ID: 1161762783

View in Genome Browser
Species Human (GRCh38)
Location 19:6186858-6186880
Sequence TGCAAAAAAATAGCCGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90554
Summary {0: 1, 1: 159, 2: 5602, 3: 32129, 4: 52663}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161762783_1161762789 9 Left 1161762783 19:6186858-6186880 CCACACCCGGCTATTTTTTTGCA 0: 1
1: 159
2: 5602
3: 32129
4: 52663
Right 1161762789 19:6186890-6186912 TTTCACTGTGTTGCCCAGGTTGG 0: 42
1: 1391
2: 15342
3: 103991
4: 318577
1161762783_1161762793 24 Left 1161762783 19:6186858-6186880 CCACACCCGGCTATTTTTTTGCA 0: 1
1: 159
2: 5602
3: 32129
4: 52663
Right 1161762793 19:6186905-6186927 CAGGTTGGTCTAGCACTTGTGGG 0: 1
1: 0
2: 8
3: 163
4: 2921
1161762783_1161762788 5 Left 1161762783 19:6186858-6186880 CCACACCCGGCTATTTTTTTGCA 0: 1
1: 159
2: 5602
3: 32129
4: 52663
Right 1161762788 19:6186886-6186908 CCAATTTCACTGTGTTGCCCAGG 0: 1
1: 2
2: 43
3: 959
4: 10646
1161762783_1161762792 23 Left 1161762783 19:6186858-6186880 CCACACCCGGCTATTTTTTTGCA 0: 1
1: 159
2: 5602
3: 32129
4: 52663
Right 1161762792 19:6186904-6186926 CCAGGTTGGTCTAGCACTTGTGG 0: 1
1: 0
2: 15
3: 340
4: 6105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161762783 Original CRISPR TGCAAAAAAATAGCCGGGTG TGG (reversed) Intronic
Too many off-targets to display for this crispr