ID: 1161767286

View in Genome Browser
Species Human (GRCh38)
Location 19:6214651-6214673
Sequence CTATGACCACACACAGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 230}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161767285_1161767286 -3 Left 1161767285 19:6214631-6214653 CCATCTGTGAAAGGAGGCTGCTA 0: 1
1: 0
2: 1
3: 27
4: 247
Right 1161767286 19:6214651-6214673 CTATGACCACACACAGAGCCTGG 0: 1
1: 0
2: 0
3: 23
4: 230
1161767280_1161767286 8 Left 1161767280 19:6214620-6214642 CCTCAGTTTCCCCATCTGTGAAA 0: 53
1: 557
2: 3069
3: 8869
4: 16538
Right 1161767286 19:6214651-6214673 CTATGACCACACACAGAGCCTGG 0: 1
1: 0
2: 0
3: 23
4: 230
1161767284_1161767286 -2 Left 1161767284 19:6214630-6214652 CCCATCTGTGAAAGGAGGCTGCT 0: 1
1: 0
2: 4
3: 36
4: 258
Right 1161767286 19:6214651-6214673 CTATGACCACACACAGAGCCTGG 0: 1
1: 0
2: 0
3: 23
4: 230
1161767279_1161767286 14 Left 1161767279 19:6214614-6214636 CCTCTGCCTCAGTTTCCCCATCT 0: 6
1: 97
2: 508
3: 1437
4: 3357
Right 1161767286 19:6214651-6214673 CTATGACCACACACAGAGCCTGG 0: 1
1: 0
2: 0
3: 23
4: 230
1161767283_1161767286 -1 Left 1161767283 19:6214629-6214651 CCCCATCTGTGAAAGGAGGCTGC 0: 1
1: 1
2: 5
3: 95
4: 783
Right 1161767286 19:6214651-6214673 CTATGACCACACACAGAGCCTGG 0: 1
1: 0
2: 0
3: 23
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161767286 Original CRISPR CTATGACCACACACAGAGCC TGG Intronic
901681416 1:10914954-10914976 CTGTGACCCAGCACAGAGCCTGG + Intergenic
902449938 1:16490695-16490717 GTATGTCCTCACTCAGAGCCTGG + Intergenic
902504521 1:16930495-16930517 GTATGTCCTCACTCAGAGCCTGG - Exonic
907188386 1:52629478-52629500 CAGGGACCACACACACAGCCAGG + Intergenic
907427290 1:54388418-54388440 CCATGCCCACACACAGTGCCTGG + Intronic
914687244 1:149991621-149991643 AGATGACAACACACAGAACCAGG + Intronic
915994847 1:160551888-160551910 CTGGGGCCTCACACAGAGCCTGG - Intronic
916323988 1:163536742-163536764 CTTTCACCTCACACAAAGCCTGG - Intergenic
916325594 1:163556346-163556368 ACTTAACCACACACAGAGCCAGG - Intergenic
917357391 1:174141139-174141161 TTCTGACCACTGACAGAGCCTGG + Intergenic
920121453 1:203661760-203661782 CTGGGAGCCCACACAGAGCCTGG - Intronic
920310723 1:205046800-205046822 CTCACACCACACACAGAGCAGGG + Intronic
921311881 1:213852720-213852742 CAATGAACACACACAGAGAAAGG + Intergenic
922974454 1:229772142-229772164 CTCTGACCCCACTTAGAGCCTGG + Intergenic
923545596 1:234920939-234920961 GTGTGAGCACACACATAGCCCGG + Intergenic
924021923 1:239792425-239792447 CCAAGACCTCACCCAGAGCCTGG - Intronic
924048828 1:240060127-240060149 CTAGGACCCCACGCAGTGCCTGG - Intronic
924122086 1:240810952-240810974 AAATGACCACAGACAGAACCCGG - Intronic
1062809844 10:455019-455041 CAGTGAGCACACACACAGCCTGG + Intronic
1063385457 10:5613707-5613729 CTTTGATGTCACACAGAGCCCGG - Intergenic
1066403002 10:35093067-35093089 CTATGGCCCCACCCAGAGGCAGG + Intergenic
1067135958 10:43607152-43607174 CTTTGTCCACACACAGGGCAGGG - Intronic
1067431678 10:46249674-46249696 ATCCGACCACAGACAGAGCCAGG + Intergenic
1067441742 10:46312500-46312522 ATCCGACCACAGACAGAGCCAGG - Intronic
1067580819 10:47444354-47444376 ATCTGACCACAGACAGAGCCAGG + Intergenic
1067689564 10:48493180-48493202 CTAACACCACACACACAGGCAGG - Intronic
1070266078 10:74904516-74904538 CTATGAGCATACACAGGGCTAGG - Intronic
1071498987 10:86190297-86190319 CTGTGACCAAACACAGAGTTGGG + Intronic
1072640189 10:97205781-97205803 CCAGAGCCACACACAGAGCCTGG - Intronic
1074187372 10:111108574-111108596 CTACGACCACAGCCAGCGCCTGG + Intergenic
1079227291 11:18618169-18618191 CTTTGACCACACACAAAGGCTGG + Intronic
1080421961 11:32118320-32118342 CTGTGTCCTCACACAGACCCAGG - Intergenic
1080766934 11:35305789-35305811 CTAACACCACACAGAGAGTCAGG + Intronic
1083814539 11:65125277-65125299 CTAAGGCCCCACACAGGGCCTGG - Intronic
1086020666 11:82226048-82226070 CTATGACCACATTAAGAGACAGG - Intergenic
1086182566 11:83971266-83971288 CTATTAGCAAACACACAGCCAGG - Intronic
1086670885 11:89546240-89546262 CTATCACCAAACACAGTGCCTGG - Intergenic
1087964399 11:104394361-104394383 CTATAACCACAGAAATAGCCAGG + Intergenic
1090172473 11:124617018-124617040 CTGGGACCCCACACAGACCCTGG + Intronic
1090228052 11:125083396-125083418 CTGTGCTCATACACAGAGCCAGG - Intronic
1090816153 11:130298206-130298228 CAATCACAACACACACAGCCTGG + Intronic
1092332869 12:7601674-7601696 GTATTACATCACACAGAGCCTGG - Intergenic
1094513353 12:31110374-31110396 CTGAGACAACACACAGATCCAGG + Intergenic
1096840006 12:54374369-54374391 CTACCACCACACCCAGGGCCTGG + Intronic
1098922455 12:76314936-76314958 CCATGAACATACACAGATCCAGG - Intergenic
1099968747 12:89478512-89478534 CTATCCCCAGACACAGTGCCTGG + Intronic
1102310291 12:111839488-111839510 CTATTACAAGACATAGAGCCTGG + Intergenic
1102518169 12:113463797-113463819 CAGAGACCACACACAGAGACGGG + Intronic
1106120965 13:26859894-26859916 CCATGACCACACACAGAGGGTGG - Intergenic
1106193624 13:27475235-27475257 CTATGATGACAAACATAGCCAGG + Intergenic
1106217715 13:27718121-27718143 TCATGACCACACTCAGAGACAGG + Intergenic
1106380121 13:29228613-29228635 ATATGTACACACACAGGGCCAGG - Intronic
1107095386 13:36530021-36530043 CTCTGACCACACAGAAAGCCTGG + Intergenic
1107349772 13:39501734-39501756 CCATGACCACACTAAGAGCAGGG - Intronic
1111901009 13:94199818-94199840 CCTTGACCACACACAGAAACTGG + Intronic
1113778348 13:112961653-112961675 CTGTGGCCACACACACAGCTGGG + Intronic
1116050664 14:39799058-39799080 CTATTACCACAAATGGAGCCTGG - Intergenic
1116974545 14:51101153-51101175 CTAAGAGCACACACAGAACCAGG + Intergenic
1118042285 14:61930377-61930399 CTGTGACCCCTCACAGAGACCGG - Intergenic
1120550793 14:85869966-85869988 CTTTGACCCCCCACAGAGCTGGG - Intergenic
1121259105 14:92553416-92553438 CTGGGACCACACTCAGGGCCTGG + Intronic
1121322384 14:92999549-92999571 AAAAGACCCCACACAGAGCCTGG + Intronic
1121567556 14:94922243-94922265 CTAGCACCTAACACAGAGCCAGG - Intergenic
1121993547 14:98584204-98584226 CAAAGACCACACCCAGACCCAGG + Intergenic
1122202753 14:100132511-100132533 CCATGACCACACGGAGGGCCTGG + Intronic
1122265330 14:100544101-100544123 TTATGAGCACAGACAGACCCTGG + Intronic
1122397780 14:101446610-101446632 CTAAGGCCAAAGACAGAGCCAGG + Intergenic
1123938046 15:25203450-25203472 CCAAGCCCACACAGAGAGCCTGG - Intergenic
1123947849 15:25247570-25247592 CCATGCCCACACAGGGAGCCTGG - Intergenic
1125315810 15:38429954-38429976 GTATGCACACACACACAGCCTGG + Intergenic
1125581527 15:40789203-40789225 CTGGGACCACACACGGAGCCTGG + Intronic
1130112860 15:80980452-80980474 CTATGTTCACACATAGAGCTTGG - Intronic
1131204463 15:90430133-90430155 CCATGACCAAAAACAGATCCAGG - Intronic
1132286634 15:100668395-100668417 CTGTGCCCTCACACAGAGCCGGG - Intergenic
1135670681 16:24373028-24373050 CTCTGCCCACTCACACAGCCTGG + Intergenic
1137580299 16:49629668-49629690 CCATGAGCACCCAGAGAGCCAGG + Intronic
1137911509 16:52382728-52382750 CTATGGCCAAATAAAGAGCCTGG + Intergenic
1138185575 16:54974614-54974636 GCATGACCACCCACAGACCCAGG - Intergenic
1139951889 16:70676465-70676487 CTATGACCCCACACGGTGCTAGG + Intronic
1140145448 16:72302594-72302616 CTATGGTCACACAAAGAGCATGG + Intergenic
1141595140 16:85092786-85092808 CTAAGACCACAGACAGAGCAGGG + Exonic
1143096369 17:4480622-4480644 CTTTAACCCCACAAAGAGCCTGG - Intronic
1143301723 17:5915533-5915555 CACTGACCACAAACTGAGCCTGG - Intronic
1144093829 17:11881951-11881973 CTATGACCAAGAGCAGAGCCTGG + Intronic
1145722215 17:27083652-27083674 CTATGCCCACACAGACAGCCCGG - Intergenic
1146140058 17:30358302-30358324 CTATGATCACACACAGCTCCAGG + Intergenic
1151811441 17:76444941-76444963 CGGTGACCACACACACAGTCCGG + Intronic
1152202599 17:78955920-78955942 CTATGGCCTCCCACAGTGCCTGG + Intergenic
1153375253 18:4369890-4369912 CTATGGACACACAAAGGGCCAGG + Intronic
1153519512 18:5938501-5938523 CTATGAGTTGACACAGAGCCAGG + Intergenic
1156955565 18:42958747-42958769 CTCTGTCCATTCACAGAGCCAGG + Intronic
1157219313 18:45814738-45814760 CTAAGACCACACATCCAGCCAGG + Intergenic
1157272292 18:46285405-46285427 TCATGACCACACAGAGAGCATGG - Intergenic
1158703573 18:59770895-59770917 CTAGGACCACACAGGGAGCCTGG + Intergenic
1158798148 18:60873326-60873348 CTAGGACCTAACACAGTGCCAGG + Intergenic
1159497139 18:69221335-69221357 TCATCACCACCCACAGAGCCAGG - Intergenic
1159497716 18:69227533-69227555 CTATGTCCCCACACAAAGCTCGG + Intergenic
1159904480 18:74077586-74077608 GGACCACCACACACAGAGCCTGG + Intronic
1159942044 18:74415680-74415702 TTAGCACCACACACAGTGCCTGG - Intergenic
1161664086 19:5564498-5564520 CCCTGACCACACACACAGCTGGG - Intergenic
1161767286 19:6214651-6214673 CTATGACCACACACAGAGCCTGG + Intronic
1162452638 19:10764150-10764172 CTGTGACCAAACTCAGAACCAGG + Intronic
1164415635 19:28044706-28044728 CAATGAGCAGGCACAGAGCCAGG + Intergenic
1165432201 19:35779191-35779213 CTATGCCCACACACACACCGAGG - Intronic
1165446701 19:35860679-35860701 CTTTGACCACACCCACAGGCCGG - Intronic
1166111133 19:40623701-40623723 CTACTACCACACACAGCGGCTGG + Exonic
1168477671 19:56688866-56688888 CTAGGACCTCACTCACAGCCAGG + Intergenic
1168485720 19:56760285-56760307 CTAAGACCTCACGCACAGCCAGG + Intergenic
925569049 2:5289349-5289371 CCATGCCCACACACATAGCTAGG + Intergenic
925636671 2:5947799-5947821 CTCCAACCAAACACAGAGCCAGG - Intergenic
926118934 2:10230568-10230590 CAGTGACCACACAGAGACCCAGG - Intergenic
926325547 2:11782526-11782548 CTATGAACAGAAAAAGAGCCGGG - Intronic
926512060 2:13793719-13793741 CTATGCCCACTCCCAGAGCCAGG + Intergenic
927203029 2:20590197-20590219 CAAAAAACACACACAGAGCCCGG - Intronic
927619072 2:24632851-24632873 TTATGCCCTCACAAAGAGCCTGG + Intronic
927707533 2:25306049-25306071 CCATGACCACAGACAGTCCCTGG - Intronic
928365179 2:30694995-30695017 CTGTGCACACACACAGAGGCAGG + Intergenic
932330999 2:70898256-70898278 CGATGACAACAAACAAAGCCTGG + Intergenic
932337970 2:70941883-70941905 CGATGGCTACACTCAGAGCCTGG - Exonic
932604801 2:73157835-73157857 CTCAGACTCCACACAGAGCCTGG - Intergenic
935466679 2:103406432-103406454 CTCTGACCACACACGCAGCTGGG + Intergenic
935703395 2:105834526-105834548 CTATAAAGACACACAGAGACTGG - Intronic
936437579 2:112521679-112521701 CCATGGCCTCATACAGAGCCTGG - Intronic
937343028 2:121104089-121104111 CTATGAGCATGTACAGAGCCTGG + Intergenic
937426007 2:121799433-121799455 CAATGACCAGACACAAAGGCAGG - Intergenic
937438929 2:121900835-121900857 CTCTGCTCTCACACAGAGCCAGG + Intergenic
939011114 2:136846918-136846940 ATATGATTACACACAGACCCAGG - Intronic
940509408 2:154593524-154593546 CTGTGGCCACACCCAGAGGCTGG + Intergenic
945182029 2:207101701-207101723 CTAGGACCACACATTGTGCCAGG - Intronic
946323459 2:218968338-218968360 GCATGCCCACACACAGAGCATGG + Intergenic
948133070 2:235615150-235615172 CTATGACAACCCACAGAGGTGGG + Intronic
948681089 2:239635137-239635159 CTCAGCCCACATACAGAGCCAGG + Intergenic
1169571500 20:6911482-6911504 CTAGGCTCACACACAGAGCAGGG + Intergenic
1170941830 20:20854411-20854433 CTACAACAACACACAGATCCAGG - Intergenic
1171238229 20:23545191-23545213 CTGAGACCACATACAGGGCCAGG + Intergenic
1172248637 20:33463479-33463501 CCCTCCCCACACACAGAGCCTGG - Intergenic
1172834313 20:37863314-37863336 CTAGGACTGGACACAGAGCCTGG - Intronic
1173557102 20:43973973-43973995 CTATGACCCCCCAGAGGGCCAGG - Intronic
1174915642 20:54650592-54650614 CAATGACCACACAATTAGCCAGG - Exonic
1175474238 20:59258577-59258599 ATATGATCACCCATAGAGCCAGG - Exonic
1175527032 20:59642050-59642072 CAATGATCACCCACAGACCCAGG - Intronic
1178117897 21:29436291-29436313 AGAGGAGCACACACAGAGCCTGG + Intronic
1178229288 21:30762812-30762834 CCATCACCACAGCCAGAGCCAGG + Intergenic
1179578316 21:42321454-42321476 CTTTGACCCCACACATCGCCAGG + Intergenic
1181885611 22:26019823-26019845 CTATGACCACACTCAGTCCTGGG + Intronic
1182294315 22:29304265-29304287 CAATGACCAATGACAGAGCCTGG + Intergenic
1182423789 22:30261310-30261332 CTCTGACCACTCGCAGCGCCTGG + Intergenic
1182762669 22:32735138-32735160 CCCTCAACACACACAGAGCCAGG - Intronic
1183413401 22:37668642-37668664 CCAGGACCACACCCAAAGCCAGG - Intergenic
1185079038 22:48699303-48699325 CTATGAACGCACACAAAGCTGGG + Intronic
1185419454 22:50727415-50727437 TCATTGCCACACACAGAGCCTGG - Intergenic
949280740 3:2343878-2343900 CTGTCACCACACACAGATGCTGG - Intronic
952540920 3:34366818-34366840 CTATCACCAAACACAAAGTCAGG - Intergenic
953605860 3:44412771-44412793 CTGTCACCAGAGACAGAGCCAGG - Intergenic
953761746 3:45693494-45693516 CTATGACCTCACAGAGACACTGG - Intronic
955865501 3:63379220-63379242 CTATGAACACATACAAAGACAGG - Intronic
957340402 3:78888751-78888773 CCATGACCTGAAACAGAGCCAGG - Intronic
959737923 3:109681998-109682020 TTATGACCTCCTACAGAGCCAGG + Intergenic
960855801 3:122101003-122101025 CCATGATCTCACACAGAGCCAGG - Intronic
961740837 3:129032315-129032337 CTGAGACCACAAACAGGGCCTGG + Intronic
965075786 3:163973872-163973894 CTTTGATCTCACACAGTGCCTGG - Intergenic
965841896 3:172915714-172915736 CTTTAGCCACACACAGACCCAGG - Intronic
967149380 3:186634582-186634604 CTAAGACCACACATCCAGCCAGG - Intergenic
967389668 3:188943236-188943258 CTATGGCCACTCACAGATCCAGG - Intergenic
967842522 3:194018381-194018403 CTTTGACCATCCACAGAGGCAGG + Intergenic
968698411 4:2043496-2043518 CTCTCCCCACTCACAGAGCCTGG + Intronic
971452220 4:26810703-26810725 CTATGAGCACACACCAAGTCTGG + Intergenic
971714398 4:30156617-30156639 CCAAGACCACAGACATAGCCTGG - Intergenic
971866307 4:32176936-32176958 CTACCAACTCACACAGAGCCAGG - Intergenic
972805345 4:42524233-42524255 CTCAGGCCTCACACAGAGCCTGG + Intronic
975915298 4:79317965-79317987 CAAAGACCACACACAGATCTGGG + Intronic
981580605 4:146245270-146245292 CTATGTCCACACAGAAAGCTCGG - Intergenic
982209998 4:153026756-153026778 CCATGACCACACCCAAACCCAGG + Intergenic
983989486 4:174100465-174100487 CTATGGCCACACCCATAGGCAGG + Intergenic
983991231 4:174122345-174122367 CTATGAACACACAGAGGGACTGG + Intergenic
985183523 4:187291301-187291323 CAATGCCCACACACAGGGCAAGG - Intergenic
990348350 5:54890916-54890938 CTCTGACCACTCACAGAGTGAGG - Intergenic
991208421 5:64076664-64076686 CTTTGACCATACACAGAGTATGG + Intergenic
995891269 5:116954778-116954800 CTCTGACCATACACTGAGGCAGG - Intergenic
998227157 5:140335936-140335958 CTATGACCACACAACCATCCTGG - Exonic
999385960 5:151154651-151154673 GTGTGCCCACGCACAGAGCCAGG - Intronic
1000263669 5:159614569-159614591 CTATGACCACAAGCAAAGTCTGG + Intergenic
1000469574 5:161623712-161623734 CTATGAGAACACACAGACACAGG + Intronic
1001043677 5:168355034-168355056 CTATGACCAAACACAGGCCCTGG - Intronic
1002400336 5:178988476-178988498 CCCTGACCACACACCAAGCCTGG + Intronic
1003243442 6:4364437-4364459 TTATGACCACAGAAAAAGCCTGG - Intergenic
1003808917 6:9758089-9758111 CTATGACCACCCATAGGGCATGG + Intronic
1004276008 6:14235828-14235850 GCAAGACCACACAGAGAGCCGGG + Intergenic
1004936769 6:20515586-20515608 CTATACACAAACACAGAGCCAGG + Intergenic
1005018808 6:21398527-21398549 CTAGCACCAAACACAGGGCCTGG - Intergenic
1005429880 6:25744402-25744424 CTATAAGCAGTCACAGAGCCAGG + Intergenic
1006013339 6:31060559-31060581 CTAAGACCACAGACAAGGCCGGG + Intergenic
1008377362 6:50807312-50807334 CAATGAACACACTCAAAGCCAGG - Intergenic
1008551925 6:52640886-52640908 CTAGGAAAAGACACAGAGCCAGG - Intergenic
1010214958 6:73393472-73393494 GTATGTCCAGCCACAGAGCCAGG + Intronic
1014184459 6:118419233-118419255 GTAGGAGCACACACAGAGACAGG + Intergenic
1015099281 6:129456071-129456093 CAATGAACACACACAGAATCAGG + Intronic
1015125853 6:129753601-129753623 CTATGACCACACTCTGAGGGAGG + Intergenic
1016698767 6:147030360-147030382 CTATGACCTTCCAAAGAGCCAGG + Intergenic
1018383317 6:163280421-163280443 CCATAGGCACACACAGAGCCAGG + Intronic
1019259341 7:72003-72025 CTTTGACCATACCAAGAGCCGGG - Intergenic
1019511184 7:1418430-1418452 CTCTGATGTCACACAGAGCCTGG + Intergenic
1020133800 7:5574839-5574861 CTCTGACCAGACACAGCCCCCGG - Intergenic
1020765917 7:12320883-12320905 CTTGCTCCACACACAGAGCCAGG + Intergenic
1022530480 7:31063833-31063855 CTATGGCCACACAGTGAGTCAGG - Intronic
1023861163 7:44218392-44218414 ATATGCCCAGACACAAAGCCTGG + Exonic
1024528418 7:50370373-50370395 CCATGAGCACATACAGTGCCTGG + Intronic
1025613835 7:63101115-63101137 CTCTAACTACACACAGATCCTGG - Intergenic
1025752702 7:64307263-64307285 CTATGCCCAAACCCCGAGCCCGG + Intergenic
1026829409 7:73601825-73601847 CACTGACGACACACAGGGCCGGG - Intronic
1027884704 7:83890006-83890028 CTATGACCTCTGACAGATCCAGG - Intergenic
1029940652 7:104477370-104477392 CTATCACCAAGCACAGTGCCTGG - Intronic
1030565949 7:111156017-111156039 CTATGACAACACAAAGAACATGG - Intronic
1031606569 7:123775180-123775202 CTTTGACCACCCAAAGTGCCAGG - Intergenic
1031808310 7:126334435-126334457 CTATGCACACATACAGAGCTGGG + Intergenic
1032115179 7:129110864-129110886 CACTGCCCACTCACAGAGCCAGG - Intergenic
1034348045 7:150398954-150398976 CTCTGAGCACACACAGACCCGGG - Intronic
1034974556 7:155440238-155440260 TTGTAACCACACAGAGAGCCTGG + Intergenic
1035027642 7:155836359-155836381 CCATGAACACACACAGCGCTTGG + Intergenic
1035570966 8:671894-671916 CAGTGAGCACAGACAGAGCCGGG - Intronic
1038585561 8:28785715-28785737 CTCTGGCCACACAGAGGGCCTGG - Intronic
1040000790 8:42575020-42575042 CTATGACCAGAGACAGACCTGGG + Intergenic
1041310436 8:56510918-56510940 TTAGGACCACACAGAGAGCCTGG + Intergenic
1044171827 8:89063030-89063052 CTCTGACCACCCAGAGATCCAGG - Intergenic
1047140014 8:122127774-122127796 GTAGGATCACACACAGAGACTGG - Intergenic
1047542209 8:125779569-125779591 CTGGGGCCAGACACAGAGCCAGG + Intergenic
1047996315 8:130339945-130339967 CTTCCACCATACACAGAGCCAGG + Intronic
1048320934 8:133399760-133399782 CTGTGGCCAGACACAGAGCTGGG + Intergenic
1048328779 8:133458258-133458280 CCAGGACCACCAACAGAGCCAGG + Exonic
1051154060 9:14120856-14120878 TTGTAACCACTCACAGAGCCAGG - Intronic
1051334732 9:16055501-16055523 AAAGGACCCCACACAGAGCCTGG - Intronic
1051687931 9:19677938-19677960 CAATGACCAATGACAGAGCCAGG + Intronic
1053508099 9:38662935-38662957 CTGTGAATACACACAGAGCCTGG - Intergenic
1057314617 9:93960449-93960471 CTGAGGCCACACCCAGAGCCAGG + Intergenic
1057880726 9:98790950-98790972 CTGTGGCCAGGCACAGAGCCAGG - Intronic
1058809332 9:108624491-108624513 ATGTGAACTCACACAGAGCCTGG - Intergenic
1060530070 9:124342837-124342859 ATATGAACACACACACAGGCTGG + Intronic
1061719921 9:132545246-132545268 ACATGACCTCACACAGTGCCTGG - Intronic
1061817395 9:133205357-133205379 CTACCACCAGACACAGAGCCTGG - Exonic
1062164748 9:135101985-135102007 CCATAAGCACAGACAGAGCCTGG + Intronic
1062243008 9:135549869-135549891 CTACCACCAGACACAGAGCCCGG + Exonic
1062453647 9:136625937-136625959 CTCTGACCTCAATCAGAGCCTGG + Intergenic
1062601143 9:137319116-137319138 CTGTGACCAAGCCCAGAGCCAGG + Intronic
1187140090 X:16585190-16585212 GTGTGACCACACACAAAACCAGG + Intergenic
1187280016 X:17851112-17851134 CTATGAGCACAAACAAAGCTTGG + Intronic
1188483795 X:30660702-30660724 CAAAGAGCACACACAGACCCCGG - Intronic
1189227609 X:39426586-39426608 CTTTGAGCACACAGGGAGCCAGG - Intergenic
1191975474 X:66866441-66866463 CAATGACTCCACACAGAACCTGG + Intergenic
1194352302 X:92835287-92835309 CTGTGGACCCACACAGAGCCAGG + Intergenic
1195963344 X:110407940-110407962 CTATGATCACCCACAGACCCAGG - Intronic
1196706704 X:118723366-118723388 CTATGAGCACACACACAGGAGGG + Intergenic
1197918408 X:131561273-131561295 CCATCACCTCACACAGTGCCTGG - Intergenic
1199874554 X:151920265-151920287 CTATGCCACCTCACAGAGCCTGG - Intronic
1200660611 Y:5952025-5952047 CTGTGGACCCACACAGAGCCAGG + Intergenic