTCAGAAAGTGGACTTCTGTGGG - Intergenic
1055330796 9:75181436-75181458 ATTAGAGTGTGGACATATTTTGG - Intergenic
1055432724 9:76260275-76260297 ATTTGAGCATGGACATCTTTTGG - Intronic
1055722100 9:79186480-79186502 GTTAGGATGTGGACAGCTTTAGG + Intergenic
1055740210 9:79380088-79380110 ATTAGAATGTGGACATATTTGGG + Intergenic
1055980984 9:82000302-82000324 ATTGGGACATGGACATCTTTAGG - Intergenic
1056198317 9:84250104-84250126 ACTAGGACGTGGACATGTTTGGG - Intergenic
1056284185 9:85071247-85071269 GTTAGAGCCTGGATATTTTTGGG - Intergenic
1056821732 9:89847045-89847067 ATTAGAATGTGGACATCTTTGGG - Intergenic
1056896252 9:90553380-90553402 ATTAGGACCTGGGCATCTTTAGG + Intergenic
1056899972 9:90589053-90589075 ATTAGGATGTGGACATCTTTGGG + Intergenic
1056983826 9:91342427-91342449 ATTAGGACGTGGACAACTTTGGG + Intronic
1057158965 9:92871758-92871780 ATTAGGATGTGAACATCTTTGGG - Intronic
1057492466 9:95532048-95532070 GTGAGGATGTGGACGTCTTTGGG - Intergenic
1057540531 9:95964399-95964421 ATTACAATGTGAACATCTTTGGG - Intronic
1057858803 9:98623862-98623884 ATGAGAACATGGACATCTCTGGG + Intronic
1057954281 9:99395552-99395574 ATTAGAATGTGGACATTTTAGGG - Intergenic
1058324409 9:103677747-103677769 ATTAGGACTTGGACAGCTTTAGG + Intergenic
1058380804 9:104375162-104375184 GTTAGGACCTGGATATGTTTGGG + Intergenic
1059087119 9:111316184-111316206 ATTAAGACATGGACATCTTTAGG - Intergenic
1059485533 9:114623844-114623866 ATTAGGGTGTGGACATCTTTGGG + Intronic
1059573005 9:115460453-115460475 ATTAGAATGTGGACATCTTTGGG - Intergenic
1059765048 9:117376130-117376152 ATTAGGATATGGACATCTTTGGG + Intronic
1060051438 9:120381275-120381297 ATTAGAGTATGGACATCTTTAGG + Intergenic
1060315785 9:122509205-122509227 ATTAGGATGTGGACATCTTTGGG + Intergenic
1061035742 9:128113547-128113569 ATTAGGACATGGACATCTTGTGG - Intergenic
1061229591 9:129307160-129307182 ATCAGAACGTGGACGTCTTTGGG - Intergenic
1061819764 9:133220611-133220633 ATGAGGATGTGGACATCTTTAGG - Intergenic
1061819780 9:133220676-133220698 ATGAGGATGTGGACATCTTTAGG - Intergenic
1062240877 9:135537271-135537293 ATGAGGATGTGGACATCTTTAGG + Intergenic
1185453689 X:296794-296816 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453700 X:296843-296865 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453710 X:296892-296914 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453719 X:296941-296963 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453727 X:296990-297012 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453736 X:297039-297061 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453746 X:297088-297110 ATCAGGACGTGGACATCTTTGGG + Intronic
1185453754 X:297137-297159 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453763 X:297186-297208 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453771 X:297235-297257 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453779 X:297284-297306 ATCAGGACGTGGACATCTTTGGG + Intronic
1185453788 X:297333-297355 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453799 X:297382-297404 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453810 X:297431-297453 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453820 X:297480-297502 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453830 X:297529-297551 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453838 X:297578-297600 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453848 X:297627-297649 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453856 X:297676-297698 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453866 X:297725-297747 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453874 X:297774-297796 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453883 X:297823-297845 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453891 X:297872-297894 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453899 X:297921-297943 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453907 X:297970-297992 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453917 X:298019-298041 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453925 X:298068-298090 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453933 X:298117-298139 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453941 X:298166-298188 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453951 X:298215-298237 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453959 X:298264-298286 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453969 X:298313-298335 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453978 X:298362-298384 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453986 X:298411-298433 ATTAGGACGTGGACATCTTTGGG + Intronic
1185453994 X:298460-298482 ATTAGGACGTGGACATCTTTGGG + Intronic
1185454004 X:298509-298531 ATTAGGACGTGGACATCTTTGGG + Intronic
1185454012 X:298558-298580 ATTAGGACGTGGACATCTTTGGG + Intronic
1185454020 X:298607-298629 ATTACGACGTGGACATCTTTGGG + Intronic
1185454030 X:298656-298678 ATTAGGACGTGGACATCTTTGGG + Intronic
1185454038 X:298705-298727 ATCAGGACGTGGACATCTTTGGG + Intronic
1185454048 X:298754-298776 ATTAGGACGTGGACATCTTTGGG + Intronic
1185454056 X:298803-298825 ATTAGGACGTGGACATCTTTGGG + Intronic
1185454065 X:298852-298874 ATTAGGATGTGGACATCTTTGGG + Intronic
1185454071 X:298900-298922 GTTACGACGTGAGCATCTTTGGG + Intronic
1185540217 X:897372-897394 ATTAGGACATGGACGTCTTTGGG + Intergenic
1185540225 X:897421-897443 ATTAGGACATGGGCATCTTTGGG + Intergenic
1185540262 X:897711-897733 ATTAGAATGTGGACATCTTTAGG + Intergenic
1185540271 X:897760-897782 ATTAGGATGTGGACATCTTTAGG + Intergenic
1185540289 X:897861-897883 ATTAGGATGTGGACATCTCTGGG + Intergenic
1185540308 X:897962-897984 ATTAGGACATGGATATCTTTGGG + Intergenic
1185572581 X:1146125-1146147 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572589 X:1146174-1146196 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572599 X:1146223-1146245 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572607 X:1146272-1146294 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572615 X:1146321-1146343 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572625 X:1146370-1146392 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572633 X:1146419-1146441 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572642 X:1146468-1146490 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572650 X:1146517-1146539 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572657 X:1146566-1146588 ATTACGACGTGGACATCTTTGGG + Intergenic
1185572664 X:1146615-1146637 ATTACGACGTGGACATCTTTGGG + Intergenic
1185572672 X:1146664-1146686 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572679 X:1146713-1146735 ATTACGACGTGGACATCTTTGGG + Intergenic
1185572689 X:1146762-1146784 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572698 X:1146811-1146833 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572707 X:1146860-1146882 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572715 X:1146909-1146931 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572723 X:1146958-1146980 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572734 X:1147007-1147029 ATTAGGACATGGACATCTTGGGG + Intergenic
1185572741 X:1147055-1147077 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572752 X:1147104-1147126 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572760 X:1147153-1147175 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572768 X:1147202-1147224 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572779 X:1147251-1147273 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572788 X:1147300-1147322 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185572799 X:1147349-1147371 ATCAGGACGTGGACATCTTTGGG + Intergenic
1185572808 X:1147398-1147420 ATCAGGACGTGGACATCTTTGGG + Intergenic
1185596846 X:1312418-1312440 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185596854 X:1312466-1312488 ATTAGGACGTGGACATATTTGGG + Intergenic
1185596861 X:1312514-1312536 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185650972 X:1647912-1647934 ATTAGGATGTGGACATCTTTGGG + Intergenic
1185650992 X:1648009-1648031 ATTAGGATGTGGACATCTTTGGG + Intergenic
1185708976 X:2287295-2287317 ATTAGGATGTGGACATCTTTGGG - Intronic
1185708985 X:2287344-2287366 ATTAGGATGTGGACATTTTTGGG - Intronic
1185708991 X:2287392-2287414 ATTGGGATGTGGACATCTTTGGG - Intronic
1185709000 X:2287441-2287463 ATTAGGATGTGGACATCTTCAGG - Intronic
1185709009 X:2287490-2287512 ATTGGGATGTGGACATCTTTGGG - Intronic
1185709041 X:2287637-2287659 ATTAGGATGTGGACATCTTTGGG - Intronic
1185709059 X:2287734-2287756 ATTAGAATGTGAACATCTTTGGG - Intronic
1185709066 X:2287783-2287805 ATTAGGATGTGGACATCTTTGGG - Intronic
1185743827 X:2555550-2555572 ATTAGGATGTGGACATCTTTGGG + Intergenic
1185743838 X:2555599-2555621 ATTAGGACATGGACATCTTTGGG + Intergenic
1185743849 X:2555649-2555671 ATTAGGACATGGACCTCTTTGGG + Intergenic
1185743857 X:2555699-2555721 ATTAGAATGTGGACCTCTTTGGG + Intergenic
1185743867 X:2555749-2555771 ATTAGAATGTGGACATCTTTGGG + Intergenic
1185743877 X:2555799-2555821 ATTAGGACGTGGACATCTTTGGG + Intergenic
1185752823 X:2627702-2627724 GTTAGGATGTGGGCATCTCTGGG - Intergenic
1185793504 X:2945452-2945474 AATAGGACGTAGACATCTTTGGG + Intronic
1185793523 X:2945599-2945621 ATTAGGATGTGGACATCTTTGGG + Intronic
1185793533 X:2945648-2945670 ATTAGAAAGTGGCTATCTTTGGG + Intronic
1185825119 X:3242408-3242430 ATTAGAATGTGGGCATCTTTGGG - Intergenic
1185825137 X:3242502-3242524 ATTAGGATGTGGACATCTCTGGG - Intergenic
1185837669 X:3360460-3360482 ATTAGGATGTGGACATCTCTGGG + Intergenic
1185922335 X:4107648-4107670 ATTAGGACGTGGGCATCTCTGGG - Intergenic
1185922346 X:4107697-4107719 ATTAGGATGTGGACATCTTTGGG - Intergenic
1185922385 X:4107939-4107961 ATTAAGATGTGGACATCTTTGGG - Intergenic
1186024213 X:5291089-5291111 TTTAGGACGTAGACATCTTTAGG + Intergenic
1186024226 X:5291177-5291199 ATTAGGATGTGGACATCTTTGGG + Intergenic
1186024252 X:5291328-5291350 GTTAGGATGTAAACATCTTTGGG + Intergenic
1186131395 X:6469760-6469782 TTAGGACCGTGGACATCTTTGGG - Intergenic
1186197064 X:7120166-7120188 ATTAGGACTTGGACATCTTTGGG - Intronic
1186203467 X:7177175-7177197 ACTAGAATGTGGACACCTTTGGG + Intergenic
1186216419 X:7305936-7305958 ATTAGGACGAGGGCATCTTTGGG + Intronic
1186225263 X:7392276-7392298 ATTAAAACATGGACATCTTCAGG - Intergenic
1186289007 X:8076458-8076480 ATTAGCAGGTGGACATCTCTGGG - Intergenic
1186461555 X:9752425-9752447 ATTAGGACAGGGACATCTTTAGG - Intronic
1186582975 X:10840740-10840762 ATTAGAATATGGACAACTTTGGG - Intergenic
1186659664 X:11656832-11656854 ATTAGGACATGAACATCTTTGGG + Intronic
1186730799 X:12407230-12407252 GTTAAAATGCAGACATCTTTGGG + Intronic
1186768589 X:12795287-12795309 ATTAGGATGTAGACATCTTTAGG + Intronic
1186882303 X:13878638-13878660 ATTAGGATGTGGACATCTTGGGG - Intronic
1186916929 X:14233068-14233090 ATTAGGATGTTGACATCTTTGGG - Intergenic
1187024312 X:15417979-15418001 ACTGGGACGTGGACATCTTTGGG + Intronic
1187333972 X:18365685-18365707 ATTAGGATGTGGACATCTTCGGG + Intergenic
1187410194 X:19044495-19044517 TTTAGGATGTGGACATTTTTGGG + Intronic
1187800704 X:23059613-23059635 AGTAGAACATGGGCATCTTTTGG + Intergenic
1187971037 X:24658798-24658820 ATTACAATGTAGACATCTTTGGG + Intronic
1188152468 X:26695058-26695080 ATTAGGACATGAACATCTTTTGG - Intergenic
1188369012 X:29346288-29346310 TTTAGCATGTGGACATCTTTGGG + Intronic
1188408649 X:29844001-29844023 ATTAGGACGTGGACATGTTTTGG + Intronic
1188828463 X:34866176-34866198 ATTAGGACGTGGACATCTTTAGG + Intergenic
1189120934 X:38394115-38394137 GTTAGGACATGGACATCTTTGGG + Intronic
1189660523 X:43292084-43292106 ATTAGAACATGAACATCTTTGGG - Intergenic
1189900509 X:45701486-45701508 ATTTGGACATGGACATCTTTGGG - Intergenic
1190040089 X:47064326-47064348 ATTAGGACATGGACATCTTTGGG - Intergenic
1190250318 X:48718506-48718528 ATTAGGAAGTGCACATCTTTGGG + Intergenic
1190315988 X:49151379-49151401 ATTAGGAGGTGAACATCTTTGGG + Intergenic
1190391335 X:49934812-49934834 GTTACATCGTTGACATCTTCTGG + Intronic
1190576446 X:51844208-51844230 ATTAGAATGTGAACATCTTTAGG - Intronic
1190858872 X:54324334-54324356 ATTAGGACATGGACATCTTTGGG + Intronic
1191029498 X:55952701-55952723 ATTAGAATGTGGGCTTCTTTGGG + Intergenic
1191838408 X:65490095-65490117 ATTAAAATGTGGACATCTCTAGG - Intronic
1192093663 X:68187200-68187222 ATTAGTATGTGGACACCTTTGGG - Intronic
1193080020 X:77397632-77397654 ATTAGGATGTGGACATCTATGGG + Intergenic
1193090900 X:77493053-77493075 ATTAGGACTTAGACATCTTTGGG + Intergenic
1193142485 X:78042476-78042498 TTTAAAATGTGGACATCTTGTGG + Intronic
1193777830 X:85665355-85665377 ATTAGAACATGGACACTTTTGGG + Intergenic
1194532272 X:95065582-95065604 TTTAGAATATGTACATCTTTGGG - Intergenic
1194763179 X:97818090-97818112 ATTAGGACATGGACATCTTTGGG - Intergenic
1194775399 X:97956813-97956835 GTTAGAGCATAGACATCTTTGGG + Intergenic
1195026484 X:100882777-100882799 CTTAGGATGTGGACATCTTTAGG - Intergenic
1195246637 X:103001279-103001301 ATTAGTATGTGAACATCTTTGGG + Intergenic
1195272484 X:103245541-103245563 ATTAGGACATGGATATCTTTGGG + Intergenic
1195393098 X:104383668-104383690 ATTAGGACCTGGATATCTTTGGG + Intergenic
1195491361 X:105473977-105473999 ATTAGATTATGGACATCTTTGGG - Intronic
1195634164 X:107094565-107094587 ATTAGGATGTGGACATCTTTGGG - Intronic
1195662943 X:107399166-107399188 ATTAGAACATGAACATCTTTGGG - Intergenic
1196595474 X:117540925-117540947 ATTAGGATGTGGACATGTTTGGG + Intergenic
1196632647 X:117961457-117961479 GTTAAGATGTGGACATCTTTAGG - Intronic
1196636170 X:118005431-118005453 ATTAAGATGTGGACATCTTTGGG - Intronic
1196745655 X:119069826-119069848 ATTAGGACATGGGCATCTTTGGG + Intergenic
1197141073 X:123117824-123117846 GGCAGGATGTGGACATCTTTAGG + Intergenic
1197562128 X:128036547-128036569 GTTTGGATGTGGACATCCTTGGG + Intergenic
1197674658 X:129316180-129316202 ATTAGAACATGGACATATTTGGG + Intergenic
1198376172 X:136042104-136042126 GTTAGGACTTCAACATCTTTTGG + Intronic
1198848189 X:140936348-140936370 ATTAGGACGTGAACATCTTTGGG + Intergenic
1199228958 X:145412374-145412396 ATTAGGACATGGACATCTTTGGG + Intergenic
1199362026 X:146931950-146931972 ATCAGAACATGGACATCTATTGG + Intergenic
1199666055 X:150097409-150097431 ATTAGGACGTGGACATCTTTGGG + Intergenic
1199722617 X:150552988-150553010 GTTAGGACTTCAACATCTTTTGG - Intergenic
1199730782 X:150630064-150630086 ATTAGGACATGGACATCTTTGGG + Intronic
1199763550 X:150924278-150924300 CTTAGGACATGGACATCTTTGGG + Intergenic
1199765428 X:150937798-150937820 ATTAGGACATGGACATCTTTGGG + Intergenic
1199814007 X:151381390-151381412 GTTAGGACCTGGATAACTTTGGG - Intergenic
1199876931 X:151939985-151940007 ATTAGGAGGTGGATATCTTTTGG - Intergenic
1199903738 X:152203919-152203941 AATAGAATGTGGACATCTTTGGG + Intronic
1200041886 X:153376544-153376566 ATGAGGACGTGGACATCTTTTGG - Intergenic
1200787389 Y:7272845-7272867 GTTAGAACGGACACATTTTTAGG - Intergenic
1201254045 Y:12089554-12089576 ATTAGAATGTGGACATCTTTGGG + Intergenic
1201254065 Y:12089698-12089720 ATTAGAATGTGGACATTTTGGGG + Intergenic
1201594799 Y:15656265-15656287 ATTAAAACATGGACATCTTTAGG - Intergenic
1201607537 Y:15803582-15803604 ATTAGAACATGGAGACCTTTGGG - Intergenic
1201613844 Y:15873661-15873683 ATTAGGACCTGGACATCTTTGGG - Intergenic
1202047751 Y:20751535-20751557 ATTAGGACAGGGACATCTTTAGG - Intergenic