ID: 1161766728

View in Genome Browser
Species Human (GRCh38)
Location 19:6212659-6212681
Sequence CTTTCTGAGCAGCGGATCGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 32}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161766728_1161766737 17 Left 1161766728 19:6212659-6212681 CCGTCGATCCGCTGCTCAGAAAG 0: 1
1: 0
2: 0
3: 3
4: 32
Right 1161766737 19:6212699-6212721 GCACAGCCCGCCGAGCAGTGGGG 0: 1
1: 0
2: 1
3: 11
4: 132
1161766728_1161766735 15 Left 1161766728 19:6212659-6212681 CCGTCGATCCGCTGCTCAGAAAG 0: 1
1: 0
2: 0
3: 3
4: 32
Right 1161766735 19:6212697-6212719 CCGCACAGCCCGCCGAGCAGTGG 0: 1
1: 0
2: 2
3: 7
4: 121
1161766728_1161766736 16 Left 1161766728 19:6212659-6212681 CCGTCGATCCGCTGCTCAGAAAG 0: 1
1: 0
2: 0
3: 3
4: 32
Right 1161766736 19:6212698-6212720 CGCACAGCCCGCCGAGCAGTGGG 0: 1
1: 0
2: 1
3: 5
4: 82
1161766728_1161766739 22 Left 1161766728 19:6212659-6212681 CCGTCGATCCGCTGCTCAGAAAG 0: 1
1: 0
2: 0
3: 3
4: 32
Right 1161766739 19:6212704-6212726 GCCCGCCGAGCAGTGGGGGCTGG 0: 1
1: 0
2: 0
3: 19
4: 217
1161766728_1161766743 30 Left 1161766728 19:6212659-6212681 CCGTCGATCCGCTGCTCAGAAAG 0: 1
1: 0
2: 0
3: 3
4: 32
Right 1161766743 19:6212712-6212734 AGCAGTGGGGGCTGGTCCCAAGG 0: 1
1: 0
2: 4
3: 33
4: 315
1161766728_1161766738 18 Left 1161766728 19:6212659-6212681 CCGTCGATCCGCTGCTCAGAAAG 0: 1
1: 0
2: 0
3: 3
4: 32
Right 1161766738 19:6212700-6212722 CACAGCCCGCCGAGCAGTGGGGG 0: 1
1: 0
2: 0
3: 6
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161766728 Original CRISPR CTTTCTGAGCAGCGGATCGA CGG (reversed) Intergenic
900603172 1:3511855-3511877 CTTGGTGAGCAGAGGGTCGAGGG - Intronic
920327747 1:205179877-205179899 CCTTCTGAGTAGAGGATGGATGG - Intronic
1064094844 10:12416657-12416679 CTTGCTGAGCACCGGAGGGAGGG + Intronic
1066196882 10:33108945-33108967 CTTTCTGAACAGAGAATCGTTGG + Intergenic
1066470395 10:35692185-35692207 ATTTCTGAGAAGCGGATGGAAGG - Intergenic
1067288773 10:44926690-44926712 TTTTCTGAGCAATGGATGGAGGG - Intronic
1069025892 10:63541001-63541023 ATTTCTGGGCAGTGGATCTAGGG + Intronic
1074689331 10:115990301-115990323 CTTTCTGAGCAGAGGGCAGAGGG + Intergenic
1085367732 11:75966983-75967005 CTTTCTGACCAGAGGAACCAGGG - Intronic
1091743263 12:2974820-2974842 CTTTGAGAGCAGCTGATTGAGGG + Intronic
1104743288 12:131194343-131194365 CTTCCTGAGCAGAGGCTCAAGGG - Intergenic
1105806042 13:23952078-23952100 CCTTCGGAGGAGCGGATGGAAGG - Intergenic
1118817469 14:69323460-69323482 CTTTCTGGGCACCGGATGGTTGG + Intronic
1141574305 16:84954272-84954294 CTTTCTGAGCTGCGGTCGGAGGG + Intergenic
1144796288 17:17893412-17893434 CTTTGTGAGCAGCAGAGGGATGG + Intronic
1153369378 18:4296877-4296899 CTTTCTGAGCAGGCAATGGATGG + Intronic
1161766728 19:6212659-6212681 CTTTCTGAGCAGCGGATCGACGG - Intergenic
1162124272 19:8490814-8490836 CTTTCTGAGCCTGGGATCGGTGG + Intronic
1163784850 19:19269766-19269788 CTTCCTGAGCAGGGGATGGAGGG + Exonic
934980498 2:98835906-98835928 CTTTCTGAGCAGTGGGTTCAGGG - Intronic
947347056 2:229202947-229202969 TTTTCTGAGGAGAGGATCCATGG - Intronic
1170916111 20:20627656-20627678 CTTTCTGTGCAGCAGAGGGAGGG + Intronic
1180973764 22:19832702-19832724 CTTTCTGATCAGGGGAACCAAGG + Intronic
1181174375 22:21027512-21027534 CTGTCTGGGCAGCTGCTCGAGGG + Exonic
1181317890 22:21982687-21982709 CTTTCTGAGCCGCCGGGCGAGGG + Exonic
1183318580 22:37149959-37149981 CTTCCTGTGCAGAGGATAGAGGG + Exonic
981920439 4:150079320-150079342 CTCTATGAGGAGCGCATCGAAGG - Exonic
1001557941 5:172648926-172648948 CTTTCTGGGCAGCAAATCAAAGG + Intronic
1005642543 6:27810246-27810268 CTTTCTGATCAGCAGCTCGGTGG - Exonic
1035092973 7:156329746-156329768 TTTTCTGAGCAGAGGGTGGAAGG - Intergenic
1042816754 8:72886555-72886577 CTTTCTGAGCAGAGTGTAGATGG - Intronic
1043618741 8:82160845-82160867 CTTGCTGAGCAGCGGGTGGTGGG + Intergenic
1043745218 8:83866869-83866891 TTTTCTGAGTAGGGGATGGATGG + Intergenic
1050808721 9:9717729-9717751 ATTTCTGTGCAGTGGATGGAAGG + Intronic
1189065708 X:37806065-37806087 CTTTCTGAGAAGAGGTTCGAAGG + Intronic
1199514299 X:148658281-148658303 CTTTCTGAGTTGCTGATTGAAGG - Intronic