ID: 1161766979

View in Genome Browser
Species Human (GRCh38)
Location 19:6213559-6213581
Sequence CGGTGTGGCCTTGGAGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 183}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161766979_1161766995 29 Left 1161766979 19:6213559-6213581 CCCTCAGCTCCAAGGCCACACCG 0: 1
1: 0
2: 1
3: 18
4: 183
Right 1161766995 19:6213611-6213633 GCCCAGGAAGAGTCCAACTGTGG 0: 1
1: 0
2: 1
3: 15
4: 164
1161766979_1161766991 13 Left 1161766979 19:6213559-6213581 CCCTCAGCTCCAAGGCCACACCG 0: 1
1: 0
2: 1
3: 18
4: 183
Right 1161766991 19:6213595-6213617 GACTGTCCCTGCTCCTGCCCAGG 0: 1
1: 0
2: 3
3: 59
4: 496
1161766979_1161766988 -9 Left 1161766979 19:6213559-6213581 CCCTCAGCTCCAAGGCCACACCG 0: 1
1: 0
2: 1
3: 18
4: 183
Right 1161766988 19:6213573-6213595 GCCACACCGGGAGGGGAGGAAGG 0: 1
1: 0
2: 3
3: 25
4: 382
1161766979_1161766997 30 Left 1161766979 19:6213559-6213581 CCCTCAGCTCCAAGGCCACACCG 0: 1
1: 0
2: 1
3: 18
4: 183
Right 1161766997 19:6213612-6213634 CCCAGGAAGAGTCCAACTGTGGG 0: 1
1: 0
2: 0
3: 9
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161766979 Original CRISPR CGGTGTGGCCTTGGAGCTGA GGG (reversed) Intronic
900384340 1:2402713-2402735 CGGTGTGGCCTTCGTGCTGCGGG + Intronic
901961325 1:12828618-12828640 CTGTGAGGCCCTGAAGCTGATGG - Exonic
901967916 1:12883223-12883245 CTGTGAGGCCCTGAAGCTGATGG - Exonic
901975721 1:12942353-12942375 CTGTGAGGCCCTGAAGCTGATGG - Exonic
901983315 1:13053488-13053510 CTGTGAGGCCCTGAAGCTGATGG - Intronic
901985695 1:13073843-13073865 CTGTGAGGCCCTGAAGCTGATGG + Exonic
901996114 1:13152924-13152946 CTGTGAGGCCCTGAAGCTGATGG - Intergenic
901998773 1:13175430-13175452 CTGTGAGGCCCTGAAGCTGATGG + Intergenic
902007774 1:13246006-13246028 CTGTGAGGCCCTGAAGCTGATGG + Intergenic
902009453 1:13259412-13259434 CTGTGAGGCCCTGAAGCTGATGG + Exonic
902017259 1:13318557-13318579 CTGTGAGGCCCTGAAGCTGATGG + Exonic
902030171 1:13416498-13416520 CTGTGAGGCCCTGAAGCTGATGG + Exonic
902891528 1:19447764-19447786 CAGTGTGGCCTGCGAGCTGCTGG - Intronic
903999572 1:27331183-27331205 GGGTGTGGCCATGGAGAAGAGGG + Intronic
904534427 1:31189851-31189873 TGGTGTGAGCTTGGAGCTGTTGG + Intronic
904946991 1:34206666-34206688 CCTAGTGGCCTTGGAGCTCATGG + Intronic
906488031 1:46246943-46246965 CGGTTTGGCCTTGGAGAGGAAGG + Intergenic
910054277 1:83012644-83012666 AGGTGTGGCCTGGCAGCTGCAGG - Intergenic
912558663 1:110534618-110534640 GGATGTGGCATTTGAGCTGAAGG + Intergenic
913718828 1:121569933-121569955 TGATGTGTCCTTGGAGCTGATGG + Intergenic
914513239 1:148352721-148352743 TGGGGTGGCCTTGGATCTGCTGG + Intergenic
917597463 1:176543637-176543659 AGGTGTGGCATTGGAGATGAAGG - Intronic
920069143 1:203289995-203290017 AGGTCTGGCCTAGGGGCTGACGG - Intergenic
920403724 1:205693646-205693668 CTGTGTGGCCTTGGGGGTGGGGG - Intergenic
920676927 1:208044511-208044533 CCGTGTGGCCTTGGAGTGCAAGG - Exonic
922572409 1:226641945-226641967 CAGGGTGGCCGTGGAGCTGATGG + Exonic
923276732 1:232403224-232403246 GGGTGTGCCCATGGAGCAGAGGG + Intronic
1063822832 10:9856772-9856794 CAGGGTGGCCTTGGAGTAGAAGG - Intergenic
1064189372 10:13192369-13192391 ACGTGTGGCCATGCAGCTGATGG - Intronic
1065960703 10:30732062-30732084 GGTGGTGGCCTTGGAGCTGGAGG + Intergenic
1068328640 10:55530850-55530872 AGGTCTGGCAGTGGAGCTGATGG + Intronic
1069438468 10:68407099-68407121 CGGGGTGGACTGGGAGCTGGGGG - Exonic
1069981601 10:72256491-72256513 AGGTGTTGCCTTGGAGCTCCTGG + Intergenic
1072737958 10:97891810-97891832 CAGAGGGGCCTTGGAGCTGCAGG + Intronic
1073469300 10:103712859-103712881 GGGTGTGGACTTGGAGCTGAAGG + Intronic
1075397859 10:122140963-122140985 CTGTGGGGCCTTGGATCTGAGGG + Intronic
1075709546 10:124523274-124523296 AGCTGTGGCCTGGGTGCTGAAGG + Intronic
1077187623 11:1242549-1242571 GGGCGTGGCCGTGGAGCTGGTGG - Exonic
1078748035 11:14133955-14133977 TGATGTGGCCCTGGAGCAGAGGG + Intronic
1083851619 11:65371000-65371022 CGGCCTGGGCTGGGAGCTGAGGG + Intergenic
1083889216 11:65587647-65587669 CTGTGTGACCTGGGAGCTGCAGG - Intronic
1083963098 11:66025461-66025483 CGTGGTGGTCTTGGTGCTGATGG + Exonic
1084706819 11:70820534-70820556 CGAGGTGGCCGTGGAGCAGACGG + Intronic
1085565677 11:77511511-77511533 AGGAAGGGCCTTGGAGCTGAGGG - Intergenic
1087177595 11:95109692-95109714 AGGTGTGGCCCTGCTGCTGATGG - Intronic
1092254000 12:6916460-6916482 CTATGAGGCCCTGGAGCTGAGGG + Exonic
1092630303 12:10369639-10369661 CTCTGTGGCCTTGGGGATGAGGG - Intergenic
1104972900 12:132539817-132539839 CTGTGTGGGCATGGGGCTGAAGG - Intronic
1104973062 12:132540267-132540289 CTGTGTGGGCATGGGGCTGAAGG - Intronic
1105837003 13:24221003-24221025 CTCTGTGGCCTTGGAGGTAATGG + Intronic
1106662465 13:31814412-31814434 TGGAGTGGGCTTGGAGCTGCAGG - Intergenic
1107103130 13:36615439-36615461 CGTTGTTGCCTTGGAGCCGCTGG - Intergenic
1107412889 13:40173718-40173740 TCGTGTGGACTTGGAGATGAGGG - Intergenic
1107665400 13:42683920-42683942 CAGTGTGATCATGGAGCTGAAGG + Intergenic
1108225672 13:48286501-48286523 CAGTGTGGCCTGGAAGCAGATGG + Intergenic
1109403972 13:61873866-61873888 AGGTGAGCCCTGGGAGCTGAAGG - Intergenic
1111936344 13:94561603-94561625 AGGTCTGGCCTTGATGCTGATGG + Intergenic
1113498780 13:110756615-110756637 CCTTGTGGCCCTGGAACTGAAGG + Intergenic
1113716345 13:112510966-112510988 CAGTGTGGCCTTGGCCCTGCAGG - Intronic
1113895860 13:113764231-113764253 CAGTGTGGCCTTGGGGCTCCTGG + Intronic
1115401725 14:32969151-32969173 TGGTGTGGCCTAGGAGGTGAGGG - Intronic
1117804791 14:59480448-59480470 TGCTGTGGCCTTGGAGAGGATGG - Intronic
1118224219 14:63884022-63884044 TGGTGTGGCCCAGGAGATGAAGG + Intronic
1119159344 14:72440163-72440185 TGGAGTGGTCTTGTAGCTGAGGG - Intronic
1119261148 14:73238397-73238419 CGGACTGGCCTTGGAGTTGAAGG + Intronic
1123680678 15:22761025-22761047 TGGTGTGGTCTTTGAGCTGGTGG + Intergenic
1124332889 15:28835483-28835505 TGGTGTGGTCTTTGAGCTGGTGG + Intergenic
1124656132 15:31508904-31508926 CGTTGTGGCCTTGGGGATGAGGG + Intronic
1127876947 15:63119798-63119820 GGGTGTGGGGTTGGGGCTGATGG + Intergenic
1129062439 15:72871032-72871054 CGAGGTGTCCTTTGAGCTGAAGG - Intergenic
1129176072 15:73840678-73840700 CAGAGTGGCCTTGGATCTGCTGG - Intergenic
1129230227 15:74192962-74192984 TGCTGTGGACTTGGAGCTGATGG - Intronic
1129769079 15:78192290-78192312 CAGTGTGGCCTTGGGGAGGATGG - Intronic
1131306427 15:91247844-91247866 GAGGGTGGCTTTGGAGCTGAGGG + Intronic
1131522494 15:93126964-93126986 CGCTGTGGCCTTCAAGCAGAAGG - Intergenic
1132152639 15:99473501-99473523 TGGGGTGGCCTTGGGGCAGATGG + Intergenic
1133256284 16:4518425-4518447 TGGTGTGGCCATCGAGCTGGAGG - Intronic
1133713086 16:8420297-8420319 AGGTGTGTTCTGGGAGCTGATGG + Intergenic
1133775218 16:8890154-8890176 CAGTGACCCCTTGGAGCTGATGG + Intergenic
1136156724 16:28388029-28388051 TGGGGAGGCCTTGGAGGTGAAGG - Intronic
1136206362 16:28727252-28727274 TGGGGAGGCCTTGGAGGTGAAGG + Intronic
1136253890 16:29025385-29025407 GGATGTGACCTTGTAGCTGACGG + Intergenic
1139280181 16:65763928-65763950 CTGTGTGGCCCTAGAGCTGGTGG + Intergenic
1141419696 16:83905548-83905570 CGACGTGGCTTTGGAGATGAAGG - Intronic
1141478228 16:84288228-84288250 CGCTGTGGCTTTGGAGATGGAGG - Intergenic
1141890794 16:86925360-86925382 CAGCATGGCATTGGAGCTGATGG + Intergenic
1141946674 16:87315522-87315544 CCGTGTGCCCCTGGAGGTGATGG - Intronic
1142227086 16:88882832-88882854 GGGTGGGGCCTGGGAGCAGAGGG - Intronic
1143016781 17:3895050-3895072 GGGTGTGTCCTAGGAGCTGCTGG + Intergenic
1144659194 17:17057436-17057458 CTGTGGGGCATGGGAGCTGAAGG + Intronic
1147423549 17:40334435-40334457 AGGTGTGGCCATGGGTCTGAGGG + Intronic
1150143938 17:62752418-62752440 CGGTGTTGCCTTTGAGCTGCAGG - Intronic
1151505155 17:74522597-74522619 CGCCCTGGCCTTGGAGCTGGTGG - Exonic
1152754711 17:82082439-82082461 GGGTGAGGCCCTGGAGCTGCAGG - Intronic
1158966323 18:62625247-62625269 AGGTGTGGCCCGAGAGCTGAGGG + Intergenic
1159703935 18:71663532-71663554 CAGTGTGGCCATGGAGGTGATGG + Intergenic
1160402415 18:78620631-78620653 CAGTGTGGCCTTGGGGCACAGGG - Intergenic
1160985660 19:1837442-1837464 CCGTGTGGTCTAGGAGCTGTGGG - Intronic
1161766979 19:6213559-6213581 CGGTGTGGCCTTGGAGCTGAGGG - Intronic
1162762922 19:12899020-12899042 CTGTGTTTCCTTGGAGCTCAGGG + Exonic
1163723828 19:18911263-18911285 CAGTGTGGCCCTGCAGATGAGGG - Intronic
1163976794 19:20860527-20860549 TGTTGTGGCCTTGGGGATGAGGG - Intronic
1164941305 19:32253702-32253724 CGCTGGGGCCTTGGAGCCCATGG - Intergenic
1165708310 19:37991838-37991860 CTGTGGAGCCTTGCAGCTGATGG + Intronic
1165803538 19:38566988-38567010 GTGAGTGGCCTTGGGGCTGAGGG + Intronic
1167510920 19:49895001-49895023 TGGTGTGGGCATGGAGCTGGGGG + Intronic
928021413 2:27707987-27708009 TGGTTTGCTCTTGGAGCTGAAGG - Exonic
929488837 2:42378677-42378699 CAGTGTGGCCTTGAAGGTGAAGG - Intronic
930103065 2:47617935-47617957 CTCTTTGGCCTTGGAGCCGATGG + Intergenic
934764234 2:96871313-96871335 AGCTGTGGCCTTGGAGATGCTGG + Intergenic
934951410 2:98578258-98578280 CAGTGTGACCCTGGTGCTGAGGG + Intronic
936108798 2:109648175-109648197 TGGCGTGGGCTGGGAGCTGAAGG + Intergenic
937840441 2:126519312-126519334 CTGTGTGGCCTTGGGGCAGCAGG - Intergenic
938314406 2:130316021-130316043 CAGGGTGTGCTTGGAGCTGAGGG + Intergenic
944542370 2:200766217-200766239 CGGTGTGGCCGTACAGGTGAAGG - Intergenic
946360405 2:219216204-219216226 CAGTAGGGCCTGGGAGCTGAGGG + Intronic
946580625 2:221124793-221124815 AGCTGTGGCCGTGGAGCTCAGGG - Intergenic
949062096 2:241967217-241967239 GAGTGGGGCCTTGGAGCTCAGGG - Intergenic
1170547727 20:17449311-17449333 GAGGGTGGCCCTGGAGCTGAAGG - Intronic
1172122411 20:32606242-32606264 ATGTGTGGCTTTGGAGCTCAGGG - Intronic
1174525134 20:51164492-51164514 CTTTGTGCCCTGGGAGCTGAAGG + Intergenic
1175249841 20:57602615-57602637 GGGTGTGGCATTGGAGTTGGGGG + Intergenic
1175532594 20:59684412-59684434 GGAGGTGGCCTTGGTGCTGAGGG + Intronic
1175562162 20:59939814-59939836 CGGCGTGGCCCTGGAGCCGCGGG - Exonic
1179251057 21:39671855-39671877 CAGATTGGCCTTGAAGCTGAAGG + Exonic
1179675770 21:42981045-42981067 GTGTGTGTCCTTGGAGGTGAGGG + Intronic
1180205977 21:46260842-46260864 GGGCCTGGCCGTGGAGCTGATGG - Exonic
1180901451 22:19376382-19376404 TGGTGTGGGCTTGGACATGAAGG - Intronic
1181054894 22:20256256-20256278 CAGTGTGGCCTTGGACTTGAGGG - Intronic
1183389745 22:37538763-37538785 GGGTGTGGCTTTGGAGTTGGCGG + Intergenic
1184128816 22:42505152-42505174 CGGTGTGGACGGGGAGCTGGTGG + Intergenic
1184137611 22:42558467-42558489 CGGTGTGGACGGGGAGCTGGTGG + Intronic
949857445 3:8474980-8475002 CCTTGTGGCCTTGGATTTGAGGG - Intergenic
956718463 3:72098534-72098556 CTGTGGGGCCTGGGAGCTGATGG + Intergenic
958865953 3:99502004-99502026 CTGTGTGGACTTGGAGCCAAGGG - Intergenic
961719178 3:128880840-128880862 TCTTGTGACCTTGGAGCTGACGG + Intronic
964790843 3:160452398-160452420 CGGCGTGGCCATGAAGCTGAAGG + Intronic
966815935 3:183889876-183889898 GGGTGTGGCCATAGGGCTGATGG + Intergenic
969685988 4:8674598-8674620 CGGTGTGGCCGGGGAGGTGGTGG - Intergenic
972355490 4:38276455-38276477 CGGCCTGGCCTCAGAGCTGAGGG + Intergenic
972635765 4:40882726-40882748 AAGTGTGGGTTTGGAGCTGAGGG + Intronic
973376166 4:49287959-49287981 CTGCGTGGACTTGGAGCTCACGG - Intergenic
973377091 4:49294114-49294136 CTGCGTGGACTTGGAGCTCACGG - Intergenic
973378009 4:49300253-49300275 CTGCGTGGACTTGGAGCTCACGG - Intergenic
973378955 4:49306549-49306571 CTGCGTGGACTTGGAGCTCACGG - Intergenic
973379263 4:49309097-49309119 CTGCGTGGACTTGGAGCTCACGG + Intergenic
973380140 4:49315101-49315123 CTGCGTGGGCTTGGAGCTCACGG + Intergenic
973381054 4:49321257-49321279 CTGCGTGGACTTGGAGCTCACGG + Intergenic
973385677 4:49512910-49512932 CTGCGTGGACTTGGAGCTCACGG + Intergenic
974877240 4:67715113-67715135 CTGTGTGGCCTTGGTGGTTAAGG + Intergenic
976783239 4:88785795-88785817 CAGTGTGGGCTGGGAGTTGAAGG + Intronic
985551296 5:534838-534860 CGGGGTGGACGCGGAGCTGAGGG + Intergenic
985966546 5:3342578-3342600 CGGTGTGGCCCAGGACCAGAGGG - Intergenic
985966575 5:3342726-3342748 CGGTGTGGCCCAGGACCAGAGGG - Intergenic
986391672 5:7292996-7293018 TGGTGTGGTCTTTGAGCTGGTGG + Intergenic
986832552 5:11596753-11596775 AGGTGCTGCCTTGGAGGTGAGGG + Intronic
990738840 5:58891809-58891831 CGGTCTGGCCTTTAGGCTGAGGG - Intergenic
991202076 5:64006363-64006385 TGGTGTGTCATGGGAGCTGATGG - Intergenic
997994461 5:138574933-138574955 AGGTTTGGCCTTGGGGGTGAGGG - Intronic
999347292 5:150835211-150835233 CGTTGTGGCCTTGGGGATGAGGG + Intergenic
1001227316 5:169955981-169956003 GGGTGTGGCTCTGGAGCTCAGGG + Intronic
1006170305 6:32088220-32088242 GGGTGGGGCCCTGTAGCTGAAGG + Intronic
1006831740 6:36972256-36972278 CGTTATGGCCTTTGATCTGACGG - Intronic
1007405010 6:41630164-41630186 CCATGTGCTCTTGGAGCTGAGGG - Intergenic
1014111061 6:117619007-117619029 CACTGTGGCCTTGGGGTTGAGGG - Intergenic
1015263235 6:131262368-131262390 AAGGGTGGGCTTGGAGCTGAGGG + Intronic
1017638939 6:156471656-156471678 CCATGTGGCCTTGGAGATGAGGG - Intergenic
1018137452 6:160791467-160791489 CATTGTGGCCTTGGGGATGAGGG - Intergenic
1022383909 7:29884483-29884505 CGGTGGGGCCTGGAAGCTGGGGG - Exonic
1023949146 7:44827813-44827835 AGATGTGGCCATGGAGCTCATGG + Intronic
1024200022 7:47097128-47097150 GGGTGTGACCTGGCAGCTGAGGG + Intergenic
1026870666 7:73849319-73849341 GGGGGTGACCTTGGTGCTGATGG + Intergenic
1026974800 7:74490714-74490736 AGCTGGGGCGTTGGAGCTGATGG - Intronic
1026997879 7:74630740-74630762 CAGTGTGGCCTTGGAACTAGTGG - Intergenic
1032450938 7:132030262-132030284 GGTTGTAGCCTTGAAGCTGAGGG + Intergenic
1033013165 7:137644080-137644102 AGGTGTTGCCTTGGGGCTTATGG - Intronic
1033951315 7:146788193-146788215 CCGTGTGGCCTGAGAGCAGAGGG + Intronic
1035179843 7:157081386-157081408 CTGGTTGGCCTTAGAGCTGAAGG - Intergenic
1039908818 8:41808065-41808087 GGGTCTGGCCTTAGAGCAGAGGG - Intronic
1043525081 8:81087769-81087791 CAGTGTAGCCTTGCAGCCGAGGG - Intronic
1045145741 8:99341867-99341889 CGGTTTGGCCTTGCAGCTAGTGG - Intronic
1048328824 8:133458498-133458520 CTGTGTGGCTTTGGAGGTTACGG + Exonic
1048861451 8:138727182-138727204 CGCTGTGGTGCTGGAGCTGAGGG - Intronic
1049010902 8:139886768-139886790 TGGTGTGGCCTTGAGGATGAAGG + Intronic
1049122846 8:140755417-140755439 CGGTGTGGCCGCGGAGTAGAGGG - Intronic
1049197511 8:141323841-141323863 CGGGGTGGCCTTGGCTCTCAAGG - Intergenic
1049461439 8:142730577-142730599 CACTGTGGCCTTGGACATGAGGG + Intronic
1049671157 8:143870456-143870478 CTGTGCGGCCTGGGAGCTGTGGG - Exonic
1049896545 9:115248-115270 CGGTGGGGCTATGGGGCTGACGG + Intergenic
1057141470 9:92729026-92729048 CTCTGTGGCCCAGGAGCTGAAGG - Exonic
1057879702 9:98783912-98783934 CTGTCTGGCCTTGTCGCTGAGGG + Intronic
1061315901 9:129795621-129795643 GGAGGTGGGCTTGGAGCTGAGGG + Intergenic
1061843034 9:133371096-133371118 CTGTGTGGCGTGGGAGCTGCAGG - Intronic
1062107948 9:134765918-134765940 AGGTGTGGCCTTGCAGGTGGAGG + Intronic
1062434337 9:136540047-136540069 CTGTGTGACCCTGGGGCTGATGG + Intronic
1203549287 Un_KI270743v1:154674-154696 CTGCGTGGACTTGGAGCTCACGG + Intergenic
1203550245 Un_KI270743v1:160988-161010 CTGCGTGGACTTGGAGCTCACGG + Intergenic
1187126944 X:16462683-16462705 AAGTGTGGGTTTGGAGCTGAGGG + Intergenic
1189709350 X:43793788-43793810 ATGTGTGGCCTTGGCGATGATGG - Intronic
1198031606 X:132758702-132758724 CAGTTTGCCCTTGGAGCTGTGGG - Intronic
1198437622 X:136632344-136632366 CAGTGTGGCTTTGGTCCTGAGGG + Intergenic
1199076797 X:143534619-143534641 CTCTGTGGCCTTGGTGCTCATGG - Intergenic
1202143176 Y:21750553-21750575 AGGTGTGGCCTTGCAGTGGATGG - Intergenic