ID: 1161762788

View in Genome Browser
Species Human (GRCh38)
Location 19:6186886-6186908
Sequence CCAATTTCACTGTGTTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11651
Summary {0: 1, 1: 2, 2: 43, 3: 959, 4: 10646}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161762785_1161762788 -1 Left 1161762785 19:6186864-6186886 CCGGCTATTTTTTTGCAGAGACC 0: 1
1: 0
2: 18
3: 230
4: 789
Right 1161762788 19:6186886-6186908 CCAATTTCACTGTGTTGCCCAGG 0: 1
1: 2
2: 43
3: 959
4: 10646
1161762783_1161762788 5 Left 1161762783 19:6186858-6186880 CCACACCCGGCTATTTTTTTGCA 0: 1
1: 159
2: 5602
3: 32129
4: 52663
Right 1161762788 19:6186886-6186908 CCAATTTCACTGTGTTGCCCAGG 0: 1
1: 2
2: 43
3: 959
4: 10646
1161762782_1161762788 8 Left 1161762782 19:6186855-6186877 CCACCACACCCGGCTATTTTTTT 0: 202
1: 9062
2: 60970
3: 161144
4: 215914
Right 1161762788 19:6186886-6186908 CCAATTTCACTGTGTTGCCCAGG 0: 1
1: 2
2: 43
3: 959
4: 10646
1161762784_1161762788 0 Left 1161762784 19:6186863-6186885 CCCGGCTATTTTTTTGCAGAGAC 0: 1
1: 11
2: 229
3: 736
4: 1421
Right 1161762788 19:6186886-6186908 CCAATTTCACTGTGTTGCCCAGG 0: 1
1: 2
2: 43
3: 959
4: 10646

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161762788 Original CRISPR CCAATTTCACTGTGTTGCCC AGG Intronic
Too many off-targets to display for this crispr