ID: 1161765244

View in Genome Browser
Species Human (GRCh38)
Location 19:6204080-6204102
Sequence CATAAGTATCAGCCAATACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161765239_1161765244 -6 Left 1161765239 19:6204063-6204085 CCAGCAGCCAGAGCCTACATAAG No data
Right 1161765244 19:6204080-6204102 CATAAGTATCAGCCAATACGGGG No data
1161765238_1161765244 -5 Left 1161765238 19:6204062-6204084 CCCAGCAGCCAGAGCCTACATAA No data
Right 1161765244 19:6204080-6204102 CATAAGTATCAGCCAATACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161765244 Original CRISPR CATAAGTATCAGCCAATACG GGG Intergenic
No off target data available for this crispr