ID: 1161762785

View in Genome Browser
Species Human (GRCh38)
Location 19:6186864-6186886
Sequence GGTCTCTGCAAAAAAATAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1038
Summary {0: 1, 1: 0, 2: 18, 3: 230, 4: 789}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161762785_1161762789 3 Left 1161762785 19:6186864-6186886 CCGGCTATTTTTTTGCAGAGACC 0: 1
1: 0
2: 18
3: 230
4: 789
Right 1161762789 19:6186890-6186912 TTTCACTGTGTTGCCCAGGTTGG 0: 42
1: 1391
2: 15342
3: 103991
4: 318577
1161762785_1161762788 -1 Left 1161762785 19:6186864-6186886 CCGGCTATTTTTTTGCAGAGACC 0: 1
1: 0
2: 18
3: 230
4: 789
Right 1161762788 19:6186886-6186908 CCAATTTCACTGTGTTGCCCAGG 0: 1
1: 2
2: 43
3: 959
4: 10646
1161762785_1161762792 17 Left 1161762785 19:6186864-6186886 CCGGCTATTTTTTTGCAGAGACC 0: 1
1: 0
2: 18
3: 230
4: 789
Right 1161762792 19:6186904-6186926 CCAGGTTGGTCTAGCACTTGTGG 0: 1
1: 0
2: 15
3: 340
4: 6105
1161762785_1161762793 18 Left 1161762785 19:6186864-6186886 CCGGCTATTTTTTTGCAGAGACC 0: 1
1: 0
2: 18
3: 230
4: 789
Right 1161762793 19:6186905-6186927 CAGGTTGGTCTAGCACTTGTGGG 0: 1
1: 0
2: 8
3: 163
4: 2921

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161762785 Original CRISPR GGTCTCTGCAAAAAAATAGC CGG (reversed) Intronic
900283397 1:1886865-1886887 CTTCTCTACAAAAAATTAGCTGG - Intronic
900696250 1:4012387-4012409 TATCTCTACAAAAAACTAGCAGG + Intergenic
900860034 1:5222462-5222484 CATCTCTACAAAAAATTAGCTGG - Intergenic
900916108 1:5639777-5639799 CGTCTCTACTAAAAATTAGCCGG + Intergenic
901297036 1:8168741-8168763 CGTCTCTACTAAAAATTAGCTGG + Intergenic
901553463 1:10013510-10013532 TGTCTCTACAAAAAATTGGCTGG + Intronic
901561570 1:10075880-10075902 CGTCTCTACAAAAAATTAGCGGG + Intronic
901866216 1:12108649-12108671 TGTCTCTACTAAAAATTAGCCGG + Intronic
901883251 1:12206216-12206238 TGTCTCTACAAAAAATTAGCAGG + Intronic
902339535 1:15773971-15773993 CGTGTCTACAAAAAATTAGCCGG + Intronic
902349059 1:15839960-15839982 GGTCTCAAAAAAAAAAAAGCCGG + Intergenic
902447281 1:16475489-16475511 TATCTCTACAAAAAATTAGCTGG - Intergenic
902467137 1:16625440-16625462 TATCTCTACAAAAAATTAGCTGG - Intergenic
902507451 1:16947305-16947327 TATCTCTACAAAAAATTAGCTGG + Intronic
902586889 1:17445008-17445030 CGTCTCTACTAAAAATTAGCCGG + Intergenic
902674388 1:17998561-17998583 CGTCTCTACAGAAAATTAGCTGG - Intergenic
903117378 1:21189313-21189335 TGTCTCAGCACAAAAGTAGCAGG - Intergenic
903144032 1:21358437-21358459 TGTCTCTATAAAAAATTAGCCGG + Intergenic
903197848 1:21706304-21706326 GTCCTCTACCAAAAAATAGCAGG + Intronic
903436065 1:23350140-23350162 TGTCTCTACAAAAAATTAGCTGG + Intergenic
903597289 1:24504335-24504357 AATCTCTACAAAAAATTAGCCGG - Intronic
903854647 1:26329639-26329661 TGTCTCTACAAAAAATTAGCTGG - Intronic
904159553 1:28512954-28512976 CATCTCTACAAAAAATTAGCAGG - Intronic
904573396 1:31484832-31484854 CGTCTCTACTAAAAATTAGCCGG + Intergenic
904656059 1:32048335-32048357 TGTCTCTACAAAAAGTTAGCTGG + Intronic
904746612 1:32715438-32715460 CGTCTCTACTAAAAATTAGCCGG - Intergenic
905090651 1:35428959-35428981 GGCCTCTGCCAAAACAAAGCAGG - Intergenic
905131853 1:35766914-35766936 CGTTTCTACAAAAAATTAGCCGG - Intronic
905246658 1:36619624-36619646 TGTCTCTACAAAAAATTAGCTGG + Intergenic
905435600 1:37953194-37953216 CTTCTCTACAAAAAATTAGCTGG + Intergenic
905481141 1:38262857-38262879 TGTCTCTACAAAAAATTAGCTGG - Intergenic
905728751 1:40278977-40278999 TGTCTCTACAAAAAATTAGCCGG + Intronic
906423697 1:45691379-45691401 CATCTCTACAAAAAATTAGCTGG + Intronic
906570239 1:46831657-46831679 GGTCTCTACAAAAAATTAGCTGG - Intergenic
906628333 1:47343904-47343926 CATCTCTACAAAAAATTAGCTGG + Intronic
906785672 1:48613647-48613669 GTTCTCTGCCATAAAACAGCAGG + Intronic
907161411 1:52372968-52372990 TGTCTCTACAAAAAATCAGCTGG + Exonic
907227349 1:52960338-52960360 CGTCTCTGCAAAAAATTAGCTGG - Intronic
907343301 1:53752816-53752838 CATCTCTACAAAAAATTAGCTGG + Intergenic
907349844 1:53819660-53819682 GCTCTTTGCAAAAAAATGGGAGG + Intronic
907477850 1:54718209-54718231 TGTCTCTCCAAAAATTTAGCTGG + Intronic
907688687 1:56640370-56640392 TGTCTGTACAAAAAAATAACTGG - Intronic
907886430 1:58596440-58596462 CGTCTCTACTAAAAATTAGCGGG - Intergenic
908565954 1:65356400-65356422 TGTCTCTACAAAAAATTAACTGG + Intronic
908760258 1:67505268-67505290 TATCTCTACAAAAAATTAGCTGG + Intergenic
908999131 1:70197446-70197468 TGTCTCTACAAAAAATAAGCTGG - Intronic
909609342 1:77536290-77536312 TGCCTCTGCAAAAAATTAGCTGG + Intronic
909638047 1:77839900-77839922 TGTCTTTACAAAAAATTAGCTGG - Intronic
910196617 1:84647874-84647896 TGTCTCTACAAAAAATTAGCTGG + Intronic
911157518 1:94651881-94651903 GGGCTCTGGAAAGCAATAGCAGG + Intergenic
911207309 1:95104856-95104878 CATCTCTACAAAAAATTAGCTGG + Intergenic
911637700 1:100253670-100253692 CATCTCTACAAAAAATTAGCTGG + Intergenic
911940507 1:104041400-104041422 CGTCTCTACTAAAAAAAAGCTGG - Intergenic
912367215 1:109144219-109144241 CGTCTCTACAAAAAATTAGCCGG - Intronic
912756252 1:112326854-112326876 CATCTCTACAAAAAATTAGCTGG - Intergenic
912917637 1:113832347-113832369 TGTCTCTACTAAAAATTAGCTGG - Intronic
914338360 1:146737594-146737616 CGTCTCTACAAAAAATTAGCTGG - Intergenic
914792343 1:150889236-150889258 CGTCTCTACAAAAACTTAGCCGG + Intergenic
915097851 1:153476365-153476387 AGTCTCTACAAAAAATTAGCCGG + Intergenic
915144680 1:153789481-153789503 CATCTCTACAAAAAATTAGCCGG - Intergenic
916050590 1:161033850-161033872 CATCTCTGCAAAAAATTAGCTGG - Intronic
916225030 1:162481131-162481153 TGTCTCTACTAAAAATTAGCCGG + Intergenic
916935794 1:169626854-169626876 TATCTCTACAAAAAATTAGCCGG - Intronic
917347522 1:174043644-174043666 GGTCTCTGAAAAAAAAAAAAAGG - Intergenic
917943711 1:179948245-179948267 TGTCTCTACAAAAAATTAGCTGG - Intergenic
918082156 1:181215989-181216011 TGTCTCTACAAAAAATTTGCTGG - Intergenic
918149650 1:181787279-181787301 CGTCTCTACTAAAAATTAGCTGG - Intronic
918345680 1:183605190-183605212 GGCCTCTGCCAAAAATGAGCAGG + Intergenic
919733254 1:200928118-200928140 GGGCTATACAAAAAATTAGCTGG - Intergenic
919904165 1:202066466-202066488 CATCTCTACAAAAAATTAGCTGG - Intergenic
920148366 1:203882743-203882765 CGTCTCTACTAAAAATTAGCTGG + Intergenic
920187297 1:204167963-204167985 CATCTCTGAAAAAAATTAGCTGG + Intergenic
921294868 1:213692231-213692253 TGTCTCTACTAAAAATTAGCTGG + Intergenic
921310121 1:213834192-213834214 CATCTCTACAAAAAATTAGCTGG - Intergenic
921802021 1:219412195-219412217 AGTCTCTACAAAAAATTAGCTGG - Intergenic
922031452 1:221803856-221803878 AGTGTCTACAAAAAATTAGCTGG - Intergenic
922280606 1:224119905-224119927 GGTCTGTGAAATAAAAAAGCTGG - Intronic
922309843 1:224378212-224378234 TGTCTCTACAAAAAATTCGCTGG - Exonic
922663853 1:227452569-227452591 CATCTCTACAAAAAATTAGCGGG - Intergenic
922688515 1:227667203-227667225 TGTCTCTACAAAAAATTAGCTGG - Intronic
923121505 1:230996604-230996626 TGTCTCTACAAAAATTTAGCAGG - Intronic
923574537 1:235146121-235146143 CATCTCTACAAAAAATTAGCTGG - Intronic
923677725 1:236094783-236094805 CGTCTCTGCCAAAAATTAGCTGG - Intergenic
923708335 1:236363992-236364014 TGTCTCTACAAAAAATTAGCTGG + Intronic
923730607 1:236546179-236546201 TGTCTCTGCAAAAAAATGCCTGG - Intronic
923740273 1:236648226-236648248 CGTTTCTGCAAAAAATTAGCTGG + Intergenic
923856850 1:237854455-237854477 CGTCTCTACTAAAAATTAGCTGG - Intergenic
923864948 1:237929797-237929819 CATCTCTACAAAAAATTAGCCGG - Intergenic
924361807 1:243249254-243249276 CATCTCTACAAAAAATTAGCTGG + Intronic
1063206107 10:3832436-3832458 TGTCTCTACAAAAAATTAGCTGG + Intergenic
1063514847 10:6685691-6685713 AGGCTTTGCAAAAAAATAGAAGG - Intergenic
1063629059 10:7717364-7717386 GTTGTCTGCAAAAAACTACCAGG - Intronic
1063923137 10:10951303-10951325 TGTCTCTACAAAAATATAGCTGG - Intergenic
1064026246 10:11851052-11851074 TGTCTCTACAAAAAATAAGCTGG + Intronic
1064139526 10:12778706-12778728 TGTCTCTCTAAAAAAATAGTAGG + Intronic
1064189771 10:13195770-13195792 TGTCTCTACTAAAAATTAGCCGG - Intronic
1064257752 10:13758673-13758695 GCTCTCAGCAAAAAAAGAGAGGG - Intronic
1064453556 10:15465754-15465776 CATCTCTACAAAAAATTAGCTGG + Intergenic
1064650489 10:17504370-17504392 CATCTCTGCAAAAAATTAGCTGG + Intergenic
1064759354 10:18602403-18602425 CATCTCTACAAAAAATTAGCCGG - Intronic
1065114292 10:22469449-22469471 TGTCTGTACAAAAAATTAGCTGG + Intergenic
1065185826 10:23170581-23170603 TGTCTCTACCAAAAATTAGCTGG + Intergenic
1065333693 10:24631888-24631910 TGTCTCTACAAAAAATTAGCTGG - Intronic
1066076030 10:31877920-31877942 TGTCTCTACAAAAAATTAACTGG + Intronic
1066100945 10:32117967-32117989 TGTCTCTACAAAAAATTAGCTGG - Intergenic
1066530263 10:36330084-36330106 GGAATGTACAAAAAAATAGCTGG - Intergenic
1067072311 10:43142371-43142393 CGTCTCTACTAAAAATTAGCCGG - Intronic
1067379339 10:45758767-45758789 CGTCTCCACAAAAAATTAGCCGG - Intronic
1067403205 10:45996801-45996823 TGTCTATACAAAAAATTAGCCGG + Intronic
1067887039 10:50099429-50099451 CGTCTCCACAAAAAATTAGCCGG - Intronic
1067975712 10:51022833-51022855 GCTCTGTACAAAAAATTAGCTGG + Intronic
1069494300 10:68889140-68889162 CATCTCTACAAAAAATTAGCTGG - Intronic
1069905332 10:71728863-71728885 TGTCTCTAAAAAAAATTAGCCGG - Intronic
1069923981 10:71835408-71835430 CATCTCTACAAAAAATTAGCCGG + Intronic
1070062593 10:72999031-72999053 CATCTCTACAAAAAACTAGCTGG - Intergenic
1070208386 10:74287818-74287840 CATCTCTACAAAAAATTAGCTGG + Intronic
1070624297 10:78038799-78038821 TGTCTCTACAAAAAATTGGCAGG - Intronic
1071697444 10:87891642-87891664 TGTCTTTACAAAAAATTAGCTGG + Intronic
1071887910 10:89970762-89970784 TGTCTCTTCAAAAAATCAGCTGG - Intergenic
1072147393 10:92654012-92654034 CGTCTCTGTTAAAAATTAGCCGG + Exonic
1072301239 10:94064379-94064401 TGTCTCTACAAAAAATTAGCTGG + Intronic
1072346193 10:94509264-94509286 TGTCTCTACTAAAAATTAGCCGG - Intronic
1072515951 10:96183249-96183271 GATCTTTTCAAAAAAACAGCTGG + Intronic
1072639697 10:97202532-97202554 CATCTCTACAAAAAATTAGCTGG - Intronic
1072900210 10:99400474-99400496 CGTTTCTACAAAAAATTAGCCGG + Intronic
1072918991 10:99559651-99559673 CATCTCTACAAAAAATTAGCTGG - Intergenic
1073114003 10:101080765-101080787 CATCTCTACAAAAAATTAGCTGG - Intergenic
1073164765 10:101436473-101436495 TGTCTCTACAAAAAATTAGCTGG + Intronic
1073373315 10:103010397-103010419 CATCTCTACAAAAAATTAGCCGG - Intronic
1073399315 10:103243871-103243893 CATCTCTCCAGAAAAATAGCTGG + Intergenic
1073496869 10:103899523-103899545 CATCTCTACAAAAAATTAGCTGG + Intronic
1074173614 10:110972673-110972695 CGTCTCTACAAAAAATTAGCTGG + Intronic
1074456722 10:113602045-113602067 TGTCTCTACAAAAAATTAGCTGG - Intronic
1075316257 10:121455978-121456000 AATCTCTACAAAAAAATAGCCGG - Intergenic
1075368661 10:121916063-121916085 CGTCTCTACAAAAAATTAGCCGG + Intronic
1075883874 10:125879811-125879833 CGTCTCTACAAAGAAGTAGCCGG - Intronic
1076573496 10:131448691-131448713 TGTCTCTACCAAAAATTAGCTGG + Intergenic
1077448054 11:2611379-2611401 TGTCTCTACTAAAAATTAGCTGG - Intronic
1077582967 11:3428950-3428972 TGTCTCTACAATAAATTAGCTGG - Intergenic
1077617500 11:3688242-3688264 CGTCTCTACTAAAAATTAGCCGG + Intronic
1078129713 11:8603133-8603155 CGTCTTTGCTAAAAATTAGCTGG + Intergenic
1078375340 11:10788774-10788796 TGTCTCTACAAAAAATTAGCCGG + Intergenic
1078503415 11:11907924-11907946 CGTCTCTACTAAAAATTAGCTGG + Intronic
1079086322 11:17447759-17447781 TGTCTGTACAAAAAATTAGCTGG - Intronic
1079293532 11:19210654-19210676 CGTCTCTACTAAAAATTAGCCGG - Intergenic
1080506971 11:32924396-32924418 TGTCTCTACAAAAAGTTAGCTGG + Intronic
1080554234 11:33401721-33401743 CATCTCTACAAAAAATTAGCTGG - Intergenic
1080741662 11:35070029-35070051 AGTCTCAGCAAAGAAATAGAAGG + Intergenic
1080829521 11:35878377-35878399 TGTCTCTGCAAAAAATTAGCTGG + Intergenic
1080859449 11:36140588-36140610 CATCTCTACAAAAAATTAGCTGG - Intronic
1081191665 11:40111244-40111266 TGTCTATGCAAAACAATAGAAGG - Intergenic
1081756273 11:45546988-45547010 TGGCTCTACAAAAAATTAGCTGG + Intergenic
1081832935 11:46129755-46129777 GGTCTCTAAAAAAAAAAATCAGG - Intergenic
1081916983 11:46738633-46738655 TCTCTCTACAAAAAATTAGCTGG - Intronic
1082015744 11:47485340-47485362 CCTCTCTGCAAAAAATTAGCTGG - Intronic
1082074425 11:47965236-47965258 TGTCTCTACAAAAAATTAGCTGG - Intergenic
1082077689 11:47987044-47987066 TGTCTATACAAAAAATTAGCTGG + Intronic
1082839873 11:57680213-57680235 TGTCTCTACAAAAAATTAGCCGG + Intronic
1082868778 11:57924101-57924123 TGTCTCTACTAAAAATTAGCTGG - Intergenic
1083294758 11:61709403-61709425 CGTCTCTACAAAAAATTAGCGGG - Intronic
1083567347 11:63730625-63730647 GGTCTCTACAAAAAAACTCCAGG - Intronic
1083569882 11:63754118-63754140 TGTCTCTAAAAAAAAATAGCCGG + Intronic
1083573927 11:63775713-63775735 CGTCTCTACTAAAAATTAGCTGG + Intergenic
1083755883 11:64791538-64791560 TGACTCTACAAAAAATTAGCTGG - Intronic
1083818547 11:65151996-65152018 TGTCTCTACAAAAAATTAGCTGG + Intergenic
1083834936 11:65260493-65260515 CTTCTCTACAAAAAATTAGCGGG - Intergenic
1084280961 11:68093167-68093189 TATCTCTATAAAAAAATAGCTGG - Intronic
1084348256 11:68572678-68572700 TGGCTCTACAAAAAATTAGCCGG + Intronic
1084466506 11:69326212-69326234 GGTCTCTGGAAAGAGACAGCCGG - Intronic
1084897642 11:72286091-72286113 CATCTCTGCAAAAAATTAGCTGG - Intergenic
1085366852 11:75955725-75955747 TGTCTCTACAAAAAATTAGTCGG + Intronic
1085711852 11:78836186-78836208 TGTTTCTACAAAAAATTAGCTGG + Intronic
1086380634 11:86248847-86248869 TGTCTCTACCAAAAATTAGCTGG + Intronic
1086737330 11:90322507-90322529 GGTCTCTGTAAACAAAATGCAGG - Intergenic
1087348921 11:97006405-97006427 GGTCTCTGCAAATACATTGCTGG + Intergenic
1087470049 11:98561633-98561655 GCTCTCGGCAAAAAAAGAGGGGG - Intergenic
1088281544 11:108139820-108139842 CGTCTCTACTAAAAATTAGCCGG - Intronic
1088295871 11:108293714-108293736 CGTCTCTACAAAAAATTAGTCGG + Intronic
1088314136 11:108490046-108490068 CATCTCTACAAAAAATTAGCTGG - Intronic
1088639858 11:111861641-111861663 CATCTCTACAAAAAATTAGCTGG - Intronic
1089040123 11:115440137-115440159 GGTCTTGGCAAAAAATTAGTTGG + Intronic
1089611267 11:119670806-119670828 CGTCTCTACAAAATATTAGCCGG - Intronic
1089991100 11:122860864-122860886 CATCTCTACAAAAAAATAGCTGG - Intronic
1090833053 11:130432873-130432895 TGTCTCTACTAAAAATTAGCTGG - Intergenic
1091499819 12:1005310-1005332 CATCTCTACAAAAAATTAGCTGG - Intronic
1091555525 12:1570426-1570448 GGGCTCCGCAAAAAAAGTGCAGG + Intronic
1092145023 12:6208731-6208753 CGTCTCTACTAAAAATTAGCCGG - Intronic
1092374927 12:7947494-7947516 CGTCTCTGCAAAAAATTAGCTGG - Intergenic
1092888592 12:12947724-12947746 CGTCTCTACAAAAAATTAGCTGG - Intronic
1093167005 12:15815728-15815750 CATCTCTACAAAAAATTAGCCGG - Intronic
1093469598 12:19486550-19486572 TCTCTCTACAAAAAATTAGCTGG - Intronic
1093930554 12:24951424-24951446 CGTCTCTACTAAAAATTAGCCGG + Intergenic
1093949409 12:25147484-25147506 CATCTCTACAAAAAATTAGCTGG + Intronic
1093969183 12:25359204-25359226 CGTCTCTACAAAAAATTAGTTGG - Intergenic
1094012416 12:25823366-25823388 CGTCTCTACTAAAAATTAGCTGG - Intergenic
1095304796 12:40626516-40626538 CGTCTCTACAAAAAATTTGCTGG + Intergenic
1095417733 12:41994733-41994755 CATCTCTACAAAAAATTAGCCGG + Intergenic
1095770870 12:45955316-45955338 GATCTCTACAAAAAATTAGCTGG - Intronic
1096078972 12:48821321-48821343 TGTCTCTACAAAAAACTAGTAGG + Intronic
1096163919 12:49404446-49404468 AGTCTTTACAAAAAATTAGCTGG - Intronic
1096170941 12:49469226-49469248 AGTCTCTACCAAAAATTAGCTGG + Intronic
1096320921 12:50612099-50612121 CATCTCTACAAAAAATTAGCAGG + Intronic
1096647386 12:53046320-53046342 CATCTCTACAAAAAATTAGCTGG + Intergenic
1096762939 12:53858497-53858519 CGTCTCTACTAAAAATTAGCTGG + Intergenic
1096825718 12:54275834-54275856 CGTCTCTACTAAAAATTAGCCGG + Intronic
1097071441 12:56357869-56357891 CATCTCTACAAAAAATTAGCTGG - Intronic
1097211353 12:57373038-57373060 CATCTCTACAAAAAATTAGCTGG + Intronic
1097819946 12:64118429-64118451 CATCTCTACAAAAAATTAGCTGG - Intronic
1097870913 12:64601650-64601672 CGTCTCTACAAAAAATTAGCTGG + Intergenic
1097978959 12:65717576-65717598 CGTCTCTACAAAAAATTAGCTGG - Intergenic
1098257236 12:68629146-68629168 TGTCTCTACAAAAAATTACCTGG - Intronic
1098354155 12:69594683-69594705 TGTCTCTACAAAAAATTAGCTGG + Intronic
1098428882 12:70397186-70397208 CTTCTCTACAAAAAATTAGCTGG + Intronic
1098873157 12:75839223-75839245 GGTTTCTGCAAATAAATACAAGG + Intergenic
1098942075 12:76549570-76549592 TGTCTCTACTAAAAATTAGCTGG - Intronic
1099945782 12:89242627-89242649 CATCTCTACAAAAAATTAGCTGG - Intergenic
1100987786 12:100220823-100220845 CGTCTCTACAAAAAATTAGCCGG + Intronic
1101233208 12:102762999-102763021 GTTCTCTGCCACAAAATAGATGG + Intergenic
1101955438 12:109208375-109208397 CGTCTCTACAAAAAATTAGCTGG - Intronic
1102141181 12:110616414-110616436 CGTCCCTACAAAAAATTAGCCGG - Intronic
1102469939 12:113154115-113154137 TGTCTCTACAAAAAATTAGTCGG + Intronic
1102642666 12:114380666-114380688 CGTCGCTACAAAAAATTAGCTGG + Intronic
1102834481 12:116041671-116041693 CGTCTCTACCAAAAATTAGCTGG + Intronic
1102954491 12:117050761-117050783 TGTCTCTACAAAAAATTAGATGG + Intronic
1102981408 12:117244406-117244428 TGTCTCTACTAAAAATTAGCTGG - Intronic
1103091552 12:118101824-118101846 GGTCTGGGCATCAAAATAGCTGG + Intronic
1103264919 12:119621207-119621229 TGTATCTACAAAAAATTAGCTGG - Intronic
1103526608 12:121573442-121573464 TCTCTCTACAAAAAATTAGCTGG - Intronic
1103529569 12:121591460-121591482 CATCTCTACAAAAAATTAGCAGG + Intergenic
1103689707 12:122761648-122761670 TGTCTCTACAAAAAATTAGCTGG + Intronic
1103890825 12:124237972-124237994 TGTCTCTGCTAAAAATTAGCTGG - Intronic
1104012926 12:124944758-124944780 TGTCTCTACCAAAAATTAGCTGG + Intergenic
1104691196 12:130827742-130827764 TGTCTCTACAAAAAATTAGCTGG + Intronic
1104824224 12:131696967-131696989 TGCCTCTACAAAAAATTAGCTGG + Intergenic
1104864353 12:131944075-131944097 CGTCTCTGCAAAAGATTAGCTGG + Exonic
1105023491 12:132833648-132833670 GCTCTCTACTAAAAATTAGCTGG + Intronic
1105327054 13:19380303-19380325 TGTCTCTACAAAAAATTAGCTGG - Intergenic
1105504032 13:20994723-20994745 CGTCTCTACACAAAAATAGCTGG + Intronic
1105864592 13:24448033-24448055 TGTCTCTACAGAAAATTAGCTGG + Intronic
1106746227 13:32711152-32711174 TGTCTCTACAAAAAATTAGCCGG - Intronic
1106807510 13:33325821-33325843 CGTCTCTACAAAAAATTAGCCGG + Intronic
1107047357 13:36008167-36008189 GGACTCTGAAAAAAAAAAGATGG - Intronic
1107321404 13:39192602-39192624 TGTCTCTACAAAAAATCAGCTGG + Intergenic
1107355908 13:39566569-39566591 GGTCTCTACAAAAAATTAGCTGG + Intronic
1107509329 13:41067121-41067143 CGTCTCTACCAAAAAATCGCTGG - Intronic
1107748768 13:43542301-43542323 TGTCTCTACAAAAAATTAGCCGG - Intronic
1107886401 13:44877518-44877540 CGCCTCTACAAAAAATTAGCCGG + Intergenic
1108604068 13:52019769-52019791 TGTCTCTACAAAAAATTATCTGG + Intronic
1110215770 13:73023288-73023310 TGTCTCTACTAAAAATTAGCTGG - Intergenic
1110660103 13:78050729-78050751 TGTCTCTACTAAAAATTAGCCGG + Intergenic
1111674573 13:91370594-91370616 TCTCTCTGCAAAAAAATGGGAGG - Intergenic
1112935534 13:104793754-104793776 GGTGTCTGCAAAAAAATATGAGG + Intergenic
1113775112 13:112939808-112939830 TCTCTATGCAAAAAATTAGCTGG + Intronic
1114302210 14:21388651-21388673 TATCTCTACAAAAAATTAGCTGG - Intronic
1114320791 14:21545640-21545662 TGTCTCTACAAAAAATTAGTGGG - Intergenic
1114461477 14:22888683-22888705 TGTCTTTACAAAAAATTAGCTGG + Intergenic
1114590245 14:23857944-23857966 TGTCTCTACAAAAAATTAGCTGG + Intergenic
1114938634 14:27576835-27576857 TGTCTCTACCAAAAAATAGTTGG - Intergenic
1115024704 14:28729552-28729574 GGTATCTGAAAAAAAATTGTGGG + Intergenic
1115188284 14:30717720-30717742 CGTCTCTACAAAAAATTAGTGGG + Intronic
1115549301 14:34490824-34490846 TGTCTCTACTAAAAATTAGCTGG - Intergenic
1116315814 14:43390438-43390460 TGTCTCTACAAAAAATTAGCGGG + Intergenic
1116648727 14:47563346-47563368 GGTCACTACAAAATAATAGTGGG - Intronic
1116716175 14:48430255-48430277 TGTCTCTACAAAAAATTAGCTGG - Intergenic
1117154123 14:52920781-52920803 CATCTCTACAAAAAATTAGCTGG + Intronic
1117373627 14:55101342-55101364 GGTCTCTACAAAACAATAGAAGG + Intergenic
1117375338 14:55113827-55113849 CGTCTCTACAAAAAATTAGCCGG - Intergenic
1117388272 14:55238389-55238411 CGTCTCTACAAAAAATTAGTTGG - Intergenic
1117671444 14:58110921-58110943 CGTCTCTCCTAAAAATTAGCTGG - Intronic
1117777969 14:59201451-59201473 TGTCTCTACTAAAAATTAGCTGG + Intronic
1117943580 14:60994540-60994562 CGTCTCAGAAAAAAATTAGCTGG + Intronic
1118632773 14:67721413-67721435 TGTCTCTACAAAAAATTATCTGG - Intronic
1118997815 14:70853190-70853212 TGTCTCTACTAAAAATTAGCTGG - Intergenic
1119249286 14:73137904-73137926 CGGCTCTACAAAAAATTAGCTGG + Intronic
1119437463 14:74606675-74606697 CGTCTCTACTAAAAATTAGCTGG + Intronic
1119551483 14:75517124-75517146 TGTCTCTACAAAAAATTAGCTGG - Intergenic
1119879842 14:78091547-78091569 GGTGTCTGCTAAGAAATAGCTGG - Intergenic
1120578048 14:86208191-86208213 GGTCAATACAAAAAATTAGCGGG + Intergenic
1120767544 14:88343293-88343315 TGGCTCTCCAAAAAAATACCGGG + Intergenic
1120977843 14:90265382-90265404 TGTCTCTATAAAAAATTAGCTGG + Intronic
1121011246 14:90521464-90521486 GGTCTCAGCAAGAACAAAGCTGG - Intergenic
1121012827 14:90532010-90532032 TGTCTCTGAAAAAAATTAGTGGG + Exonic
1121082992 14:91123746-91123768 TGTCTCTACAAAAAATCAGCTGG - Intronic
1122176596 14:99925419-99925441 TGTCTCTAAAAAAAATTAGCTGG - Intronic
1122557058 14:102586301-102586323 TGTCTCTACAAAAAATTAGCTGG + Intergenic
1122674996 14:103405510-103405532 TGTCTCTACAAAAAATTAGCTGG - Intronic
1122701265 14:103590696-103590718 TGTCTCTACAAAAAATTAGCTGG + Exonic
1122708511 14:103637858-103637880 TGTCTCTACAAAAAACAAGCCGG - Intronic
1122980499 14:105190253-105190275 TGTCTCTACAAAAAATTAGCTGG + Intergenic
1123452681 15:20380791-20380813 GTTCTCTGTAAAAAAAGAGCAGG + Intergenic
1124372143 15:29110064-29110086 GGGCTCTGCAGAAAATCAGCTGG + Intronic
1124903533 15:33846641-33846663 GGTCTCTGCAGCACAGTAGCTGG - Intronic
1124929462 15:34105092-34105114 TGTCTCTGAACAAAAATAGCTGG + Exonic
1125295968 15:38203446-38203468 GGTCTGTGAAAAAAAATACTGGG + Intergenic
1125569386 15:40704233-40704255 TGTCTCTACTAAAAATTAGCTGG - Intronic
1125626135 15:41110598-41110620 CATCTCTACAAAAAATTAGCCGG - Intronic
1125927164 15:43572262-43572284 TATCTCTACAAAAAATTAGCCGG + Intronic
1125940308 15:43671827-43671849 TATCTCTACAAAAAATTAGCCGG + Intergenic
1126042280 15:44603260-44603282 TGTCTCTACAAAAAATTAGCCGG - Intronic
1126259435 15:46670982-46671004 CATCTCTACAAAAAATTAGCCGG - Intergenic
1126346835 15:47704547-47704569 CATCTCTACAAAAAATTAGCTGG + Intronic
1126625658 15:50684019-50684041 CGTCTCTACTAAAAATTAGCAGG - Intronic
1126796726 15:52265698-52265720 CATCTCTACAAAAAATTAGCTGG - Intronic
1127150903 15:56074301-56074323 CGTCTCTACAGAAAATTAGCTGG + Intergenic
1127156461 15:56131426-56131448 TGTCTCTACAAAAAATTAGCTGG - Intronic
1127253441 15:57266865-57266887 TGTCTCTACAAAAAATTAGCGGG + Intronic
1127297222 15:57619537-57619559 GGTCTCTACAAAAAATTATCTGG - Intronic
1127440609 15:59003272-59003294 TGTCTCTACAAAAACTTAGCTGG - Intronic
1127491689 15:59470982-59471004 TGTCTCTACAAAAAATTAGCTGG - Intronic
1127800179 15:62471173-62471195 TGCCTCTACAAAAAATTAGCTGG + Intronic
1128101795 15:65007189-65007211 GCTCTCAGCAAAAAAAGAGGGGG - Intronic
1128137749 15:65276533-65276555 TGTCTGTACAAAAAATTAGCTGG - Intronic
1128189200 15:65674581-65674603 CATCTCTACAAAAAAATAGCCGG + Intronic
1128189845 15:65681735-65681757 TGTCTCTACAAAAAATTAGCTGG - Intronic
1128307171 15:66606385-66606407 CATCTCTACAAAAAATTAGCTGG + Intronic
1129123855 15:73421258-73421280 CGCCTCTTAAAAAAAATAGCTGG - Intergenic
1129176033 15:73840262-73840284 GCTCTGTGCTAAACAATAGCAGG + Intergenic
1129432090 15:75506669-75506691 GGTTACTACAAAAAATTAGCTGG - Intronic
1129448120 15:75633130-75633152 TGTCTCTACAAAAAATTGGCCGG - Intergenic
1129753782 15:78083707-78083729 CATCTCTACAAAAAATTAGCTGG + Intronic
1129810276 15:78504845-78504867 CGTCTCTACAAAAAATTAGCCGG + Intergenic
1129854828 15:78815944-78815966 TGTCTCTACAAAAAATTAGCTGG + Intronic
1129863617 15:78884340-78884362 TGTCTCTACTAAAAATTAGCTGG + Intronic
1130231100 15:82097569-82097591 TGTCTATACAAAAAATTAGCAGG - Intergenic
1130360871 15:83184730-83184752 GATGTCTTCAAAAAAAGAGCAGG + Intronic
1130427593 15:83816832-83816854 TGTCTCTACAAAAAATTAGCTGG + Intronic
1130536670 15:84790388-84790410 GGCCTCTGCAAAGGAAAAGCTGG + Intronic
1130570862 15:85042334-85042356 TGTCTCTACAAAAAATTAGCTGG - Intronic
1131181608 15:90243809-90243831 TATCTCTCCAAAAAAATAGCCGG - Exonic
1131196317 15:90358055-90358077 CGTCTCTACTAAAAATTAGCCGG - Intronic
1131372797 15:91897287-91897309 GATCTCTACTAAAAATTAGCTGG + Intronic
1131482395 15:92793236-92793258 CTTCTCTACAAAAAATTAGCCGG + Intronic
1131641197 15:94295751-94295773 TATCTGTACAAAAAAATAGCTGG + Intronic
1132409782 15:101568071-101568093 CGTCTCTACAAAAAAACAGCTGG - Intergenic
1132975941 16:2711311-2711333 GGTCTCAGCACAAAGACAGCAGG + Intergenic
1133163833 16:3932312-3932334 TGTTTCTACAAAAAATTAGCTGG + Intergenic
1133183016 16:4073254-4073276 CGTCTCTACCAAAAATTAGCTGG - Intronic
1133245266 16:4444503-4444525 GGTCTCTACTAAAAATTAACTGG - Intronic
1133484922 16:6210558-6210580 TGTCTCTACAAAAAATTAGCTGG + Intronic
1133561243 16:6952475-6952497 TGTCTCTACAAAAAATTAGCAGG + Intronic
1133733704 16:8597537-8597559 CATCTCTACAAAAAATTAGCTGG + Intergenic
1133770193 16:8863280-8863302 TGTCTCTACAAAAAATGAGCTGG - Intronic
1134079265 16:11313897-11313919 TGTCTCTACAAAAAATTAGCTGG - Intronic
1134105451 16:11482508-11482530 GGTGTCTTCCAAAAAATAGCAGG - Intronic
1134137197 16:11685192-11685214 TGTCTCTACAAAAAATTGGCCGG + Intronic
1134379156 16:13708255-13708277 GGTGTCTGCAAAAAATTAGCTGG - Intergenic
1134446759 16:14336941-14336963 CGTCTCTACCAAAAATTAGCTGG - Intergenic
1134661852 16:15990214-15990236 TGTCTCTACTAAAAATTAGCTGG - Intronic
1134853694 16:17502399-17502421 TGTCTCTAAAAAAAATTAGCTGG - Intergenic
1135003570 16:18799179-18799201 TGTCTCTACAAAAAATTAGTCGG - Intronic
1135092105 16:19525146-19525168 AGGTTCTGCAAAAAAAAAGCAGG + Intronic
1135164665 16:20128542-20128564 TTTCTCTACAAAAAATTAGCTGG - Intergenic
1135344991 16:21681419-21681441 CATCTCTACAAAAAATTAGCTGG + Intronic
1135415997 16:22268338-22268360 TGTCTCTACTAAAAATTAGCTGG - Intronic
1135982690 16:27160652-27160674 CGTCTCTATAAAAAATTAGCTGG - Intergenic
1136162422 16:28429131-28429153 AGTCTCTACTAAAAATTAGCTGG + Intergenic
1136183229 16:28569488-28569510 TGTCTCTACAAAAAATTAGCCGG + Intronic
1136200544 16:28685858-28685880 AGTCTCTACTAAAAATTAGCTGG - Intergenic
1136216889 16:28800051-28800073 AGTCTCTACTAAAAATTAGCTGG - Intergenic
1136490917 16:30607798-30607820 TGTCTCTACTAAAAATTAGCCGG + Intronic
1137452914 16:48593838-48593860 TGTCTCTACTAAAAATTAGCCGG + Intronic
1137659540 16:50192910-50192932 TGTCTCTACAAAAAATTAGCTGG + Intronic
1138020544 16:53475991-53476013 CGTATCTACAAAAAATTAGCAGG - Intronic
1138147420 16:54625054-54625076 TGTCTCTACTAAAAATTAGCTGG - Intergenic
1138432824 16:56980339-56980361 TGTCTCTACAAAAAAATACGTGG - Intronic
1138476837 16:57275944-57275966 TGTCTCTACCAAAAATTAGCTGG + Intronic
1139290884 16:65856782-65856804 TGTCTCTACTAAAAATTAGCTGG + Intergenic
1139565847 16:67775641-67775663 TGTCTCTACAAAAAATTAGGTGG + Intronic
1139757362 16:69155333-69155355 TGACTCTACAAAAAATTAGCCGG - Intronic
1139995918 16:70979760-70979782 CGTCTCTACAAAAAATTAGCTGG + Intronic
1140415378 16:74770538-74770560 CGTCTCTACAAAAAATTAGCTGG - Intronic
1140488606 16:75315169-75315191 CGTCTCTACAAAAAATTTGCCGG + Intronic
1141056939 16:80826272-80826294 CGTCTCTACTAAAAATTAGCTGG - Intergenic
1141738616 16:85873597-85873619 CGTCTCTACAAAAAATTATCTGG - Intergenic
1142384064 16:89751328-89751350 CGTCTCTACAAAAAATCAGCTGG + Intronic
1142404710 16:89881612-89881634 CATCTCTACAAAAAATTAGCAGG - Intronic
1142580479 17:938888-938910 CGTCTCTACTAAAAATTAGCTGG + Intronic
1142661766 17:1435219-1435241 CATCTCTACAAAAAATTAGCTGG - Intronic
1142721640 17:1780219-1780241 TGTCTCAACAAAAAAATAACAGG - Exonic
1142800135 17:2339550-2339572 TCTCTCTACAAAAAATTAGCTGG + Intronic
1142891104 17:2943501-2943523 TGTCTCTACTAAAAATTAGCTGG + Intronic
1143224336 17:5287748-5287770 CATCTCTACAAAAAATTAGCCGG + Intronic
1143231168 17:5356810-5356832 CGTCTCTACAAAAAATTAGCTGG - Intronic
1143550202 17:7626030-7626052 CGTCTCTACTAAAAATTAGCCGG + Intronic
1143705046 17:8691556-8691578 TGTTTCTACAAAAAATTAGCAGG - Intergenic
1143819903 17:9552178-9552200 CATCTCTACAAAAAATTAGCTGG + Intronic
1143879407 17:10018689-10018711 TGTCTCTGCTAAACAGTAGCTGG + Intronic
1143931627 17:10435095-10435117 GTTCTCTCCTAAAAACTAGCTGG + Intergenic
1144706016 17:17368361-17368383 TGTCTCTACTAAAAATTAGCCGG + Intergenic
1144868467 17:18352656-18352678 TGTCTCTACAAAAAATTAGCTGG + Intronic
1145036870 17:19547211-19547233 TATCTCTACAAAAAATTAGCTGG - Intronic
1145187125 17:20804371-20804393 TGTCTCTACAAAAAATTAGCTGG + Intergenic
1145876674 17:28323834-28323856 CGTCTCTACAGAAAATTAGCTGG + Intronic
1145911003 17:28543106-28543128 TATCTCTACAAAAAATTAGCTGG + Intronic
1145985032 17:29040113-29040135 TGTCTCTACAAAAAATAAGCTGG + Intronic
1146078371 17:29754826-29754848 TGTCTTTACAAAAAATTAGCTGG - Intronic
1146388166 17:32396263-32396285 TGTCTCTACTAAAAATTAGCTGG + Intergenic
1146388314 17:32397433-32397455 TATCTCTACAAAAAATTAGCAGG + Intergenic
1146851727 17:36227873-36227895 TGTCTCTACAAAAAATTAGCTGG - Intronic
1146867637 17:36351746-36351768 TGTCTCTACAAAAAATTAGCTGG - Intronic
1147070511 17:37952363-37952385 TGTCTCTACAAAAAATTAGCTGG - Intergenic
1147082037 17:38031885-38031907 TGTCTCTACAAAAAATTAGCTGG - Intronic
1147097984 17:38155850-38155872 TGTCTCTACAAAAAATTAGCTGG - Intergenic
1147188068 17:38723328-38723350 AGTCTCTACAAAAAATTAGCTGG + Intronic
1147236360 17:39060486-39060508 GGACTGTGCAAATAAATAGATGG + Intergenic
1147416223 17:40292196-40292218 TGTCTCTACAAAAAATTAGCTGG - Intronic
1147998167 17:44372788-44372810 TGTCTCTACTAAAAATTAGCTGG - Intronic
1148285276 17:46384416-46384438 TGTCTCTACCAAAAATTAGCGGG + Intergenic
1148307440 17:46602012-46602034 TGTCTCTACCAAAAATTAGCGGG + Intronic
1150035407 17:61790797-61790819 GTTGTCTACAAAAAATTAGCTGG - Intronic
1150051137 17:61964400-61964422 CATCTCTACAAAAAAGTAGCTGG + Intronic
1150052059 17:61974240-61974262 TGTCTCTACAAAAAGTTAGCTGG + Intronic
1150079684 17:62225955-62225977 TGTCTCTACAAAAAATTAGCTGG - Intergenic
1150780868 17:68120971-68120993 CATCTCTACAAAAAATTAGCTGG + Intergenic
1150913658 17:69414092-69414114 CGTCTCTACTAAAAATTAGCCGG + Intergenic
1151441649 17:74133173-74133195 CATCTCTACAAAAAAATAGCTGG + Intergenic
1151525397 17:74662606-74662628 CATTTCTGCAAAAAATTAGCCGG + Intergenic
1151553090 17:74833183-74833205 TGTCTCTCCTAAAAATTAGCTGG - Intronic
1151612248 17:75183629-75183651 CGTCTCTACGAAAAATTAGCCGG - Intergenic
1151650060 17:75461750-75461772 CGTCTCTACTAAAAATTAGCTGG + Intronic
1151754998 17:76069543-76069565 TGTCTCTACTAAAAATTAGCCGG + Intronic
1151781674 17:76250761-76250783 TATCTCTTAAAAAAAATAGCCGG - Intergenic
1151931539 17:77235117-77235139 CCTCTCTACAAAAAATTAGCTGG + Intergenic
1152131857 17:78482212-78482234 TGTCTCTACAAAAACTTAGCCGG - Intronic
1152150835 17:78600037-78600059 CGTCTCTACAAAAAATTAACTGG - Intergenic
1152475608 17:80516164-80516186 TGTCTCTACTAAAAATTAGCTGG + Intergenic
1153090039 18:1332587-1332609 CGTCTCTACTAAAAATTAGCAGG - Intergenic
1153170587 18:2311593-2311615 CATCTCTACAAAAAATTAGCTGG + Intergenic
1153531246 18:6048625-6048647 CGTCTCTACTAAAAATTAGCCGG + Intronic
1153611266 18:6887590-6887612 TGCCTCTGCAAAAAATGAGCTGG - Intronic
1154969908 18:21397361-21397383 CGTCTCTACCAAAAATTAGCCGG + Intronic
1155550172 18:26956148-26956170 TGTCTCTACTAAAAATTAGCTGG + Intronic
1156013189 18:32517396-32517418 TGTCTCTACAAAAAATTAGCTGG + Intergenic
1156059393 18:33055496-33055518 CATCTCTGCAAAAAATTAGCGGG - Intronic
1156724397 18:40110560-40110582 TGTCTCTGTGAAAAATTAGCTGG + Intergenic
1156874073 18:41984971-41984993 GGTCACTCCAACAGAATAGCTGG - Intronic
1158416500 18:57253552-57253574 GGTCTCTGTAAAACAAAAGTCGG - Intergenic
1158701861 18:59755364-59755386 CGCCTCTACAAAAAATTAGCCGG + Intergenic
1158733964 18:60058286-60058308 CATCTCTACAAAAAATTAGCTGG + Intergenic
1159522560 18:69544957-69544979 CATCTCTACAAAAAATTAGCTGG + Intronic
1159956902 18:74525099-74525121 CATCTCTACAAAAAATTAGCTGG - Intergenic
1160204154 18:76819781-76819803 CATCTCTACAAAAAATTAGCTGG - Intronic
1160924289 19:1535711-1535733 CATCTCTACAAAAAATTAGCTGG + Intergenic
1161006258 19:1938470-1938492 TGTCTCTATAAAAAATTAGCCGG + Intergenic
1161148329 19:2693119-2693141 CATCTCTACAAAAAATTAGCCGG + Intronic
1161178447 19:2862995-2863017 GCTCTCCGCAAAATAAAAGCAGG + Intergenic
1161408943 19:4105831-4105853 CGTCTCTACAAAAAATTAGCAGG - Intronic
1161762785 19:6186864-6186886 GGTCTCTGCAAAAAAATAGCCGG - Intronic
1161806319 19:6445110-6445132 CGTCTCTGAAAAAAAAAAGAAGG - Intronic
1161823043 19:6542844-6542866 TGTCTCTGCAAAAAATTAGCTGG + Intergenic
1161895129 19:7074577-7074599 GGTCTCTGATAGAAAATGGCTGG + Intronic
1161995655 19:7709900-7709922 CGTCTCTACCAAAAATTAGCCGG - Intergenic
1162075895 19:8187078-8187100 TGTCTCTACAAAAAATTAGCTGG + Intronic
1162118521 19:8446570-8446592 CCTCTCTTCAAAAAATTAGCCGG - Intronic
1162122782 19:8482132-8482154 CGTCTCTACTAAAAATTAGCCGG - Intronic
1162337072 19:10068345-10068367 CATCTCTACAAAAAATTAGCTGG + Intergenic
1162448995 19:10743073-10743095 CGCCTCTACAAAAAATTAGCCGG - Intronic
1162574605 19:11491746-11491768 TGTCTCTACTAAAAATTAGCTGG - Intronic
1162580683 19:11528411-11528433 GTTCTCTACAAAAAATTATCTGG - Intronic
1162640132 19:12001997-12002019 CGTCTCTACTAAAAATTAGCAGG + Intergenic
1162671953 19:12265234-12265256 GCTCTCTACAAAAAATTAGCTGG + Intronic
1162719658 19:12654833-12654855 AGTCTCTACAAAAAATTAGCTGG - Intronic
1162916916 19:13879564-13879586 AGTGTCTACAAAAAATTAGCTGG + Intronic
1163728293 19:18934805-18934827 CGTCTCTAGAAAAAATTAGCCGG - Intronic
1163866712 19:19779231-19779253 CGTCTCTACTAAAAATTAGCTGG - Intergenic
1163873659 19:19847115-19847137 TGTCTCTACTAAAAATTAGCTGG + Intergenic
1164403829 19:27924110-27924132 TGTTTCTACAAAAAATTAGCTGG - Intergenic
1164468371 19:28507346-28507368 TGTCTCTACTAAAAATTAGCCGG - Intergenic
1164897416 19:31889132-31889154 GGGCTCAGAAAAAAAAAAGCGGG + Intergenic
1165010179 19:32840332-32840354 TGTCTCTACAAAAAGATAGCTGG - Intronic
1165485277 19:36091725-36091747 TATCTCTACAAAAAATTAGCCGG + Intronic
1165567079 19:36739823-36739845 TGTGTCTACAAAAAATTAGCAGG + Intronic
1166077827 19:40424187-40424209 TGTCTCTACAAAAAAATAAAAGG - Intronic
1166112536 19:40631500-40631522 CATCTCTACAAAAAAGTAGCTGG + Intergenic
1166537408 19:43583349-43583371 TGTCTCTACAAAAAAATTACAGG - Intronic
1166667649 19:44690639-44690661 TGTCTCTACTAAAAATTAGCTGG + Intergenic
1166717171 19:44976022-44976044 CATCTCTACAAAAAATTAGCTGG - Intronic
1166946501 19:46400439-46400461 TGTCTCTACAAAAAATTAGTCGG - Intergenic
1167093715 19:47362103-47362125 CGTCACTGCAAAAAATTAGCCGG + Intronic
1167190433 19:47984903-47984925 CGTCTCTACTAAAAATTAGCCGG + Intronic
1167504903 19:49866168-49866190 TGTCTCTCTAAAAAATTAGCGGG - Intronic
1167955002 19:53057582-53057604 CGTCTCTACTAAAAATTAGCCGG - Intergenic
1168088331 19:54064629-54064651 CATCTCTACAAAAAATTAGCTGG - Intergenic
1168090314 19:54078614-54078636 GGTCATTGCAAAAAAAGTGCTGG + Intronic
1168532689 19:57142309-57142331 CGTCTCTACAAAAAATTAGCTGG - Intronic
1168671616 19:58245107-58245129 CATCTCTACAAAAAATTAGCTGG - Intronic
1168684983 19:58343562-58343584 CGTGTCTACAAAAAATTAGCCGG + Intergenic
925166950 2:1721663-1721685 CGTCTCTACTAAAAATTAGCCGG + Intronic
925232219 2:2243610-2243632 GGGCCCTGCAGAAAAGTAGCTGG + Intronic
925782343 2:7393076-7393098 GGTCCCTGCAAAAAAACAACTGG + Intergenic
926678386 2:15645745-15645767 CATCTCTACAAAAAATTAGCTGG + Intergenic
926798537 2:16638716-16638738 TGTCTCTGCAAAATAATAAAAGG - Intronic
926859565 2:17294081-17294103 CATCTCTACAAAAAATTAGCCGG + Intergenic
927191512 2:20520133-20520155 GGTGTCTGCAAAATAACGGCAGG - Intergenic
927547789 2:23970120-23970142 CATCTCTACAAAAAATTAGCTGG + Intronic
927886124 2:26720091-26720113 CGTCTCTACTAAAAATTAGCCGG + Intronic
927919005 2:26957011-26957033 CGTCTCTACTAAAAATTAGCCGG - Intergenic
927970149 2:27300704-27300726 TGTCTCTACAAAAAATTAGCTGG + Intronic
928647287 2:33368043-33368065 TGTCTCTACTAAAAAATAGCCGG + Intronic
928690646 2:33794963-33794985 CGTCTCTACAAAAACTTAGCTGG + Intergenic
928706768 2:33957915-33957937 CGTCTCTACTAAAAATTAGCTGG - Intergenic
929194740 2:39173505-39173527 TTTCTCTACAAAAAATTAGCTGG + Intergenic
929509439 2:42555291-42555313 CATCTCTGCTAAAAATTAGCCGG + Intronic
929512327 2:42574294-42574316 CATCTCTGCTAAAAATTAGCCGG - Intronic
930060010 2:47280430-47280452 CATCTCTACAAAAAATTAGCTGG - Intergenic
930608287 2:53514716-53514738 CATCTCTACAAAAAATTAGCTGG + Intergenic
930786121 2:55273073-55273095 CGTCTCTACTAAAAATTAGCCGG + Intergenic
931218532 2:60268038-60268060 GGTCTCTGCAGAAGAATACCGGG - Intergenic
931238777 2:60434163-60434185 CATCTCTACAAAAAATTAGCCGG + Intergenic
931375427 2:61703466-61703488 CATCTCTACAAAAAATTAGCTGG + Intergenic
931400809 2:61929760-61929782 GGTCTTTACAAAAAATTAGTTGG + Intronic
931875277 2:66505243-66505265 TGTCTCTACCAAAAATTAGCTGG + Intronic
932506626 2:72239058-72239080 CGACTCTACAAAAAATTAGCCGG - Intronic
932661641 2:73658869-73658891 AGTCTCTGAAAAAAAATAAAAGG + Intergenic
933077034 2:77941871-77941893 GTTTTCTACAAAAAAAGAGCAGG + Intergenic
933504848 2:83163656-83163678 CGTCTCTACAAAAAATTAGCCGG - Intergenic
933693642 2:85198697-85198719 CGTCTCTACAAAAAATTAGCTGG + Intronic
933865968 2:86517857-86517879 CATCTCTACAAAAAACTAGCTGG + Intronic
934029111 2:88025525-88025547 TGTCTCAGCAAAAAAAGAGTAGG + Intergenic
934687215 2:96330080-96330102 CGTCTCTACAAAAAATTAGCTGG + Exonic
934740399 2:96717368-96717390 CATCTCTACAAAAAGATAGCTGG + Intronic
935080552 2:99789262-99789284 TGTCTCTACAAAAAATTATCTGG + Intronic
935164290 2:100556158-100556180 CATCTCTACAAAAAATTAGCTGG + Intergenic
935797790 2:106662359-106662381 CGTCTCTACTAAAAATTAGCTGG - Intergenic
936025092 2:109025634-109025656 CGTCTCTACTAAAAATTAGCCGG + Intergenic
936408969 2:112236892-112236914 TGTCTCTACAAAAACATAGCTGG + Intronic
937184915 2:120031036-120031058 TGTCTCTACTAAAAATTAGCTGG - Intronic
937810413 2:126193624-126193646 GGTCTCTCTAAATAAAGAGCAGG + Intergenic
938641985 2:133290911-133290933 TGTCTCTACAAAAAATTAGCTGG - Intronic
939644879 2:144685694-144685716 TGTCTCTATAAAAAATTAGCTGG + Intergenic
941390487 2:164907433-164907455 CGTCTCTACAAAAAATTAGCCGG - Intronic
941519265 2:166518980-166519002 GGCCTCTGAAAAAAAAATGCAGG + Intergenic
941710282 2:168704766-168704788 CGTCTCTACTAAAAATTAGCCGG - Intronic
941990473 2:171551116-171551138 CATCTCTACAAAAAATTAGCTGG - Intronic
941998279 2:171622175-171622197 TGTCTCTATAAAAAATTAGCTGG + Intergenic
942006307 2:171703395-171703417 TGTCTCTACAAAAAATCAGCTGG - Intronic
942064235 2:172255100-172255122 TGTTTCTACAAAAAATTAGCTGG + Intergenic
942113853 2:172708130-172708152 TGTCTCTACAAAAAATTAGCTGG + Intergenic
942135529 2:172921256-172921278 TGTCTCCACAAAAAACTAGCTGG - Intronic
942465367 2:176202373-176202395 CATCTCTACAAAAAATTAGCTGG - Intergenic
942719278 2:178931994-178932016 CGTCTCTACTAAAAATTAGCTGG + Intronic
942771479 2:179526196-179526218 TGTCTCTACAAAAAATTAGCTGG - Intronic
944083404 2:195815829-195815851 TGTCTCTACTAAAAATTAGCCGG + Intronic
944091437 2:195916504-195916526 GGTCTCTCTAAAATAATAGTTGG + Intronic
944181879 2:196904564-196904586 TGTCTCTACTAAAAATTAGCTGG + Intronic
944244615 2:197518429-197518451 AGTTTCTGCAAAAAATTAGCTGG - Intronic
944551163 2:200845719-200845741 TATCTCTACAAAAAAGTAGCGGG + Intergenic
944568439 2:201016448-201016470 CGTCTCTATAAAAAATTAGCTGG - Intronic
944618519 2:201487037-201487059 TGTCTCTACAAAAAATCAGCTGG - Intergenic
944703313 2:202264768-202264790 TGTCTCTACAAAAAATTAGCTGG + Intergenic
944761191 2:202816005-202816027 GTTCTCTGCAAAAAAAGAAAAGG + Exonic
944793158 2:203154072-203154094 TGTCTCTACAAAAAATTAGCCGG + Intronic
944796128 2:203187225-203187247 ACTCTCTACAAAAAATTAGCTGG - Intronic
944951992 2:204762281-204762303 CATCTCTACAAAAAATTAGCTGG - Intronic
945226443 2:207535980-207536002 TGTCTCTACAAAAAATTAGCCGG - Intronic
945473009 2:210249048-210249070 GCTGTGTGCAAAAGAATAGCAGG + Intergenic
946907853 2:224433223-224433245 CGTCTCTACTAAAAATTAGCCGG - Intergenic
946962537 2:225000084-225000106 TTTCTATGCAAAAATATAGCTGG + Intronic
947159880 2:227202571-227202593 CGTCTCTACAAAAAATTAGCCGG + Intronic
948202280 2:236137871-236137893 TGTCTCTACTAAAAATTAGCTGG - Intergenic
948941193 2:241197546-241197568 CATCTCTACAAAAAATTAGCCGG - Intronic
1169105753 20:2992921-2992943 TGCCTCTTCAAAAAATTAGCTGG + Intronic
1169109937 20:3026105-3026127 TGTCTCTACTAAAAATTAGCCGG - Intronic
1169232147 20:3897529-3897551 CGTCTCTACAAAAAATTAGCTGG + Intronic
1169374533 20:5055834-5055856 TGTCTCTGCTAAAAATTAGCTGG + Intergenic
1169463210 20:5814821-5814843 CGTCTCTACAAAAAATTAGTGGG - Intronic
1170448972 20:16462077-16462099 TGTCTCTACTAAAAATTAGCTGG + Intronic
1170695409 20:18653230-18653252 TGTCTCTATAAAAAATTAGCTGG + Intronic
1171210629 20:23314160-23314182 TGTCTCTAAAAAAAATTAGCTGG - Intergenic
1171241990 20:23577875-23577897 GATCTCTACAAAGAAATACCAGG - Intergenic
1171546413 20:26005413-26005435 TGTCTCTACAAAAAATTAGCTGG + Intergenic
1171789892 20:29513388-29513410 CTTCTCTGCAAAAAAATAAATGG - Intergenic
1171944063 20:31360318-31360340 CATCTCTACAAAAAATTAGCTGG + Intergenic
1172364431 20:34338105-34338127 CGTCTCTACCAAAAATTAGCTGG + Intergenic
1172364674 20:34339848-34339870 CGTCTCTACTAAAAATTAGCCGG - Intergenic
1172384172 20:34521874-34521896 CATCTCTACAAAAAATTAGCTGG + Intronic
1172396975 20:34614461-34614483 CATCTCTACAAAAAATTAGCCGG + Intronic
1172411923 20:34730874-34730896 TGTCTATACAAAAAATTAGCTGG - Intronic
1172486479 20:35301093-35301115 TGTCTCTACAAAAAGTTAGCTGG - Intergenic
1172576181 20:36010599-36010621 TGTCTCTGCTAAAAATTAGCTGG + Intronic
1172601926 20:36190013-36190035 ATTCTCTACAAAAAATTAGCTGG + Intronic
1172638054 20:36423137-36423159 GGTCACAGCAAATAAATAGCAGG + Intronic
1172742024 20:37176474-37176496 GATCTCTACAAAAAATTAGCTGG + Intronic
1172802038 20:37582490-37582512 TGTCTCTACTAAAAATTAGCTGG + Intergenic
1173040796 20:39460409-39460431 CATCTCTGCAAAAAATTAGCTGG + Intergenic
1173396409 20:42684181-42684203 TGTCTCTACTAAAAATTAGCTGG + Intronic
1173830017 20:46077077-46077099 CATCTCTACAAAAAAATAGCCGG - Intronic
1174005689 20:47408937-47408959 CATCTCTACAAAAAATTAGCTGG + Intergenic
1174234980 20:49082311-49082333 TGTCTCTACCAAAAAATTGCTGG - Intronic
1174237452 20:49105525-49105547 CGTCTCTACTAAAAATTAGCCGG - Intergenic
1174452145 20:50626850-50626872 TGTCTCTACTAAAAATTAGCTGG + Intronic
1176964122 21:15192944-15192966 CGTCTCTACAAAAAACTAGCAGG - Intergenic
1178461626 21:32807492-32807514 CGTCTCTACTAAAAATTAGCCGG - Intronic
1178520318 21:33283885-33283907 GGTGTCTGCATACAAACAGCAGG + Intronic
1178573011 21:33758282-33758304 AGTTTCTACAAAAAATTAGCTGG - Intronic
1178774052 21:35532186-35532208 TGTCTCTACAAAAATTTAGCCGG + Intronic
1179072199 21:38082123-38082145 GTTCTCTGCAAAACAAAAGGCGG - Intronic
1179641196 21:42748049-42748071 GGTATCTGCAAGGAAACAGCGGG + Intronic
1179650943 21:42808275-42808297 GGTCTCTACATAAAACTGGCTGG + Intergenic
1179897791 21:44372332-44372354 CGTCTCTACAAAAAATTAGCCGG + Intronic
1180009169 21:45038521-45038543 CGTCTCTACTAAAAATTAGCCGG + Intergenic
1180925630 22:19552492-19552514 CATCTCTACAAAAAATTAGCTGG - Intergenic
1180963284 22:19772465-19772487 TGTCTCTACAAAATATTAGCAGG - Intronic
1180969908 22:19809935-19809957 CATCTCTGCAAAAAGTTAGCTGG - Intronic
1181687396 22:24538940-24538962 TGCCTCTACAAAAAATTAGCCGG - Intergenic
1181688533 22:24545270-24545292 GGTCTTTGAAACAAAATAGCTGG + Intronic
1181717366 22:24741341-24741363 TGTCTCTACTAAAAATTAGCCGG + Intronic
1181852180 22:25757424-25757446 CATCTCTACAAAAAATTAGCGGG + Intronic
1181970781 22:26688260-26688282 CGTCTCTACAAAAAATTAGCCGG + Intergenic
1182274764 22:29180517-29180539 CATCTCTACAAAAAATTAGCTGG + Intergenic
1182329408 22:29540108-29540130 CGTCTCTACTAAAAATTAGCTGG + Intronic
1182365221 22:29774270-29774292 CGTCTCTGCAAAAAATTAGCTGG - Intergenic
1182384188 22:29922186-29922208 CGTCTCTACTAAAAATTAGCTGG - Intronic
1182536102 22:31004202-31004224 TGTCTCTGCAAAAAATTAGCTGG + Intergenic
1182659716 22:31916699-31916721 TGTCTCTACAAAAAATTAGTGGG - Intergenic
1182760223 22:32716690-32716712 TGTCTCCACAAAAAATTAGCCGG - Intronic
1182794422 22:32980441-32980463 GGTCTCTGCTAAAACATAAAAGG + Intronic
1182865701 22:33602535-33602557 TGTCTCTACAAAAAACTAGCTGG - Intronic
1183190825 22:36321112-36321134 TGTCTCTACTAAAAATTAGCTGG - Intronic
1183578008 22:38704465-38704487 TGTCTCTACCAAAAATTAGCTGG - Intergenic
1183737544 22:39652163-39652185 CGTCTCTACTAAAAATTAGCTGG - Intronic
1184124072 22:42474553-42474575 TGTCTCTACAAAAAATTAGCTGG - Intergenic
1184163803 22:42715550-42715572 CTTCTTTGCAAAAAATTAGCAGG + Intronic
1184423223 22:44393846-44393868 CGTCTCTACTAAAAATTAGCTGG + Intergenic
1184456403 22:44612681-44612703 CGTCTCTACTAAAAATTAGCTGG - Intergenic
1184496255 22:44843657-44843679 TGTCTCTACAAAAAATTAACTGG + Intronic
1184535451 22:45083491-45083513 CGTCTCTACTAAAAATTAGCCGG + Intergenic
1184893751 22:47395009-47395031 GGGCTCTGCAGAAAAGCAGCTGG + Intergenic
949351108 3:3126063-3126085 CGTCTCTACTAAAAATTAGCCGG + Intronic
950015658 3:9753180-9753202 GCTCTCTGCTAAAAATTAGCTGG + Intronic
950288487 3:11764163-11764185 TGTCTCTACAAAAAATTAGCCGG - Intergenic
950728676 3:14937010-14937032 AATCTCTACAACAAAATAGCTGG - Intergenic
951157085 3:19368680-19368702 AGTATCTGCAATATAATAGCTGG + Intronic
952161544 3:30698617-30698639 TGTCTCTGGAATAAAACAGCTGG + Intergenic
952275483 3:31871699-31871721 TGTTTCTACAAAAAATTAGCCGG + Intronic
952289789 3:32003942-32003964 TTTCTCTGCAAAACAACAGCTGG + Intronic
952418304 3:33109164-33109186 CATCTCTACAAAAAATTAGCAGG - Intergenic
952509310 3:34037688-34037710 CTTCTCTACAAAAAATTAGCTGG - Intergenic
952788510 3:37178622-37178644 TGTCTCTACAGAAAATTAGCTGG + Intronic
953074681 3:39557718-39557740 TATCTCTACAAAAAATTAGCAGG - Intergenic
953199391 3:40765300-40765322 GTTCTCTGCAAGATAAGAGCTGG - Intergenic
953306816 3:41839176-41839198 CGTCTCTACTAAAAATTAGCTGG + Intronic
953514854 3:43579981-43580003 CGTCTTTACAAAAAATTAGCTGG + Intronic
953594592 3:44298292-44298314 CATCTCTACAAAAAATTAGCTGG + Intronic
954011642 3:47645113-47645135 TGTCTCTACAAAAAATTAGCTGG + Intronic
954090566 3:48280470-48280492 CGTCTCTACTAAAAATTAGCTGG + Intronic
954098777 3:48353345-48353367 CATCTCTGCTAAAAATTAGCTGG + Intergenic
954116845 3:48471410-48471432 CGTCTCTACTAAAAATTAGCCGG + Intronic
954178134 3:48860441-48860463 TGTCTCTACCAAAAATTAGCCGG + Intronic
954204185 3:49045759-49045781 CATCTCTACAAAAAATTAGCTGG - Intronic
954373000 3:50178991-50179013 GGTCTCTACTAAAAATTAGCTGG - Intronic
954694242 3:52412044-52412066 TGTCTCTACAAAAAATTAGCTGG + Intronic
954937869 3:54343451-54343473 CATCTCTACAAAAAATTAGCTGG - Intronic
954951665 3:54480172-54480194 TGTCTCTACAAAAAAAAAGAAGG + Intronic
955309924 3:57875351-57875373 CATCTCTACAAAAAATTAGCTGG + Intronic
955641616 3:61091776-61091798 AGTCTCTACAAAAATTTAGCTGG + Intronic
956174246 3:66458275-66458297 TGTCTCTACAAAAAATTAGCTGG - Intronic
957229236 3:77490259-77490281 CGTCTCTACTAAAAATTAGCTGG - Intronic
957619589 3:82578078-82578100 CATCTCTACAAAAAATTAGCCGG + Intergenic
957982911 3:87534769-87534791 GCTCTCTAGAAAAATATAGCAGG + Intergenic
958171595 3:89946490-89946512 GGTCTCTGCAATAAAATGAAGGG - Intergenic
958263872 3:91414416-91414438 TGTCTCTACAAAAAATTAGCAGG - Intergenic
958984724 3:100767107-100767129 TGTCTCTACAAAAAATTAGCTGG - Intronic
959072106 3:101712236-101712258 CGTCTCTACAAAAAATTAGCCGG + Intergenic
959669363 3:108957717-108957739 TGTCTCAGCAAACAAATTGCTGG - Intergenic
959738886 3:109693199-109693221 GGTCTTTGCAAAAAAGAAGAGGG - Intergenic
960094799 3:113678914-113678936 CATCTCTACAAAAAATTAGCCGG - Intronic
960670658 3:120152712-120152734 TGTATCTACAAAAAATTAGCTGG - Intergenic
961132860 3:124484932-124484954 CGTCTCTACAAAAAATTAGCTGG + Intronic
961161583 3:124731058-124731080 CGTCTCTACAAAAAATTAGCTGG + Intronic
961218598 3:125182015-125182037 TGTCTCTACAAAAAAATACAAGG + Intronic
961299038 3:125910181-125910203 TGTCTCTACAATAAATTAGCTGG + Intergenic
961726043 3:128931335-128931357 CGTCTCTACAGAAAATTAGCTGG - Intronic
961746170 3:129064759-129064781 TGTCTCTACCAAAAATTAGCTGG - Intergenic
961832353 3:129630084-129630106 CATCTCTACAAAAAATTAGCCGG + Intergenic
961861971 3:129924525-129924547 CGTCTCTATAAAAAATTAGCTGG - Intergenic
961866866 3:129959760-129959782 TGTCTCTACAAAAAATTAGCTGG - Intergenic
962539034 3:136359689-136359711 GATCTCTGCTAAAAATTAGATGG - Intronic
963014727 3:140811362-140811384 AGCCTCTACAAAAAATTAGCTGG + Intergenic
963153178 3:142068726-142068748 TGTCTCTACGAAAAATTAGCTGG - Intronic
964219977 3:154331978-154332000 CGTCTCTACCAAAAATTAGCTGG + Intergenic
964797596 3:160516608-160516630 TGTCTCTACAAAATATTAGCTGG + Intronic
965552873 3:169987255-169987277 CGTTTCTACAAAAAATTAGCCGG + Intronic
965558315 3:170038776-170038798 GGCCTCGGAAAACAAATAGCCGG - Intronic
965558641 3:170041461-170041483 CGTCTCTACTAAAAATTAGCCGG - Intronic
966158836 3:176947108-176947130 CATCTCTACAAAAAATTAGCTGG + Intergenic
966619912 3:181952695-181952717 TGTCTCTACTAAAAATTAGCCGG - Intergenic
966803980 3:183791329-183791351 AGACCCTCCAAAAAAATAGCTGG - Intronic
967900457 3:194445226-194445248 GGTTTCTTCAACAAAATAACTGG + Intronic
968082494 3:195856376-195856398 TGTCTCTACAAAAAATTAGCCGG + Intergenic
968143930 3:196281857-196281879 CATCTCTACAAAAAATTAGCTGG - Intronic
968146869 3:196306708-196306730 CGTCTCTACTAAAAATTAGCCGG - Intronic
968221084 3:196940912-196940934 TGTCTCTACAAAAAATTAGCTGG + Intronic
968528266 4:1075830-1075852 CATCTCTACAAAAAATTAGCTGG - Intronic
968543715 4:1184136-1184158 GGTCTCTACGAAAAATTAGCTGG - Intronic
968706166 4:2079089-2079111 TGTCTCTACAAAATAAAAGCTGG - Intronic
968722965 4:2221294-2221316 TATCTCTGCAAAAAATTAGTGGG - Intronic
968806494 4:2776407-2776429 TGTCTTTACAAAAAATTAGCCGG - Intergenic
969601453 4:8178928-8178950 TGTCTCTACGAAAAATTAGCCGG - Intergenic
969815725 4:9685981-9686003 TGTCTCTACAAAAAATTAGCTGG + Intergenic
969887021 4:10223896-10223918 GCTTTCTGCAAAGAAATACCTGG + Intergenic
970149619 4:13075385-13075407 CGTCTCTACAAAAAATTAGCTGG - Intergenic
970930635 4:21507424-21507446 TGTCTCTACTAAAAATTAGCTGG - Intronic
971754576 4:30690745-30690767 TGTCTCTACAAAGAATTAGCTGG + Intergenic
971958402 4:33453648-33453670 GGTCTCTGCACAAGAAGAGTGGG - Intergenic
972723027 4:41719854-41719876 GGTCTCTCCAGAAGGATAGCTGG + Intergenic
972886317 4:43493637-43493659 AGTCTCTACTAAAAATTAGCTGG + Intergenic
972986429 4:44771735-44771757 GGTCTCTCTAAAATAATAGTTGG + Intergenic
972998944 4:44921210-44921232 GGTCTCAGCAAATAAATATAGGG - Intergenic
973793718 4:54402324-54402346 TGTCTCTACAAAAAATTAGCCGG + Intergenic
974071017 4:57123717-57123739 GGTCTCTACAAAAAATTAGCTGG - Intergenic
974581800 4:63813527-63813549 GGTTTCTGAAATAAAATAGGTGG - Intergenic
975964428 4:79953165-79953187 TTTCTCATCAAAAAAATAGCTGG + Intronic
976005023 4:80419594-80419616 GGTCTCTGTAAAATAATAATTGG - Intronic
976430055 4:84952290-84952312 GGTCTCTGCGGAAAAAGAGGTGG + Intronic
977126726 4:93178555-93178577 TCTCTCTGCAGAAAATTAGCTGG - Intronic
977586099 4:98777233-98777255 CATCTCTACAAAAAATTAGCTGG + Intergenic
978029474 4:103921890-103921912 CATCTCTACAAAAAATTAGCTGG + Intergenic
978370531 4:108025716-108025738 CCTCTCTACAGAAAAATAGCTGG + Intronic
978448706 4:108805659-108805681 CGTCTCTGCTAAAAATTAGCTGG + Intergenic
978790931 4:112662984-112663006 CATCTCTACAAAAAATTAGCTGG - Intergenic
979463285 4:121007222-121007244 CGTCTCTCCAAAAAATTAACTGG + Intergenic
979962182 4:127034312-127034334 GGTCTCTGCAAACAAAAAGCAGG + Intergenic
981166500 4:141565194-141565216 CGTCTCTACCAAAAATTAGCTGG + Intergenic
982053201 4:151524138-151524160 TGTCTCTACAAAAAATTAGCTGG + Intronic
982185866 4:152798086-152798108 TGTCTCTACAAAAAATTAGCTGG + Intronic
982457901 4:155631924-155631946 CGTCTCTACTAAAAATTAGCTGG - Intergenic
983094004 4:163540850-163540872 TGTCCCTACAAAAAATTAGCTGG + Intronic
983246176 4:165290302-165290324 CATCTCTACAAAAAATTAGCTGG - Intronic
983443346 4:167816009-167816031 TGTCTCTACAAAAAATTAGCTGG + Intergenic
983723925 4:170894134-170894156 TGTCTCTGCCAAAACATAACAGG + Intergenic
984020429 4:174478461-174478483 TGTCTCTACTAAAAATTAGCTGG + Intergenic
984313963 4:178102363-178102385 CATCTCTACAAAAAATTAGCTGG + Intergenic
984358474 4:178696374-178696396 CATCTCTACAAAAAATTAGCTGG + Intergenic
986049531 5:4076115-4076137 CATCTCTACAAAAAATTAGCTGG + Intergenic
986104401 5:4645914-4645936 CGTCTCTCCAAAAAATTAGCTGG - Intergenic
986763006 5:10897143-10897165 TGTCTCTACCAAAAATTAGCTGG + Intergenic
986815434 5:11404777-11404799 CATCTCTACAAAAAATTAGCCGG - Intronic
986822319 5:11481439-11481461 TGTCTCTACAAAAAATTAGCCGG + Intronic
987309585 5:16669373-16669395 CATCTCTGCAAAAAATTAGCTGG - Intronic
988238568 5:28577606-28577628 GGTCTCTGCAAGACAAAAGATGG - Intergenic
988301147 5:29429153-29429175 TGTCTCTACAAAAAATTAGTGGG + Intergenic
988448319 5:31312527-31312549 TGTCTCTACAAAAAATTAGCAGG + Intronic
988569792 5:32352879-32352901 CATCTCTACAAAAAAAGAGCTGG + Intergenic
988570368 5:32359023-32359045 TGTCTCTACAAATAATTAGCTGG + Intronic
988683378 5:33504074-33504096 AGTCACTCCAAAAAAATATCAGG + Intergenic
988867901 5:35355320-35355342 CATCTCTACAAAAAATTAGCCGG - Intergenic
990087774 5:51999953-51999975 CGTCTCTACAAAAAATTAGCCGG + Intergenic
990438309 5:55817627-55817649 CGTCTCTACTAAAAATTAGCTGG - Intergenic
991683421 5:69160626-69160648 CGTCTCTACTAAAAATTAGCCGG + Intergenic
991684685 5:69170785-69170807 CATCTCTACAAAAAATTAGCTGG - Intronic
992301895 5:75391124-75391146 TGTCTCTACAAAAAATTAACTGG - Intronic
992385143 5:76277602-76277624 CGTCTCTACAAAAAGTTAGCCGG + Intronic
992517338 5:77508280-77508302 TGTCGCTACAAAAAATTAGCTGG - Intronic
992560058 5:77942676-77942698 CGTCTCTACAAAAAATCAGCAGG + Intergenic
992705832 5:79391297-79391319 TGTCTCTACAAAAAATTAGCCGG - Intronic
992711852 5:79466343-79466365 CATCTCTACAAAAAATTAGCCGG + Intronic
992799482 5:80282601-80282623 CCTCTCTACAAAAAATTAGCTGG + Intergenic
992805613 5:80334526-80334548 CATCTCTACAAAAAATTAGCTGG + Intergenic
992858527 5:80889163-80889185 CGTTTCTACAAAAAATTAGCTGG + Intergenic
993807290 5:92426771-92426793 GGTCTCTACAAAAAATTAGCTGG - Intergenic
994086714 5:95767047-95767069 TGTCTCTACAAAAAATCAGCTGG + Intronic
994438930 5:99776765-99776787 TGTTTGTGCAAAACAATAGCTGG + Intergenic
994514191 5:100749948-100749970 GGTCTCAGCATGAAAATATCTGG + Intergenic
994621493 5:102168531-102168553 CATCTCTACAAAAAATTAGCTGG + Intergenic
994852339 5:105071795-105071817 CGTCTCTACAAAAAACTAGCCGG - Intergenic
995093144 5:108204350-108204372 CATCTCTACAAAAAATTAGCTGG - Intronic
995131806 5:108638583-108638605 TGTCTCTACAAAAAAATAAAAGG + Intergenic
995504767 5:112848751-112848773 CGTCTCTACAAAAAATTAGCTGG + Intronic
995873887 5:116770166-116770188 CATCTCTACAAAAAATTAGCTGG + Intergenic
996153164 5:120064728-120064750 CGTCTCTACTAAAAATTAGCTGG - Intergenic
996375951 5:122807114-122807136 TGTCTCTACAAAAAATTAGCTGG + Intronic
996735826 5:126757108-126757130 TGTCTCTACGAAAAAATAGCTGG + Intergenic
996812383 5:127531782-127531804 CGTCTCTACCAAAAATTAGCTGG - Intronic
996893672 5:128454719-128454741 GGTTTCTGCAAAACAAATGCTGG - Intronic
997144796 5:131421219-131421241 CATCTCTACAAAAAATTAGCTGG - Intergenic
997262017 5:132472564-132472586 TGTCTCTACAAAAAATTAGCTGG + Intronic
997291714 5:132741245-132741267 GATATCTGCAAAAAGACAGCTGG + Intergenic
997500340 5:134368866-134368888 CATCTCTACAAAAAATTAGCCGG + Intronic
997613775 5:135232592-135232614 CTTCTCTACAAAAAATTAGCTGG + Intronic
997943984 5:138183006-138183028 GGGCTCTGCCAAAAAATAGTAGG + Intronic
997967634 5:138371949-138371971 CGTCTCTACAAAAAATAAGCCGG + Intronic
997994133 5:138572116-138572138 TGTCTCTACAAAAAATTAGCCGG - Intronic
998126332 5:139625059-139625081 TGTCTCTGCAAAAAAAAAAGTGG - Intronic
998459988 5:142302765-142302787 TGTCTCTACTAAAAATTAGCTGG + Intergenic
998831773 5:146167563-146167585 CATCTCTACAAAAAATTAGCCGG - Intronic
998832331 5:146173176-146173198 TGTCTCTACTAAAAACTAGCCGG + Intronic
998854683 5:146382931-146382953 CGTCTCTACTAAAAATTAGCTGG + Intergenic
999307666 5:150530727-150530749 GGGCTCTACAAAAAACTAGCTGG - Intronic
999464367 5:151788083-151788105 TGTCTCTACAAAAAATTAGCTGG - Intronic
999547012 5:152640754-152640776 CATCTCTGCAAAAAATTAGCTGG + Intergenic
999785955 5:154890923-154890945 CGTCTCTACTAAAAATTAGCTGG - Intronic
999870186 5:155741852-155741874 TGTCTCTACCAAAAATTAGCTGG - Intergenic
999985103 5:156996029-156996051 CATCTCTACAAAAAATTAGCTGG + Intergenic
1000081359 5:157850447-157850469 TATCTCTACAAAAAATTAGCCGG + Intronic
1000187181 5:158870512-158870534 CATCTCTACAAAAAATTAGCTGG + Intronic
1000246981 5:159456635-159456657 ACTATCTGCAAAAAAAAAGCTGG + Intergenic
1000729077 5:164808755-164808777 TGTCTCTACTAAAAATTAGCCGG - Intergenic
1001079627 5:168657842-168657864 TGTCTCTACAAAAAATTAGCTGG + Intergenic
1001218524 5:169878534-169878556 TTTCTCTGCAAAGAAAGAGCAGG - Intronic
1002032068 5:176437587-176437609 TGTCTCTACTAAAAACTAGCCGG + Intergenic
1002138892 5:177126564-177126586 CATCTCTACAAAAAATTAGCTGG - Intergenic
1002166940 5:177353687-177353709 TGTCTCTACAAAAAATTAGCTGG + Intergenic
1002525074 5:179811069-179811091 CGTCTCTACTAAAAATTAGCCGG + Intronic
1003204544 6:3995068-3995090 TGCCTCTACAAAAAATTAGCTGG + Intergenic
1003341566 6:5226544-5226566 TGTCTCTACTAAAAATTAGCCGG - Intronic
1003536035 6:6976250-6976272 CAACTCTGCAAAAAATTAGCTGG + Intergenic
1003859423 6:10308546-10308568 CGTCTCTACTAAAAATTAGCTGG - Intergenic
1003941822 6:11036282-11036304 TTTCTCTGTTAAAAAATAGCAGG - Intronic
1003944165 6:11058357-11058379 CATCTCTACAAAAAATTAGCTGG - Intergenic
1004204628 6:13580828-13580850 CATCTCTACAAAAAAGTAGCTGG - Intronic
1004218045 6:13720386-13720408 CGTCTCTACTAAAAATTAGCCGG + Intergenic
1005299592 6:24457709-24457731 CGTCTCTACTAAAAATTAGCTGG + Intronic
1006507910 6:34502322-34502344 GGTCTCTCCAGCACAATAGCTGG - Intronic
1006540158 6:34733358-34733380 CGTCTCTAAAAAAAAAAAGCTGG + Intergenic
1006769852 6:36543801-36543823 CGTCTCTACTAAAAACTAGCTGG - Intronic
1007515658 6:42409115-42409137 TGTCTCTACAAAAAATTAGCTGG + Intronic
1007607013 6:43124512-43124534 TGTCTCTATAAAAAACTAGCTGG + Intronic
1007779521 6:44244897-44244919 CGTCTCTACTAAAAATTAGCTGG - Intergenic
1008522385 6:52374573-52374595 AGACCCTGCAAAAAATTAGCTGG - Intronic
1008881246 6:56382690-56382712 GGTCACTGCAAAAAAACAGCTGG + Intronic
1008991559 6:57608561-57608583 TGTCTCTACAAAAAATTAGCAGG + Intronic
1009004388 6:57764996-57765018 TGTCTCTACAAAAAATTAGCGGG + Intergenic
1009180078 6:60506797-60506819 TGTCTCTACAAAAAATTAGCAGG + Intergenic
1009473479 6:64057991-64058013 CGTCTCTACGAAAAATTAGCTGG - Intronic
1009919409 6:70038893-70038915 TGTCTCTACTAAAAATTAGCTGG + Intronic
1009989678 6:70826592-70826614 CATCTCTACAAAAAATTAGCTGG + Intronic
1010687912 6:78873638-78873660 CGTCTCTATAAAAAATTAGCTGG - Intronic
1010692762 6:78930095-78930117 TGTCTCTACAAAAAATTAGCTGG - Intronic
1011040672 6:83026851-83026873 GGTCTCTACAAAAAATTAACTGG - Intronic
1011609060 6:89132674-89132696 TGTCTCTACCAAAAATTAGCTGG + Intergenic
1011726437 6:90214922-90214944 TGTCTCTACAAAAAATTATCTGG - Intronic
1012225533 6:96699514-96699536 CATCTCTACAAAAAATTAGCTGG - Intergenic
1012444617 6:99295147-99295169 GGTGCCTGCAAAAATATAGGTGG + Intronic
1012453318 6:99376799-99376821 TGTCTCTACTAAAAATTAGCTGG + Intronic
1012455973 6:99405724-99405746 TGTCTCTACAAAAAATTAGCCGG - Intronic
1012595482 6:101032885-101032907 GCTCTCAGCAAAAAAAAAGAGGG - Intergenic
1012894879 6:104936985-104937007 GCTCTCTACAAAAAATTCGCTGG - Intergenic
1012894926 6:104937293-104937315 CGTCTCTACAAAATACTAGCTGG - Intergenic
1012927303 6:105280730-105280752 TGTCTCTACAAATAATTAGCTGG - Intronic
1013524897 6:110964801-110964823 CGTCTCTACTAAAAATTAGCCGG - Intronic
1013532021 6:111029039-111029061 TGTCTCTACTAAAAATTAGCTGG - Intergenic
1014541161 6:122678067-122678089 CGTCTCTACAAAAAATTAGCCGG - Intronic
1015598629 6:134890951-134890973 TGTCTCTACTAAAAATTAGCTGG + Intergenic
1016268312 6:142257837-142257859 TGTCTCTGCTAAAAATTAGCGGG + Intergenic
1016324875 6:142889299-142889321 TGTCTCTACAAAATATTAGCTGG + Intronic
1016504318 6:144761483-144761505 CATCTCTACAAAAAATTAGCTGG + Intronic
1016637825 6:146315178-146315200 TGTCTCTCCAAAAAGTTAGCTGG + Intronic
1016825277 6:148382604-148382626 TGTCTAAGGAAAAAAATAGCAGG - Intronic
1017179207 6:151534224-151534246 CATCTCTACAAAAAATTAGCTGG - Intronic
1017347255 6:153398454-153398476 CATCTCTACAAAAAATTAGCTGG + Intergenic
1017393818 6:153973086-153973108 GGTCTTTGCAAAAAAAAAAAAGG + Intergenic
1017560153 6:155618386-155618408 CATCTCTACAAAAAATTAGCCGG + Intergenic
1017578737 6:155836685-155836707 TGTCTCTACCAAAAATTAGCCGG + Intergenic
1017831357 6:158133135-158133157 CATCTCTACAAAAAATTAGCTGG + Intronic
1018197375 6:161367150-161367172 CGTCTCTACTAAAAATTAGCCGG - Intronic
1018210321 6:161475064-161475086 TGTCTCTACTAAAAATTAGCTGG - Intronic
1018401291 6:163423124-163423146 TGTCTCTGCTAAAAATTAGCCGG + Intronic
1018627759 6:165796255-165796277 CATCTCTACAAAAAATTAGCTGG - Intronic
1018920607 6:168169827-168169849 GGATTCTGCAGAAAAATCGCAGG - Intergenic
1019556974 7:1636932-1636954 TATCTCTACAAAAAATTAGCTGG + Intergenic
1019692004 7:2420635-2420657 CATCTCTACAAAAAATTAGCTGG + Intronic
1019726233 7:2604278-2604300 CGTCTCTACAGAAAATTAGCTGG - Intronic
1019766264 7:2853262-2853284 GGTCTCTCCAAAAGAGTAGCTGG - Intergenic
1020126857 7:5537861-5537883 TGTCTCTACAAAACATTAGCTGG - Intronic
1020170542 7:5841381-5841403 CGTCTCTACTAAAAATTAGCTGG + Intergenic
1020248724 7:6450319-6450341 CGTCTCTCCTAAAAATTAGCTGG + Intronic
1020248849 7:6451034-6451056 CGTCTCTCCTAAAAATTAGCTGG + Intronic
1020453343 7:8345191-8345213 CATCTCTACAAAAAATTAGCTGG - Intergenic
1020577874 7:9957037-9957059 TGTCTCTGCATAAACATAACTGG + Intergenic
1021380395 7:19959233-19959255 CGTCTCTACTAAAAATTAGCCGG + Intergenic
1022602182 7:31771882-31771904 CGTCTCTACAAAAAATTAGCTGG + Intronic
1022728471 7:33001371-33001393 CGTCTCTACAAAAAATTAGCTGG + Intronic
1023126819 7:36962476-36962498 GGTCACTACAGAAAAATACCAGG + Intronic
1023198657 7:37669323-37669345 TATCTCTACAAAAAATTAGCCGG + Intergenic
1023235210 7:38078898-38078920 CTTCTCTACAAAAAATTAGCTGG - Intergenic
1023532611 7:41174040-41174062 TGTCTCTACTAAAAATTAGCCGG + Intergenic
1023915168 7:44582959-44582981 CGTCTCTACAAAAAATTAACCGG + Intergenic
1025937535 7:66049219-66049241 TGTCTCTACCAAAAATTAGCTGG - Intergenic
1026189696 7:68113478-68113500 GCTCTCTAATAAAAAATAGCTGG - Intergenic
1026246046 7:68620669-68620691 CGTCTCTACTAAAAATTAGCCGG + Intergenic
1026347134 7:69483764-69483786 CGTCTCTTCAAAAAATTAACTGG + Intergenic
1026359435 7:69590239-69590261 TGTCTCTTAAAAAAAATAGCTGG + Intergenic
1026657968 7:72273678-72273700 TGTCTCTACAAAAAATTAGCTGG - Intronic
1026775586 7:73229200-73229222 TGTCTTTACAAAAAATTAGCCGG + Intergenic
1026880227 7:73903045-73903067 TGTCTCTACAAAAAATTAGCCGG - Intergenic
1026989826 7:74578345-74578367 CGTCTCTACAAAAAATTAGCTGG - Intronic
1027016443 7:74782572-74782594 TGTCTTTACAAAAAATTAGCCGG + Intronic
1027071585 7:75163364-75163386 TGTCTTTACAAAAAATTAGCCGG - Intergenic
1027253772 7:76416635-76416657 TGTCTCTACAAAAAAATAGCTGG + Intronic
1027645369 7:80790734-80790756 GGGCTGTGAAGAAAAATAGCAGG - Intronic
1028022908 7:85799421-85799443 GGTCTCTTCAAAAAATATGCTGG + Intergenic
1028545386 7:91993348-91993370 TGTCTCTACAAAAAATTAGCTGG - Intronic
1029067101 7:97861181-97861203 CGTCTCTACTAAAAATTAGCCGG - Intronic
1029336792 7:99907277-99907299 CGTCTCTACTAAAAATTAGCTGG - Intronic
1029360318 7:100083625-100083647 TGTCTCTACAAAAAAGTAGCCGG - Intergenic
1029568028 7:101351946-101351968 AGTCTCTACAAAAAATTAGCTGG + Intergenic
1029657744 7:101938272-101938294 TGTCTCTGCAAAAAATTAGCTGG - Intronic
1029936010 7:104424818-104424840 TGTCTCTACAAAAAATTAGCCGG + Intronic
1030006926 7:105129121-105129143 CGTCTCTACAAAAAATTAGCCGG - Intronic
1030035349 7:105404023-105404045 CATCTCTACAAAAAATTAGCTGG - Intergenic
1030529735 7:110697631-110697653 TGTCTCTACAAAAAATTAGCTGG + Intronic
1030825809 7:114156218-114156240 TGTCTCTGTAAAAAAATAACTGG - Intronic
1031003272 7:116442610-116442632 AGTCTCTGCTAAAAAATAGCTGG - Intronic
1031774929 7:125896300-125896322 TGTCTCTACAAAAAATTAGAAGG - Intergenic
1032097149 7:128945272-128945294 TGTCTTTACAAAAAATTAGCTGG - Intronic
1032141093 7:129330630-129330652 CGTCTCTACTAAAAATTAGCCGG - Intronic
1032284316 7:130529310-130529332 GGTCTCTGGAAAATAACAGTAGG + Intronic
1032412465 7:131706999-131707021 CGTCTCTACAAAAACTTAGCTGG - Intergenic
1032714415 7:134493014-134493036 CATCTCTGCAAAAAATTAGTTGG - Intergenic
1032719629 7:134540054-134540076 CGTCTCTACCAAAAATTAGCTGG + Intronic
1033241707 7:139685330-139685352 TGTCTGTACAAAAAATTAGCTGG - Intronic
1033304304 7:140213136-140213158 CATCTCTACAAAAAATTAGCTGG + Intergenic
1033488413 7:141814943-141814965 AGTCTCTGCTAATAAATAGTTGG - Intergenic
1033579153 7:142715883-142715905 GCTCTCTGCACAAAAACAGAGGG + Intergenic
1033735723 7:144219637-144219659 CATCTCTACAAAAAATTAGCTGG - Intergenic
1033747328 7:144331316-144331338 CATCTCTACAAAAAATTAGCTGG + Intergenic
1033964164 7:146953093-146953115 GGTCTCAGCAAGACAATATCTGG + Intronic
1034429072 7:151031790-151031812 TGTCTCTACTAAAAATTAGCTGG - Intronic
1034512197 7:151545093-151545115 CATCTCTACAAAAAATTAGCTGG + Intergenic
1035001224 7:155613643-155613665 TGTCTCTACAAAAAATTAGTTGG + Intronic
1035870895 8:3135083-3135105 TGTCTCTACAAAAAATTAGCTGG - Intronic
1036666343 8:10744780-10744802 TGTCTCTACAAAAAATTAGCTGG + Intronic
1036717139 8:11136340-11136362 TGTCTCTACTAAAAATTAGCTGG + Intronic
1037944343 8:22977408-22977430 CGTCTCTACAAAACATTAGCTGG + Intronic
1037989206 8:23308578-23308600 GGTCTGAGCAAAAAAATCCCTGG + Intronic
1038183714 8:25252991-25253013 CGTCTCTACTAAAAATTAGCTGG - Intronic
1038494015 8:27989295-27989317 CATCTCTGCAAAAAATTAGCTGG - Intronic
1038572396 8:28674239-28674261 TGTCTCTAAAAAAAAAAAGCTGG - Intronic
1038768891 8:30457745-30457767 CGTCTCTACTAAAAATTAGCTGG - Intronic
1039031158 8:33311088-33311110 GGTTTCTGCAAAGAAAAACCAGG - Intergenic
1039515222 8:38127003-38127025 TGTCTCTTCAAACAATTAGCTGG + Intronic
1039624773 8:39037585-39037607 TGTCTCTACAAAAAATAAGCTGG - Intronic
1039959654 8:42236593-42236615 CGTCTCTACTAAAAATTAGCCGG + Intergenic
1040034768 8:42859463-42859485 AGTCTCTATAAAAAATTAGCCGG + Intronic
1040697285 8:50015820-50015842 ATTCTCTGCAAAAAAATGGTTGG + Intronic
1040931457 8:52739295-52739317 CGTCTCTACTAAAAATTAGCTGG + Intronic
1041032157 8:53747994-53748016 CGTCTCTACTAAAAATTAGCTGG + Intronic
1041087530 8:54270722-54270744 CATCTCTACAAAAAATTAGCTGG + Intergenic
1042207410 8:66343277-66343299 TGTCTCTACAAAAACCTAGCTGG + Intergenic
1042863408 8:73335665-73335687 TGACTCTACTAAAAAATAGCTGG - Intergenic
1044087793 8:87962173-87962195 TGTATCTACAAAAAATTAGCAGG - Intergenic
1044108044 8:88236584-88236606 CGTCTCTACAAAAAATTAGTGGG + Intronic
1044689850 8:94866452-94866474 CATCTCTACAAAAAATTAGCTGG - Intronic
1044747584 8:95385625-95385647 CATCTCTACAAAAAATTAGCTGG - Intergenic
1044861396 8:96527043-96527065 GGTCAATGCCAAAAATTAGCAGG - Intronic
1044939542 8:97326860-97326882 CATCTCTACAAAAAATTAGCTGG - Intergenic
1044976101 8:97667152-97667174 CGTCTCTACAAAAAATTAGCTGG - Intronic
1045087752 8:98705249-98705271 TGTCTCTACAAAAAATTAGTTGG + Intronic
1045135307 8:99210765-99210787 CATCTCTACAAAAAATTAGCTGG - Intronic
1045139601 8:99266247-99266269 TGTCTCTACAAAAAAAAAACAGG + Intronic
1045204781 8:100027057-100027079 TGTCTCTACAAAACATTAGCTGG + Intronic
1045902005 8:107293239-107293261 GGGGTCTGCAAAATAACAGCAGG - Intronic
1046452378 8:114411107-114411129 GGACTGTACAAAAAATTAGCTGG - Intergenic
1046913392 8:119653505-119653527 GGTGTCTTGGAAAAAATAGCAGG + Intronic
1047553210 8:125899267-125899289 GGACTCTGTAAATGAATAGCTGG + Intergenic
1047601017 8:126425943-126425965 GGTCCCTGGAAAAAGAGAGCAGG - Intergenic
1048637885 8:136318689-136318711 TTTTTCTACAAAAAAATAGCTGG - Intergenic
1048725109 8:137374546-137374568 CATCTCTACAAAAAATTAGCTGG - Intergenic
1049977198 9:871195-871217 CGTCTCTACAAAAAATTAGCCGG - Intronic
1050347021 9:4700315-4700337 TGTCTCTACAAAAAATTAGCTGG - Intronic
1051099586 9:13505721-13505743 TGTCTCTACAAAAAAAAAGAGGG + Intergenic
1051417086 9:16853246-16853268 CATCTCTACAAAAAACTAGCTGG + Intronic
1051424387 9:16918891-16918913 GGTGTCTACAAAAAATTAGCTGG + Intergenic
1051786092 9:20745267-20745289 TGCCTCTACAAAAAATTAGCAGG - Intronic
1052817971 9:33116391-33116413 TGTCTCTACTAAAAATTAGCTGG - Intronic
1054776170 9:69125466-69125488 CGTCTCTACTAAAAATTAGCTGG - Intronic
1055202511 9:73684244-73684266 GCTCTCAGCAAAAAAAGAGAGGG + Intergenic
1055323858 9:75108061-75108083 CGTCTCTACAAAAAATGAGCTGG + Intronic
1055593023 9:77838017-77838039 TGTCTCTACTAAAAATTAGCTGG - Intronic
1055711244 9:79064102-79064124 TGTTTCTGCCACAAAATAGCTGG - Intergenic
1056648023 9:88431877-88431899 CTTCTCTACAAAAAATTAGCTGG + Intronic
1056950910 9:91040009-91040031 GGTCCCTGCTCAGAAATAGCAGG + Intergenic
1057133656 9:92671652-92671674 TGTCTCTACAAAAAATTAGCAGG + Intergenic
1057390334 9:94637558-94637580 CGTCTCTACCAAAAATTAGCTGG - Intronic
1057792143 9:98131485-98131507 CATCTCTGCAAAAAATCAGCGGG - Intronic
1057808521 9:98239218-98239240 CATCTCTACAAAAAATTAGCTGG - Intronic
1058398248 9:104581238-104581260 CGTCTCTACAAAAAATTAGCTGG - Intergenic
1058403534 9:104644471-104644493 CGTCTCTACTAAAAATTAGCTGG + Intergenic
1058855592 9:109058773-109058795 CATCTCTACAAAAAATTAGCTGG - Intronic
1058886297 9:109323662-109323684 CATCTCTACAAAAAATTAGCCGG - Intergenic
1059458689 9:114415898-114415920 TGTTTCTGAAAAAAAAAAGCTGG + Intronic
1059511768 9:114855051-114855073 CATCTCTACAAAAAATTAGCTGG - Intergenic
1060038397 9:120278790-120278812 TGGCTCTACAAAAAATTAGCTGG + Intergenic
1060693364 9:125684841-125684863 TGTCTCTGCAAAAAATTAGCCGG - Intronic
1060693899 9:125689575-125689597 CATCTCTACAAAAAATTAGCTGG + Intronic
1061021983 9:128021877-128021899 CATCTCTACAAAAAATTAGCCGG - Intergenic
1061315237 9:129791454-129791476 CGTCTCTACTAAAAATTAGCTGG + Intergenic
1061691836 9:132339311-132339333 CATCTCTACAAAAAATTAGCTGG + Intronic
1185662948 X:1741523-1741545 CATCTCTACAAAAAATTAGCTGG + Intergenic
1185746641 X:2578616-2578638 GATGTCTGTAAAAAAAAAGCCGG - Intergenic
1185911507 X:3985194-3985216 CATCTCTACAAAAAATTAGCTGG - Intergenic
1185943246 X:4344827-4344849 TGTCTCTACAAAAAATTAGTTGG - Intergenic
1185952081 X:4448640-4448662 TGTCTCTACAAAAAATTAGCTGG - Intergenic
1186371781 X:8954418-8954440 TGTCTCTACAAAAAATTAGCTGG - Intergenic
1186405111 X:9294997-9295019 CATCTCTACAAAAAATTAGCTGG + Intergenic
1187071919 X:15897006-15897028 CGTCTCTACAAAAAATTAGTTGG + Intergenic
1187244407 X:17540908-17540930 CGTCTCTACAAAAAATTAGCTGG + Intronic
1187540850 X:20192760-20192782 CATCTCTACAAAAAATTAGCTGG - Intronic
1188187871 X:27137966-27137988 GGTCTTTGCAAAAAGACAGTAGG + Intergenic
1188259903 X:28010025-28010047 GGTCTGTTAAAAAAAATACCTGG + Intergenic
1188386481 X:29566108-29566130 CGTCTCTACAAAAAATTAGCCGG - Intronic
1188914176 X:35889815-35889837 CATCTCTACAAAAAATTAGCTGG - Intergenic
1189003462 X:36970282-36970304 GAGCTCTTCAAAATAATAGCAGG + Intergenic
1189528777 X:41856632-41856654 GGTCTCTGAAAAAAAGTAGCTGG + Intronic
1189699502 X:43702865-43702887 TGTCTCTGAAAAAAAAAATCAGG + Intronic
1189807810 X:44752848-44752870 CGTCTCTACAAAAAGTTAGCTGG + Intergenic
1189964711 X:46360949-46360971 TGTCTCTACTAAAAATTAGCTGG - Intergenic
1190051277 X:47151198-47151220 CGTCTCTACAAAAAATTAGCTGG - Intronic
1190091408 X:47440670-47440692 CGTCTCTACTAAAAATTAGCTGG - Intergenic
1190164618 X:48062776-48062798 TGTCTCTACAAAAAATTAGCCGG + Intronic
1190191159 X:48278340-48278362 CGTGTCTACAAAAAATTAGCTGG + Intergenic
1190306986 X:49089623-49089645 CATCTCTACAAAAAAGTAGCTGG + Intronic
1190777943 X:53569186-53569208 TGTCTCTACAGAAAATTAGCTGG - Intronic
1192159805 X:68776007-68776029 TGTCTTTACAAAAAATTAGCAGG + Intergenic
1192340685 X:70260973-70260995 TGTCTCTACAAAAAATTAGTCGG + Intergenic
1192411351 X:70935806-70935828 TACCTCTACAAAAAAATAGCTGG + Intergenic
1192470781 X:71396861-71396883 CGTCTCTACAAAAATTTAGCTGG + Intronic
1192541567 X:71977580-71977602 TGTCTCTACAAAAAATTAGCTGG - Intergenic
1193385544 X:80867092-80867114 TGTCTCTGAAAAAAATTAGTGGG - Intergenic
1193600115 X:83501211-83501233 GGGCTCTCCAAAAGAACAGCAGG + Intergenic
1193834611 X:86326303-86326325 CATCTCTACAAAAAATTAGCTGG + Intronic
1195196403 X:102501540-102501562 CGTCTCCACAAAAAATTAGCTGG - Intergenic
1196669427 X:118349717-118349739 CGTCTCTCCTAAAAATTAGCTGG - Intronic
1196845417 X:119893264-119893286 CGTCTCTACTAAAAAGTAGCTGG - Intergenic
1197061033 X:122181886-122181908 GATCTCTACAAAAAAGTAGCTGG - Intergenic
1197756657 X:130000205-130000227 CATCTCTACAAAAAATTAGCCGG - Intronic
1198119690 X:133579703-133579725 TGTCTCTACAAAAAATTAGCTGG - Intronic
1198477472 X:137009402-137009424 TGTCTCTACAAAAAATTAGCTGG + Intergenic
1198652202 X:138875068-138875090 CGTCTCTACTAAAAATTAGCTGG + Intronic
1199502109 X:148518265-148518287 GCTCTCTGGAAGAAAACAGCTGG - Intronic
1200641565 Y:5725103-5725125 CGTCTCTACTAAAAATTAGCTGG + Intronic
1201380986 Y:13378854-13378876 TGTCTCTACAAAAAATTAACTGG - Intronic
1201720805 Y:17094698-17094720 AGTCTCTACAAAAAATTAGCTGG + Intergenic
1201738771 Y:17301163-17301185 TGTCTCTACAAAAAATTAGCTGG - Intergenic
1201854306 Y:18524186-18524208 TGTCTCTACAAAAATGTAGCCGG + Intergenic
1201879015 Y:18796199-18796221 TGTCTCTACAAAAATGTAGCCGG - Intronic
1202604756 Y:26629294-26629316 TGTCTCTACAAAAAATTAGCTGG + Intergenic