ID: 1161765242

View in Genome Browser
Species Human (GRCh38)
Location 19:6204078-6204100
Sequence TACATAAGTATCAGCCAATA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161765239_1161765242 -8 Left 1161765239 19:6204063-6204085 CCAGCAGCCAGAGCCTACATAAG No data
Right 1161765242 19:6204078-6204100 TACATAAGTATCAGCCAATACGG No data
1161765238_1161765242 -7 Left 1161765238 19:6204062-6204084 CCCAGCAGCCAGAGCCTACATAA No data
Right 1161765242 19:6204078-6204100 TACATAAGTATCAGCCAATACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161765242 Original CRISPR TACATAAGTATCAGCCAATA CGG Intergenic
No off target data available for this crispr