ID: 1161762782

View in Genome Browser
Species Human (GRCh38)
Location 19:6186855-6186877
Sequence AAAAAAATAGCCGGGTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447292
Summary {0: 202, 1: 9062, 2: 60970, 3: 161144, 4: 215914}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161762782_1161762793 27 Left 1161762782 19:6186855-6186877 CCACCACACCCGGCTATTTTTTT 0: 202
1: 9062
2: 60970
3: 161144
4: 215914
Right 1161762793 19:6186905-6186927 CAGGTTGGTCTAGCACTTGTGGG 0: 1
1: 0
2: 8
3: 163
4: 2921
1161762782_1161762789 12 Left 1161762782 19:6186855-6186877 CCACCACACCCGGCTATTTTTTT 0: 202
1: 9062
2: 60970
3: 161144
4: 215914
Right 1161762789 19:6186890-6186912 TTTCACTGTGTTGCCCAGGTTGG 0: 42
1: 1391
2: 15342
3: 103991
4: 318577
1161762782_1161762792 26 Left 1161762782 19:6186855-6186877 CCACCACACCCGGCTATTTTTTT 0: 202
1: 9062
2: 60970
3: 161144
4: 215914
Right 1161762792 19:6186904-6186926 CCAGGTTGGTCTAGCACTTGTGG 0: 1
1: 0
2: 15
3: 340
4: 6105
1161762782_1161762788 8 Left 1161762782 19:6186855-6186877 CCACCACACCCGGCTATTTTTTT 0: 202
1: 9062
2: 60970
3: 161144
4: 215914
Right 1161762788 19:6186886-6186908 CCAATTTCACTGTGTTGCCCAGG 0: 1
1: 2
2: 43
3: 959
4: 10646

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161762782 Original CRISPR AAAAAAATAGCCGGGTGTGG TGG (reversed) Intronic
Too many off-targets to display for this crispr