ID: 1161762784

View in Genome Browser
Species Human (GRCh38)
Location 19:6186863-6186885
Sequence GTCTCTGCAAAAAAATAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2398
Summary {0: 1, 1: 11, 2: 229, 3: 736, 4: 1421}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161762784_1161762789 4 Left 1161762784 19:6186863-6186885 CCCGGCTATTTTTTTGCAGAGAC 0: 1
1: 11
2: 229
3: 736
4: 1421
Right 1161762789 19:6186890-6186912 TTTCACTGTGTTGCCCAGGTTGG 0: 42
1: 1391
2: 15342
3: 103991
4: 318577
1161762784_1161762792 18 Left 1161762784 19:6186863-6186885 CCCGGCTATTTTTTTGCAGAGAC 0: 1
1: 11
2: 229
3: 736
4: 1421
Right 1161762792 19:6186904-6186926 CCAGGTTGGTCTAGCACTTGTGG 0: 1
1: 0
2: 15
3: 340
4: 6105
1161762784_1161762793 19 Left 1161762784 19:6186863-6186885 CCCGGCTATTTTTTTGCAGAGAC 0: 1
1: 11
2: 229
3: 736
4: 1421
Right 1161762793 19:6186905-6186927 CAGGTTGGTCTAGCACTTGTGGG 0: 1
1: 0
2: 8
3: 163
4: 2921
1161762784_1161762788 0 Left 1161762784 19:6186863-6186885 CCCGGCTATTTTTTTGCAGAGAC 0: 1
1: 11
2: 229
3: 736
4: 1421
Right 1161762788 19:6186886-6186908 CCAATTTCACTGTGTTGCCCAGG 0: 1
1: 2
2: 43
3: 959
4: 10646

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161762784 Original CRISPR GTCTCTGCAAAAAAATAGCC GGG (reversed) Intronic
Too many off-targets to display for this crispr