ID: 1161767778

View in Genome Browser
Species Human (GRCh38)
Location 19:6216568-6216590
Sequence TCCAGGGCCCCTCGCCCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 185}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161767778 Original CRISPR TCCAGGGCCCCTCGCCCATG AGG Intronic
900083124 1:873964-873986 TCCAGGGTCGCATGCCCATGAGG + Intergenic
900483544 1:2910735-2910757 CCCAGGGACCCTGGCCCAAGGGG + Intergenic
903157698 1:21459520-21459542 TCCCTGGCCCCCAGCCCATGTGG + Intronic
905183197 1:36178887-36178909 TCAAGTGCCCCACGCTCATGGGG + Intronic
906116292 1:43359325-43359347 GCCCGGCCCCCTCACCCATGCGG + Exonic
907305452 1:53510457-53510479 TCCAGGGCTCCTCGTCCAGGTGG - Intronic
907526026 1:55054619-55054641 TCCAGGTCCCCTTGCACATCAGG + Intronic
909863672 1:80638325-80638347 TCCAGGGACCCCCGCCCATCTGG - Intergenic
909899157 1:81110795-81110817 CCCAGGACCCCTCACCAATGGGG + Intergenic
913544527 1:119853865-119853887 TCCCTGGCCCCCAGCCCATGCGG - Intergenic
913602284 1:120433513-120433535 TCCCTGGCCCCCAGCCCATGTGG + Intergenic
914084766 1:144443124-144443146 TCCCTGGCCCCCAGCCCATGTGG - Intronic
914190774 1:145408290-145408312 TCCCTGGCCCCCAGCCCATGTGG - Intergenic
914363456 1:146957119-146957141 TCCCTGGCCCCCAGCCCATGTGG + Intronic
914488221 1:148130015-148130037 TCCCTGGCCCCCAGCCCATGTGG - Intronic
914588583 1:149085135-149085157 TCCCTGGCCCCCAGCCCATGTGG - Intronic
915101260 1:153502551-153502573 TCCAGGCCCCACCACCCATGTGG + Intergenic
917373810 1:174325917-174325939 TGAAGGGCCCCTAGGCCATGTGG - Intronic
918215923 1:182391897-182391919 TCCCGGGCCCCGCGGCCATTGGG + Exonic
921923078 1:220690269-220690291 TCCCGGGCCCCACGGCCAGGGGG + Exonic
923540941 1:234887766-234887788 TCCAGGGGCTCTTGCCCAGGTGG + Intergenic
1067580693 10:47443747-47443769 GCCAGGACCCCTCCCCCAGGAGG - Intergenic
1067719944 10:48720803-48720825 TCCAGGGACCAGCGCACATGAGG - Intronic
1067796316 10:49324639-49324661 CCCAGGGCCCCTCTCTCCTGAGG + Exonic
1069986267 10:72286367-72286389 TCCACGGCCCTTCCCCCATCGGG + Intergenic
1071474792 10:86016832-86016854 TCCAGGGTCCCTCAACCATGTGG - Intronic
1072898920 10:99390481-99390503 TCCATGGCTCCTCCCCCAAGAGG - Intronic
1076401832 10:130189972-130189994 TCCAGGGCCCCGCGCCAACTGGG + Intergenic
1076814837 10:132909602-132909624 TCCAAGGCCCCTCCTCCATCTGG + Intronic
1078025899 11:7695438-7695460 GCCTGTGCCCCTCTCCCATGTGG + Intronic
1078428015 11:11267098-11267120 CTCACAGCCCCTCGCCCATGGGG - Intergenic
1079387917 11:19997300-19997322 TCCAGGGCCCCTCCAACTTGTGG + Intronic
1080433207 11:32217244-32217266 TCCAGTGGCCCTCACCCCTGTGG - Intergenic
1080605574 11:33862200-33862222 TCCAGGGTCCCTCCCCTCTGAGG - Intronic
1080836480 11:35944806-35944828 CCCAGGGCCCCTCGCCGGTCAGG - Intronic
1081629841 11:44681636-44681658 TCCAGGCCACCCCACCCATGGGG - Intergenic
1082031298 11:47606079-47606101 TCCAGGGACCTTTGCCAATGTGG - Intergenic
1083986697 11:66220354-66220376 CCCGAGGCCCATCGCCCATGTGG - Intronic
1084537341 11:69764834-69764856 TCCAGGACCCCTCCTACATGGGG + Intergenic
1084779213 11:71397576-71397598 TCCAGGGACCCTGGGCCAGGTGG + Intergenic
1085195522 11:74669581-74669603 ACCTGGGCCCTTCGCCCCTGCGG + Intergenic
1088887798 11:114021273-114021295 TACAGGGCCCCTGGGACATGGGG - Intergenic
1089556759 11:119319454-119319476 ACCTGGGCCCCTCACACATGAGG + Intronic
1090226883 11:125077028-125077050 TGCAGGGCCCCTGGGCTATGTGG + Intronic
1094543972 12:31386632-31386654 TCCAGGGCCCATCCCCCCTCGGG - Exonic
1095261688 12:40105733-40105755 TCCTGCGCCGCTCGCCCATCAGG + Exonic
1097245450 12:57605197-57605219 CCCAGGGACCCTTGCCCATCCGG + Intronic
1098882560 12:75931170-75931192 TCCATGCCCACTCACCCATGAGG + Intergenic
1100853617 12:98739097-98739119 TCCAGGGCCCCACAGCCAAGTGG + Intronic
1103704704 12:122865174-122865196 TCCAGGGCCCCTGGCACAGGTGG - Intergenic
1103862319 12:124025041-124025063 GCCAGGGCCCCCGGGCCATGTGG + Intronic
1104931003 12:132339436-132339458 TCTGCGGCCCCTCGGCCATGTGG + Intergenic
1105070151 12:133229477-133229499 TCCAGGGCTCTTGGCCTATGTGG - Intronic
1106117647 13:26831002-26831024 TCCAGGGCCCCTGGCCTGAGGGG - Intergenic
1107833650 13:44396620-44396642 TCCTGGGACCCTTGCCCATGTGG - Intronic
1108521719 13:51252141-51252163 GCCAGCGCCCCTCGCTGATGGGG - Exonic
1109389287 13:61671478-61671500 TCCCGGGACCCTCTCCCAGGTGG + Intergenic
1113682767 13:112255816-112255838 TCCAGGGCCCCTCGGCGTTTTGG - Intergenic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1113927801 13:113951089-113951111 ACCAGGACCACACGCCCATGAGG - Intergenic
1115729588 14:36254263-36254285 ACCAGGACCCCTCACACATGGGG - Intergenic
1117954304 14:61110924-61110946 TCCCTGGCCCCTGGCCCCTGGGG - Intergenic
1119004127 14:70908312-70908334 GCCGGGGCCCCCCGCCCGTGGGG + Intronic
1120025399 14:79578257-79578279 TCCAGTTGCCCTCTCCCATGGGG + Intronic
1120524653 14:85563667-85563689 TCCAGGCCCCTTCTCCAATGTGG + Intronic
1120789173 14:88563311-88563333 TCCAGGCCGCCTCGGCCCTGGGG + Intronic
1122772751 14:104104562-104104584 ACCACGGCCCCCAGCCCATGAGG - Intronic
1122984353 14:105205434-105205456 TCCTGTGCCCCTCCCCCGTGGGG + Intergenic
1124954881 15:34353835-34353857 TCTAGGGCCCCTGGCCTCTGAGG + Exonic
1125163874 15:36679812-36679834 GCCAGGGCCCCTCACCCACATGG + Intronic
1125726286 15:41869954-41869976 TCCGGGGCCTCAGGCCCATGCGG - Exonic
1125796667 15:42408807-42408829 TCCAGGGCCCCTCTTCTATCCGG + Intronic
1127871560 15:63078195-63078217 CCCAGGGCTCCTAGCCCATTAGG - Intergenic
1128582114 15:68817945-68817967 TCCAGGGCCCTGCGCGCCTGTGG - Intronic
1129625388 15:77192650-77192672 TGCTGGGCCCCTGGCCCTTGTGG + Intronic
1132280824 15:100613427-100613449 TTCAGGGCCCCTGGGCCATGTGG - Intronic
1132688300 16:1171348-1171370 CCCAGGGCCACTGGCCCATCTGG - Intronic
1133046131 16:3089363-3089385 TGTAGGGCCGCTCGCCCGTGTGG + Exonic
1134043178 16:11083509-11083531 ACCTGGGCCCCTCCCACATGGGG - Intronic
1135328419 16:21542559-21542581 TACCGAGCCCCACGCCCATGTGG - Intergenic
1135825427 16:25723124-25723146 CCCCGGGTCCCTCCCCCATGAGG + Intronic
1136222177 16:28835794-28835816 GCCAGGGCCCGTCTGCCATGGGG + Intronic
1136338766 16:29628532-29628554 TACCGAGCCCCACGCCCATGTGG - Intergenic
1136477871 16:30524684-30524706 TGTAGGGCCGCTCGCCCGTGTGG + Exonic
1137619981 16:49869739-49869761 TCCAGGGCCCCTCCCTCAACAGG - Intergenic
1137624658 16:49900081-49900103 CCCAGGGCCCCGCACCCACGGGG + Intergenic
1138447943 16:57076531-57076553 TCCAGAGCCCCTGGCCCAGGAGG - Intronic
1140420253 16:74813378-74813400 TGCAGGGCCCCTCGGGCAGGGGG - Intergenic
1141755417 16:85987686-85987708 TCCTGGGACCCTTGGCCATGAGG + Intergenic
1141755732 16:85989468-85989490 TCCAGGGTCCCTCAGCCCTGAGG + Intergenic
1142262249 16:89048453-89048475 GCCAGTGCCCCTCCCCCATGCGG - Intergenic
1142494124 17:297225-297247 CCCAGGGCACCTCTCCCATCTGG + Intronic
1143512737 17:7405193-7405215 TCCCGGGCCCCGGGCCCCTGGGG + Intronic
1144850432 17:18241381-18241403 CCCAGGGCCCCTCACCCTCGTGG - Intronic
1145797176 17:27662487-27662509 TCCAGGGCTCCTGGCCCACATGG - Intergenic
1146085363 17:29823534-29823556 TCCAGGGTACCTCCCCCATGCGG + Intronic
1146183247 17:30710003-30710025 TCCCGGGCCCCTCGCCAGTGGGG - Intergenic
1146212923 17:30956183-30956205 TGCAGGGCCCCTCTGCCCTGGGG + Intronic
1147131956 17:38415032-38415054 TTCAGGGACCCTGGCCCATGAGG + Intergenic
1151364994 17:73611482-73611504 CCCAGGGCACCTCTCCCAGGGGG - Intronic
1152246133 17:79185453-79185475 TCCAGGGCACCACGCTCACGAGG - Intronic
1152433264 17:80260897-80260919 TCCAGGCCCGCTCGCACCTGCGG - Exonic
1152607845 17:81301968-81301990 TCGAGGGCACCTGGGCCATGCGG - Intergenic
1156456933 18:37300012-37300034 TCCAGCTTCCCTGGCCCATGAGG + Intronic
1160143954 18:76348967-76348989 TCGAGGGCCCATCTCTCATGGGG - Intergenic
1160833424 19:1113656-1113678 TCCAGGACCCCGGGGCCATGCGG + Exonic
1161079289 19:2302609-2302631 TGCAGGGCCCCTCGCTCTGGTGG + Intronic
1161612403 19:5250626-5250648 TCCCGACCCCCTCGCCCAAGCGG - Intronic
1161767778 19:6216568-6216590 TCCAGGGCCCCTCGCCCATGAGG + Intronic
1162775212 19:12975178-12975200 TCCAGGGCCCTTCGAGCAAGGGG - Intergenic
1162806276 19:13139432-13139454 TCCAAGGCCCCCCACCCCTGGGG - Exonic
1162975544 19:14205771-14205793 TCCCAGGCCCCTCGCCAGTGGGG + Intronic
1164771348 19:30811797-30811819 TCCAGGGACCCTGGCTGATGGGG - Intergenic
1165092546 19:33394581-33394603 TCCAGGGGCCCCCGCCCAGGCGG - Intronic
1165148987 19:33750090-33750112 GGCAGGGCCCCTCGCCAAGGGGG + Intronic
1166047637 19:40238771-40238793 TCTAGTGCCCCTCTCCCTTGAGG - Intronic
1166459656 19:42975045-42975067 TCCATGGCCTCTCGCATATGAGG - Intronic
1166476972 19:43135091-43135113 TCCATGGCCTCTCGCATATGAGG - Intronic
1168652091 19:58097935-58097957 TGCAGGGCCCCTCACCGATCTGG + Intronic
926143774 2:10384508-10384530 GCAAGGCCCCCTCCCCCATGGGG + Intronic
928126245 2:28618590-28618612 TCAAAGCCCCCTCGTCCATGAGG + Intronic
929127676 2:38536078-38536100 TCCAAGGCCCATCTCCCTTGGGG + Intergenic
929786872 2:44999757-44999779 TCCAGAGCTCCTGGACCATGTGG + Intergenic
930058765 2:47272053-47272075 TCCAGGGCCCCTGGGGAATGTGG - Intergenic
930980868 2:57524354-57524376 TCCAGGAACCCCCTCCCATGTGG - Intergenic
931917233 2:66969465-66969487 TCCAGGGCCCCTTGTGCATTTGG + Intergenic
936089675 2:109492948-109492970 TACAGGGCCCCAGGCCCTTGGGG + Intronic
937259129 2:120574248-120574270 TCCAGGTCCCCTCCCTCTTGGGG - Intergenic
938473281 2:131585805-131585827 CCCAGTGTCACTCGCCCATGGGG + Intergenic
940674581 2:156713120-156713142 TCCTGGGCCCCTCGCCTTTTAGG + Intergenic
947610502 2:231522358-231522380 TCCAGGGTGCCTCGAGCATGAGG + Intergenic
947774611 2:232697606-232697628 CTCAGCGCCCCTCGCCCAGGAGG - Intronic
948255963 2:236568113-236568135 TCCGGGGTCCCCGGCCCATGTGG + Intronic
948290876 2:236823467-236823489 TCCAGGGCCCCTGGCTCATCAGG - Intergenic
1172230562 20:33333133-33333155 CCCAGCTCCCCTCGCCCACGTGG + Intergenic
1172902051 20:38342514-38342536 TCCAGGTCCCCCAGCCCATTAGG + Intergenic
1173222574 20:41141744-41141766 TCCAGGCCCCCCCGCCCAGCTGG + Intronic
1175395850 20:58661043-58661065 TCCAGGGCCCCGTGCCCAGGCGG - Intronic
1175788856 20:61729041-61729063 TCCAGCCGTCCTCGCCCATGTGG + Intronic
1179163072 21:38913499-38913521 GCCAGGGCCGCACGCCCACGCGG - Intergenic
1179945968 21:44676268-44676290 TCCAGAGTCCCTGACCCATGGGG - Intronic
1180202012 21:46229615-46229637 TCCAGGGCTTCTGGCCCCTGTGG - Intergenic
1181079756 22:20406008-20406030 TGTAGGGCCGCTCGCCCGTGTGG - Exonic
950576062 3:13832780-13832802 TCCAGGGGCCCTGTCCTATGGGG - Intronic
952383401 3:32821426-32821448 TGCAGGGTCTCTCGCCCAGGGGG + Intronic
954428304 3:50455209-50455231 TACTCGGACCCTCGCCCATGCGG + Intronic
954615182 3:51965891-51965913 TCCAGTCCCCCTCTTCCATGAGG - Intronic
954638761 3:52085607-52085629 TCCAAGGGCCCACACCCATGAGG - Intronic
954692067 3:52400933-52400955 CCCAGGGCCCTAGGCCCATGAGG + Intergenic
955524365 3:59805462-59805484 TTCAGGGCACCTCTCCAATGAGG - Intronic
956282570 3:67573588-67573610 TCCAGGGACCCCCTCCCATGTGG - Intronic
961347537 3:126273955-126273977 TCTAGGGGCCCTCGCCCTTGGGG + Intergenic
967871463 3:194233396-194233418 TCCAGGGTGCCTTTCCCATGGGG - Intergenic
968357471 3:198120394-198120416 TCCAGGGTCGCATGCCCATGAGG + Intergenic
968955296 4:3715971-3715993 TCCAGCTCCCGTTGCCCATGGGG + Intergenic
969101754 4:4774766-4774788 TCCAGGGCTCCACACCTATGGGG - Intergenic
971395358 4:26222038-26222060 TCTAGGGCCCCTCGTCAAAGTGG - Intronic
971616398 4:28795450-28795472 TCCAGGGACCCCCTCCCATATGG - Intergenic
973893081 4:55387293-55387315 TCCAGGTCCCCTCTCCACTGTGG + Intergenic
977323684 4:95549215-95549237 TCCGGGTCCCCTCGCCTGTGAGG + Intergenic
979205627 4:118033830-118033852 CCCAGGGCCCCTCGTCCGGGTGG - Intronic
983321710 4:166203145-166203167 TCCAGGGACCCCCTCCCATCTGG - Intergenic
985441068 4:189982856-189982878 TCCAGGGTCGCATGCCCATGAGG - Intergenic
986325128 5:6666991-6667013 GCCAGTGCCGCTGGCCCATGGGG + Intronic
988631278 5:32934183-32934205 TCCAGGGGCCCTGGCTCAAGAGG + Intergenic
1000954620 5:167528244-167528266 TCCAGTGCCCCTAGCTCATTTGG + Intronic
1002537825 5:179887857-179887879 TGCTGGGCCCATTGCCCATGAGG - Intronic
1003372178 6:5539092-5539114 TCCAGGGCCTCAGTCCCATGTGG - Intronic
1004879664 6:19995370-19995392 TCCATGGCCCCTGCACCATGGGG - Intergenic
1005691700 6:28312925-28312947 GATAGGGCCTCTCGCCCATGTGG + Intergenic
1005986810 6:30881007-30881029 TCCGGGGCCCCGGGCCCAGGAGG - Intronic
1007610098 6:43143613-43143635 TCCAGGGCCCCTCACCGTTGAGG - Exonic
1011262881 6:85486950-85486972 TCCTGGGCCCCTTTCCCATCTGG - Intronic
1019042492 6:169118577-169118599 TACAGGGTCCCTGGCCCCTGAGG - Intergenic
1020555374 7:9663875-9663897 TTCAGGGACCCTCTCCCATCTGG + Intergenic
1021986417 7:26102093-26102115 TCCTGGGCCCCAGGCCCAGGAGG - Intergenic
1022440745 7:30430859-30430881 CCCAGGGGCCCTAGCCCTTGTGG - Intronic
1022485449 7:30774068-30774090 TCCATGGCCACTCACCCTTGTGG + Intronic
1023395240 7:39745755-39745777 TCCAGGGCCCCTGGTCAACGAGG - Intergenic
1023715455 7:43039411-43039433 TGCAGGGGCCCTTTCCCATGCGG + Intergenic
1023862929 7:44226565-44226587 CCGAGGGCCCCTCGCCAGTGGGG - Exonic
1024011292 7:45269112-45269134 TCCAGGACACATCTCCCATGGGG + Intergenic
1025026375 7:55519693-55519715 TCCAGGGCCCCCACGCCATGGGG + Intronic
1028756509 7:94440991-94441013 TCCAGGGACCCTCTCCCACCTGG + Intergenic
1029880041 7:103798649-103798671 CCCAGGACCCCTTTCCCATGAGG + Intronic
1034745860 7:153523581-153523603 TCCAGTGCCTCTCCCTCATGGGG - Intergenic
1035645178 8:1213701-1213723 TCCAAGGGCCCTCTCCCATCAGG + Intergenic
1037882885 8:22581494-22581516 GCCAGAGCCCCTCGCCCCTGCGG + Exonic
1041374035 8:57193828-57193850 TCAAGGGCACCTGGCCCTTGTGG - Intergenic
1041936282 8:63335378-63335400 TCCAGGCCCCCACTCCCAAGAGG - Intergenic
1042530491 8:69810105-69810127 TCCAGTGCCCCAGGCCCAGGTGG + Intronic
1056481546 9:87011764-87011786 GCCCGGCCCCCTCACCCATGCGG + Intergenic
1058417346 9:104802615-104802637 TCCAGGGGTCCTGGCCCTTGGGG + Intronic
1060934852 9:127508905-127508927 CACAGGCCCCCTCGCCCAGGGGG - Intronic
1062237151 9:135515743-135515765 CCCAGGGTCCCTCGCCCTTCCGG - Intergenic
1062536150 9:137021926-137021948 TCCAGGGCTCCTGACCCTTGTGG + Exonic
1062741323 9:138176879-138176901 TCCAGGGTCGCATGCCCATGAGG + Intergenic
1185627319 X:1492059-1492081 CCCAGCACCCCTCGCCCCTGGGG + Intronic
1185734420 X:2486086-2486108 TCCAGGCTGCCTCGTCCATGGGG + Intronic
1186351238 X:8741971-8741993 GCCAGAGCCCCTCACCCAAGTGG - Intergenic
1195245601 X:102992510-102992532 TCCAGGGACCCCCTCCCATTTGG - Intergenic
1196419040 X:115504199-115504221 TCCAGGGCGCCCCGGTCATGGGG - Intergenic
1199074089 X:143510391-143510413 TCCAGGTCCCTTCTCCCAGGTGG + Intronic
1199093088 X:143713626-143713648 TCCAGGTCCCTTCTCCCAGGAGG + Intronic
1199270525 X:145877658-145877680 TCCAGGGCCCCTCTTCGATGAGG - Intergenic