ID: 1161765239

View in Genome Browser
Species Human (GRCh38)
Location 19:6204063-6204085
Sequence CTTATGTAGGCTCTGGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161765239_1161765243 -7 Left 1161765239 19:6204063-6204085 CCAGCAGCCAGAGCCTACATAAG No data
Right 1161765243 19:6204079-6204101 ACATAAGTATCAGCCAATACGGG No data
1161765239_1161765242 -8 Left 1161765239 19:6204063-6204085 CCAGCAGCCAGAGCCTACATAAG No data
Right 1161765242 19:6204078-6204100 TACATAAGTATCAGCCAATACGG No data
1161765239_1161765245 -5 Left 1161765239 19:6204063-6204085 CCAGCAGCCAGAGCCTACATAAG No data
Right 1161765245 19:6204081-6204103 ATAAGTATCAGCCAATACGGGGG No data
1161765239_1161765244 -6 Left 1161765239 19:6204063-6204085 CCAGCAGCCAGAGCCTACATAAG No data
Right 1161765244 19:6204080-6204102 CATAAGTATCAGCCAATACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161765239 Original CRISPR CTTATGTAGGCTCTGGCTGC TGG (reversed) Intergenic
No off target data available for this crispr