ID: 1161768153

View in Genome Browser
Species Human (GRCh38)
Location 19:6217933-6217955
Sequence AGGTGTGTATGGAGAGCAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 794
Summary {0: 1, 1: 0, 2: 5, 3: 48, 4: 740}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161768153_1161768160 -3 Left 1161768153 19:6217933-6217955 CCAGCTGCTCTCCATACACACCT 0: 1
1: 0
2: 5
3: 48
4: 740
Right 1161768160 19:6217953-6217975 CCTTGGCTGTGGTTCTGGGATGG 0: 1
1: 0
2: 1
3: 42
4: 361
1161768153_1161768161 20 Left 1161768153 19:6217933-6217955 CCAGCTGCTCTCCATACACACCT 0: 1
1: 0
2: 5
3: 48
4: 740
Right 1161768161 19:6217976-6217998 CTCGAAGTCTGAGTCTGAGCTGG 0: 1
1: 0
2: 0
3: 8
4: 83
1161768153_1161768158 -7 Left 1161768153 19:6217933-6217955 CCAGCTGCTCTCCATACACACCT 0: 1
1: 0
2: 5
3: 48
4: 740
Right 1161768158 19:6217949-6217971 CACACCTTGGCTGTGGTTCTGGG 0: 1
1: 0
2: 1
3: 38
4: 200
1161768153_1161768157 -8 Left 1161768153 19:6217933-6217955 CCAGCTGCTCTCCATACACACCT 0: 1
1: 0
2: 5
3: 48
4: 740
Right 1161768157 19:6217948-6217970 ACACACCTTGGCTGTGGTTCTGG 0: 1
1: 0
2: 1
3: 5
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161768153 Original CRISPR AGGTGTGTATGGAGAGCAGC TGG (reversed) Exonic
900134057 1:1106778-1106800 AGGTGTGGAGGGAGAGCTGCAGG + Intronic
901135536 1:6991364-6991386 TGGTGAGTATGGAGAGCAACTGG - Intronic
901631899 1:10652099-10652121 AGGTGACTTTGGAGAGCTGCTGG - Intronic
901843018 1:11965518-11965540 AGCTGTCTAGGGAGAGCAGATGG - Exonic
902148191 1:14420873-14420895 AGGTGTGGAGGGAGAGGTGCGGG - Intergenic
902363735 1:15957361-15957383 CGGTGTGTGTGGAGAGGAGGAGG + Intronic
902363745 1:15957400-15957422 CGGTGTGTGTGGAGAGGAGGAGG + Intronic
902363754 1:15957439-15957461 CGGTGTATCTGGAGAGGAGCAGG + Intronic
902800473 1:18826472-18826494 AGGAGTGGGTGGAGTGCAGCAGG + Intergenic
903327614 1:22579995-22580017 AGGTGGGGATGGAGTCCAGCTGG + Intronic
903331097 1:22597633-22597655 AGGTGTGGAGGGAGGGCAGTGGG - Intronic
903572019 1:24313069-24313091 AGTTGTGCCTGCAGAGCAGCAGG - Intergenic
903624569 1:24721515-24721537 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
904238913 1:29131448-29131470 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
905358331 1:37400588-37400610 AGGGGTGAATGCAGAGCAGCTGG + Intergenic
905615118 1:39391413-39391435 ATGTGTGTGTGGAGAGGAGGAGG + Intronic
905662131 1:39735749-39735771 AGGTGGGAATGGAGAGGGGCTGG + Intronic
906056021 1:42917358-42917380 AGGTGAGCATGGAGAGTCGCGGG - Intergenic
907371180 1:54004594-54004616 AGGTGTGTAGGGAGAGGCGTGGG - Intergenic
907759536 1:57343777-57343799 AGGTGTGGATGGAGAGGCGTCGG - Intronic
907980024 1:59472118-59472140 AGGTGTGGAAGGAGAGGCGCGGG + Intronic
908162506 1:61424442-61424464 ATGTGTCTATGATGAGCAGCAGG + Intronic
909335207 1:74465270-74465292 AGGTGTGGAGGGAGAGGCGCAGG + Intronic
909487114 1:76186595-76186617 AGGTTTGTATGGAGATAAGCAGG - Intronic
909608764 1:77532094-77532116 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
910334301 1:86110549-86110571 AGGTGTGGAGGGAGAGGCGCAGG + Intronic
910478856 1:87636597-87636619 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
910498330 1:87858802-87858824 TGGTGAGTATGTAGAGCAACAGG + Intergenic
910693171 1:89984988-89985010 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
911001420 1:93170258-93170280 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
915042636 1:152981698-152981720 AGGTGGGTGGGGAGGGCAGCAGG + Intergenic
915078910 1:153337932-153337954 AGGTGTGGAGGGAGAGCAGCTGG - Intronic
916069528 1:161161714-161161736 AGGTGGGAGTGGTGAGCAGCTGG + Intronic
917348906 1:174056743-174056765 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
917406257 1:174711208-174711230 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
918002205 1:180508591-180508613 AGGTGTGGAGGGAGAGGAGCAGG + Intergenic
918512046 1:185322052-185322074 AGGTGTGGAGGGAGAGACGCGGG - Intergenic
918793139 1:188857619-188857641 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
918951971 1:191151415-191151437 AGGTGTGGAGGGAGAGGCGCTGG + Intergenic
918993856 1:191731804-191731826 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
919049826 1:192499431-192499453 AGGTGTGGAGGGAGAGGCGCCGG - Intergenic
919207027 1:194431344-194431366 AGGTGTGGAGGGAGAGATGCTGG - Intergenic
919250807 1:195054311-195054333 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
919297806 1:195723259-195723281 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
919465659 1:197919863-197919885 GGGTGTGCAGGGAGAGCGGCAGG - Intronic
919483635 1:198119778-198119800 AGGTGGTTATGGAGAGAAGGAGG - Intergenic
919816385 1:201443413-201443435 AGGTGTGGATAGAGAGAAGCTGG + Intergenic
919853811 1:201692187-201692209 AGGTGTGGATATAGAGAAGCAGG + Intronic
920335807 1:205244452-205244474 AAGTGTTTATTGAGAGCAGGAGG + Intronic
920604900 1:207371767-207371789 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
920976347 1:210789235-210789257 AGCTGAGTATGGAGAGGAGGGGG - Intronic
921650119 1:217667948-217667970 AATTGTCTGTGGAGAGCAGCAGG - Intronic
922784154 1:228274840-228274862 AGGTGAGTGTGGGGGGCAGCAGG + Exonic
923172633 1:231431144-231431166 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
923193486 1:231642276-231642298 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
924010772 1:239663175-239663197 AGGTGAGAGTGGAGAGCAGCAGG - Intronic
924952130 1:248894937-248894959 AGGTGTGTATGGCCTGCATCTGG + Intergenic
1063300431 10:4845286-4845308 AGGTGTGGAGGGAGAGACGCCGG - Intronic
1063309336 10:4937751-4937773 AGGTGTGGAGGGAGAGGTGCAGG - Intronic
1063379559 10:5575862-5575884 AGGTGTGACTGGAGAGGACCTGG + Intergenic
1063409722 10:5828077-5828099 AGGTGTGTACAAAGAGCAGCTGG + Intronic
1065357597 10:24857452-24857474 AGAGGTGTCTGGACAGCAGCTGG + Intronic
1065752204 10:28897147-28897169 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1065895859 10:30162844-30162866 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1066234002 10:33468023-33468045 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1066235506 10:33480835-33480857 AGGTGTGGAGGGAGAGGCGCCGG - Intergenic
1066575443 10:36819921-36819943 AGGTGTGGAAGGAGAGGCGCAGG + Intergenic
1068136459 10:52954503-52954525 AGGTGAGCAAGGAGATCAGCAGG + Intergenic
1068211297 10:53924172-53924194 AGGTGTGGAGGGAGAGGCGCAGG + Intronic
1068216633 10:53990801-53990823 AGGTGTGGAGGGAGAGGTGCAGG + Intronic
1068290996 10:55001365-55001387 AAGTGTGTGTGTAGAGCAGGGGG - Intronic
1068460337 10:57321510-57321532 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1068461646 10:57337077-57337099 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1068554996 10:58448626-58448648 AGGTGTGGAGGGAGAGGTGCAGG - Intergenic
1068721063 10:60246846-60246868 GGGTGTGTGTGGGGAGAAGCAGG - Intronic
1069988638 10:72300598-72300620 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1070564103 10:77590558-77590580 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1070942596 10:80359860-80359882 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1071055668 10:81505816-81505838 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1071332150 10:84571190-84571212 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
1071778224 10:88813208-88813230 ACGTGTGGATGGGGAACAGCAGG + Exonic
1071901023 10:90120146-90120168 AGGTGTGGATGGAGAGGCGCGGG - Intergenic
1072278461 10:93845178-93845200 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1074316971 10:112369777-112369799 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1074876121 10:117614628-117614650 AGGCATGTTTGAAGAGCAGCGGG + Intergenic
1074979998 10:118611751-118611773 AGGTCTGTAGTGAGAGCAGCAGG + Intergenic
1074996386 10:118760518-118760540 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1075023844 10:118969489-118969511 ATGTGTGTTTGTACAGCAGCTGG + Intergenic
1075095691 10:119469162-119469184 AGGTGACTGTGGTGAGCAGCAGG - Intergenic
1075305683 10:121365567-121365589 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
1075488486 10:122846969-122846991 AGGGGAGGATGGAGAGGAGCAGG + Intronic
1076549676 10:131270307-131270329 AGCTGAGTTTGAAGAGCAGCAGG + Intronic
1077332336 11:1989137-1989159 GGGTGTGTCTGGAGAGAAGGGGG + Intergenic
1077790237 11:5431279-5431301 AGGTGTGAATGAAGAACATCTGG + Intronic
1078018797 11:7638233-7638255 AGGTAATTATGAAGAGCAGCCGG + Intronic
1079909669 11:26294040-26294062 TGGTCTGTTTGGAGAGCTGCAGG + Intergenic
1081047728 11:38296648-38296670 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1081977517 11:47245082-47245104 AGCTCTGGGTGGAGAGCAGCAGG + Intronic
1082106694 11:48228899-48228921 AGGTGTGGAGGGAGAGGAGTGGG + Intergenic
1082734886 11:56845187-56845209 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1082832702 11:57630917-57630939 AGATGTGTGAGGTGAGCAGCTGG - Intergenic
1083074331 11:60020587-60020609 AGGTGTGGAGGGAGAGGCGCCGG - Intergenic
1083309138 11:61775599-61775621 ACGTGGGTATGGAGAGGATCTGG + Intronic
1084210418 11:67619029-67619051 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1084268186 11:68015499-68015521 AGGGGGGCATGGAGGGCAGCTGG + Intronic
1085465814 11:76722521-76722543 AGGTGTGTATGCAGGGCACAGGG - Intergenic
1086001123 11:81987046-81987068 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1086124243 11:83333596-83333618 AGGTGAGTATGGAGGGGAGTTGG - Intergenic
1086210158 11:84308906-84308928 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1086552461 11:88069040-88069062 AGGTGTGGAGGGAGAGATGCAGG + Intergenic
1087682380 11:101231706-101231728 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1087977298 11:104565305-104565327 AGGTGTGGAGGGAGAGGTGCGGG - Intergenic
1088583497 11:111337035-111337057 AGGTGTGTATAGGGAGGGGCTGG - Intergenic
1088626142 11:111732038-111732060 GGGTGGGGAAGGAGAGCAGCAGG + Intronic
1089377626 11:118005773-118005795 AGGAGTGGATGCAGAGGAGCAGG - Intergenic
1089868301 11:121651022-121651044 AGGAGTGTCTGGAGAGCAGGAGG + Intergenic
1090274428 11:125409642-125409664 GGAGGTGTGTGGAGAGCAGCCGG + Intronic
1090588222 11:128237080-128237102 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1090782688 11:130021662-130021684 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1090836400 11:130457384-130457406 AGGTGTGTATGGAGTGACACTGG + Intronic
1091086630 11:132727518-132727540 GGGTGTGCCAGGAGAGCAGCTGG - Intronic
1091092571 11:132786098-132786120 TGGTCTGTAAGGAGAGCAGCTGG - Intronic
1202815318 11_KI270721v1_random:44313-44335 GGGTGTGTCTGGAGAGAAGGGGG + Intergenic
1091402282 12:188445-188467 AGGTGTGGAGGGAGAGGCGCTGG - Intergenic
1091936720 12:4440751-4440773 AGATGGGGCTGGAGAGCAGCGGG - Intronic
1092133925 12:6132607-6132629 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1092366510 12:7881269-7881291 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
1092545894 12:9450755-9450777 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1092732433 12:11547282-11547304 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1093346234 12:18040244-18040266 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
1093524812 12:20093634-20093656 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1093583307 12:20807800-20807822 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1093793683 12:23285935-23285957 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1093940357 12:25047598-25047620 AGGTGAGGAGGGAGAGCATCAGG - Intronic
1094327525 12:29256633-29256655 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
1094374859 12:29779064-29779086 AGGTGTGTATGCAGCTCTGCAGG - Intronic
1094405396 12:30110819-30110841 AGGTGTGGAGGGAGAGACGCAGG - Intergenic
1094507062 12:31071318-31071340 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1095478642 12:42611148-42611170 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1095533939 12:43224312-43224334 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1095605324 12:44060627-44060649 AAGTATGTCTGGAGAGGAGCAGG + Intronic
1095990809 12:48033382-48033404 ATGTTTGTTTGGGGAGCAGCCGG + Intergenic
1096072382 12:48782534-48782556 AGGTAGGGATGGAGGGCAGCAGG - Intronic
1096925105 12:55135485-55135507 AGGTGTGTGTGGAGTCTAGCAGG - Intergenic
1097222999 12:57461453-57461475 AGGTGTGTATGGGGAGGAGGAGG - Intronic
1097547539 12:61023403-61023425 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1097981976 12:65744349-65744371 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1099192408 12:79573908-79573930 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1099437284 12:82659587-82659609 AGGTGTGGAGGGAGAGTCGCAGG - Intergenic
1100078881 12:90824052-90824074 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1100266995 12:92986895-92986917 AGATTTGAATGGAGAGGAGCCGG - Intergenic
1100600605 12:96108894-96108916 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1100734658 12:97513108-97513130 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1102161080 12:110769510-110769532 AGGTGTATTTTGAGAGCAGATGG - Intergenic
1102387273 12:112520260-112520282 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1102903986 12:116660715-116660737 AGGTGTGGAGGGAGAGACGCAGG + Intergenic
1103267259 12:119641090-119641112 AGGTTTCTAGGAAGAGCAGCAGG + Exonic
1104094443 12:125544199-125544221 TGGTGGGTAGGGAGAGCATCAGG + Intronic
1104373839 12:128247237-128247259 AGGTGTGGAGGGAGAGGTGCAGG + Intergenic
1104746880 12:131216160-131216182 GGGTGTCTGGGGAGAGCAGCTGG - Intergenic
1104785737 12:131447023-131447045 GGGTGTCTGGGGAGAGCAGCTGG + Intergenic
1105409810 13:20161690-20161712 AAGTGTGTCTGAAGAGAAGCAGG - Intergenic
1106163339 13:27219753-27219775 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
1108275721 13:48807596-48807618 TGGTGTGGCTGGAGAGAAGCGGG - Intergenic
1108362335 13:49678650-49678672 AGGTGTGGAGGGAGAGGCGCCGG - Intronic
1108644018 13:52408446-52408468 AGGTGTGGAGGGAGAGGCGCTGG - Intergenic
1108855515 13:54788010-54788032 AGGTGTGGAGGGAGAGGTGCAGG - Intergenic
1108856560 13:54800049-54800071 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1108991175 13:56659480-56659502 AGGTGTGGAGGGAGAGGTGCAGG - Intergenic
1109152157 13:58859225-58859247 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1109171677 13:59105740-59105762 GGGTGTGAATGGTGAGGAGCTGG - Intergenic
1109563199 13:64077865-64077887 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1109854339 13:68108086-68108108 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1109858790 13:68170969-68170991 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1109884346 13:68523932-68523954 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1110854239 13:80278989-80279011 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1110913969 13:80998799-80998821 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1111333531 13:86792254-86792276 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1111556212 13:89884197-89884219 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1111747649 13:92290878-92290900 AGGTGTGGAGGGAGAGGCGCTGG + Intronic
1112077796 13:95931807-95931829 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1112496361 13:99908263-99908285 AGGTGTGTAAACAGAGCAGATGG - Intergenic
1112984777 13:105434797-105434819 AGTTTTGCATGGAGAGCATCAGG - Intergenic
1113174462 13:107546204-107546226 AGGCCTGTCTGCAGAGCAGCAGG - Intronic
1113644831 13:111986956-111986978 ATATTTGTATGGAGAACAGCAGG - Intergenic
1113657245 13:112074687-112074709 CGTTGTTTGTGGAGAGCAGCAGG + Intergenic
1114566326 14:23635791-23635813 AGGTGTGGAGGGAGAGGCGCCGG + Intronic
1114679536 14:24473139-24473161 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1114755255 14:25252609-25252631 TGGTGTGTATGTAGGGCAGCTGG + Intergenic
1115533270 14:34346170-34346192 AGGTGTGGAGGGAGAGGTGCGGG - Intronic
1115620829 14:35138594-35138616 AGGTGTTTATGGAGGTCAGTTGG - Intronic
1116310970 14:43326594-43326616 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1116426485 14:44798579-44798601 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1116900926 14:50361945-50361967 AGGTGTGGAGGGAGAGGCGCAGG + Intronic
1117565602 14:56991056-56991078 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1117742587 14:58833919-58833941 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1117837285 14:59819914-59819936 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
1118050345 14:62019778-62019800 AGGTGTGATTGCAGTGCAGCGGG + Intronic
1118306294 14:64658168-64658190 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1118335494 14:64850311-64850333 AGGTGTGTGTGGACAGCCTCTGG - Intronic
1118932329 14:70254710-70254732 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1119027745 14:71167529-71167551 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1119179752 14:72597894-72597916 AGGAGGGTGTGGAGAGCTGCCGG - Intergenic
1119303717 14:73590804-73590826 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1119740006 14:77008103-77008125 AGGTGTGGGTGAAGGGCAGCAGG + Intergenic
1119877449 14:78072952-78072974 AGGTGTGTGTGGAGGTGAGCAGG - Intergenic
1120058977 14:79959535-79959557 AGGTGGGTAGGGAGAACATCGGG + Intergenic
1120214710 14:81669082-81669104 AGGTGTGGAGGGAGAGGTGCAGG - Intergenic
1121338814 14:93093037-93093059 ATGAGTGTATGGAGAGCTGGGGG - Intronic
1122058304 14:99119848-99119870 AGCTGGGTTTGGAGAGCAGCAGG + Intergenic
1122437263 14:101708556-101708578 GGGTGAGTCTGGACAGCAGCGGG + Intergenic
1122514497 14:102297675-102297697 AGGTGTGGAGGGAGAGGTGCAGG + Intronic
1122627630 14:103092334-103092356 AGGTGCCTGTGGAGAGCAGATGG + Intergenic
1122894858 14:104751856-104751878 AGGTGTGGAGGGAGAGGTGCGGG - Intergenic
1123044063 14:105502935-105502957 AGGTGGGTTTGGAGGACAGCTGG + Intergenic
1124047248 15:26161674-26161696 AGGTGGATATGGACAGCTGCAGG + Intergenic
1124061625 15:26298433-26298455 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1124110633 15:26781996-26782018 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1124957052 15:34366732-34366754 AGGTGGGGATGGAGGGCTGCAGG - Intronic
1126165568 15:45651375-45651397 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1126639635 15:50811958-50811980 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1126997543 15:54462445-54462467 AGGTGTGGAGGGAGAGGTGCAGG + Intronic
1127954034 15:63836805-63836827 AAGTGTGGAGGCAGAGCAGCAGG + Intergenic
1128982587 15:72197933-72197955 AGGTGGGGAAGGAGAGAAGCTGG - Intergenic
1129155249 15:73713621-73713643 AGCTGTGCATGGAGACCTGCAGG + Exonic
1129158301 15:73732516-73732538 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1129196896 15:73973738-73973760 AGGTGTGGAGGGAGAGCCGCGGG + Intergenic
1129208600 15:74052528-74052550 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1129332457 15:74834641-74834663 AGGTAGGTGTGGAGAGCAGTGGG - Intergenic
1129690805 15:77712270-77712292 AGGATTGTAAGGAGAGGAGCTGG - Intronic
1129724429 15:77894343-77894365 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1131012741 15:89032024-89032046 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1131250225 15:90825511-90825533 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
1131472863 15:92711388-92711410 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
1131846162 15:96492208-96492230 AGGTGTGGAGGGAGAGGCGCTGG - Intergenic
1131892209 15:96984480-96984502 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1131892224 15:96984530-96984552 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1131992417 15:98104594-98104616 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1132098902 15:99008606-99008628 AGGTGTGGAGGGAGAGACGCGGG - Intergenic
1132574781 16:659366-659388 AGGTGGCGATGGTGAGCAGCAGG + Exonic
1132836865 16:1958571-1958593 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1133234242 16:4380436-4380458 GGGTGTGTAAGCAGAGAAGCTGG - Intronic
1133300166 16:4777735-4777757 AGGTGTGTGTTGAGAGCCGCTGG + Exonic
1133362685 16:5186692-5186714 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1134070165 16:11255777-11255799 AGGGGGGCGTGGAGAGCAGCCGG + Intronic
1134309068 16:13059523-13059545 AGGTGGGGAGGGAGAGCATCAGG + Intronic
1134560460 16:15204776-15204798 TGGTGTCCCTGGAGAGCAGCTGG - Intergenic
1134678172 16:16104997-16105019 AGGTGTGGAGGGAGAGGAACGGG - Intronic
1134920999 16:18116390-18116412 TGGTGTCCCTGGAGAGCAGCTGG - Intergenic
1135338984 16:21630320-21630342 AGGTGTGAAGGGAGAGGTGCAGG - Intronic
1135774063 16:25240816-25240838 AGAAGTGTATGGAGAGCAAGCGG - Intronic
1136098436 16:27975348-27975370 AGGGGTGGATGGAGAACAGCTGG + Intronic
1138026006 16:53523020-53523042 AGGTCAGTGAGGAGAGCAGCAGG - Intergenic
1138304564 16:55962622-55962644 GGGTGTGGCTGGAGAGGAGCAGG - Intergenic
1139018983 16:62724861-62724883 AGGTGTGGAGGGAGAGACGCGGG + Intergenic
1139676387 16:68526738-68526760 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1140077650 16:71716654-71716676 TGGTGTGTTTGGAGAGCTGCAGG - Intronic
1140480334 16:75259009-75259031 AGGTTTCTAAGGAGAGCAGGAGG - Intronic
1140692859 16:77501071-77501093 AGGTGGGGAGGGAGAGCATCAGG - Intergenic
1140905540 16:79406163-79406185 AGGCGTGTAGGGAAAGCAGCAGG - Intergenic
1142044922 16:87919326-87919348 AGGTGTGTTTGGAGAGTGGGAGG - Intronic
1142185677 16:88693707-88693729 AGGTGGGAATGGAGAGCCCCTGG - Intergenic
1142368440 16:89663685-89663707 GGGTGTGTCTGAAGGGCAGCAGG + Intronic
1142702066 17:1668835-1668857 AGGTGTGTTGGGAGCTCAGCTGG - Intronic
1143135299 17:4709411-4709433 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1143375740 17:6466078-6466100 AGGTGTGGATGGGGAGCAGCAGG - Intronic
1143552711 17:7640887-7640909 AGGTGTGGAGGGAGAGACGCGGG + Intergenic
1144039083 17:11392529-11392551 AGGTGTGTATGGAGATCACATGG - Intronic
1144128044 17:12220892-12220914 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1144776234 17:17786151-17786173 AGGTGGGTATGGAGACAAACTGG - Intronic
1145050345 17:19654686-19654708 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
1145094803 17:20016456-20016478 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
1145102572 17:20089099-20089121 CGGTGTGTAAGGGGAGCAGTAGG + Intronic
1147689904 17:42308660-42308682 AGCAGGGTGTGGAGAGCAGCTGG - Intronic
1148023338 17:44568207-44568229 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1148989985 17:51657472-51657494 AGGTGGGTCTGGAGAAAAGCAGG + Intronic
1149099295 17:52884329-52884351 AGGTGTGGAAGGAGAGGCGCGGG - Intronic
1149916351 17:60613604-60613626 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
1150682475 17:67294740-67294762 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1150792208 17:68207848-68207870 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1151354783 17:73551810-73551832 AGCTGAGTTTGGAAAGCAGCGGG - Intronic
1151397870 17:73836557-73836579 AGGTATGCAGGGAGAGCCGCTGG - Intergenic
1151575251 17:74949883-74949905 AGGTGTGTGGGGAGAGGAGCTGG - Exonic
1151608292 17:75154123-75154145 AGGAATGAATGGAGAGCAGCAGG + Intronic
1152145692 17:78567397-78567419 AGGTGTGAATGAGGAGGAGCTGG + Intronic
1152240284 17:79157348-79157370 AGGGGTGCATGGACGGCAGCTGG - Intronic
1152931398 17:83111960-83111982 AGGTGTGTATAGAGCGGGGCGGG + Intergenic
1154057285 18:11024016-11024038 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
1154171594 18:12056733-12056755 AGTAGTGTATGGGGAGTAGCGGG + Intergenic
1154231468 18:12559457-12559479 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1154942987 18:21132826-21132848 AGGTGTGGAGGGAGAGGAGCGGG - Intergenic
1155806341 18:30175488-30175510 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1156079473 18:33316218-33316240 AGGTGTGGAGGGAGAGGCGCCGG + Intronic
1156253352 18:35373392-35373414 AGATGTGTGTGGTGAGCAGAGGG + Intronic
1156629093 18:38944773-38944795 AGGTGTGGAGGGAGAGGTGCGGG - Intergenic
1156657790 18:39309083-39309105 AGGTGTGGAGGGAGAGGTGCTGG + Intergenic
1156854557 18:41766657-41766679 AGGTGTGTAAGGAGAACTGATGG + Intergenic
1157856935 18:51112175-51112197 AGGTGTGGATGGAGAGGCACGGG - Intergenic
1158282341 18:55841065-55841087 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1159289282 18:66395812-66395834 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1159322183 18:66866690-66866712 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1159670246 18:71212848-71212870 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1160200101 18:76788903-76788925 AGGTGTGGAGGGAGAGGTGCGGG - Intergenic
1160451683 18:78970733-78970755 AGGTGGGGAAGGAGAGGAGCAGG - Intergenic
1160612203 18:80097193-80097215 AGGTGTGGAAGGAGAGAAACAGG - Intergenic
1160728645 19:630327-630349 GCGTGTGTCTGGAAAGCAGCGGG - Intronic
1161768153 19:6217933-6217955 AGGTGTGTATGGAGAGCAGCTGG - Exonic
1162091130 19:8280723-8280745 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1162093364 19:8295561-8295583 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1164425941 19:28142010-28142032 GGGAGTGTCTGGATAGCAGCTGG - Intergenic
1164855432 19:31517203-31517225 AGGGTTGCATGGACAGCAGCTGG - Intergenic
1165415571 19:35691430-35691452 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1165426183 19:35746650-35746672 AGGGAAGTCTGGAGAGCAGCCGG + Intronic
1165846547 19:38821487-38821509 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
1166303472 19:41924828-41924850 CGGTGTTTCTGGAGAGAAGCAGG + Intronic
1166889178 19:45979885-45979907 GGGTCTGTAGGGGGAGCAGCAGG + Intergenic
1167087488 19:47320269-47320291 AGGAGGGTATGGTCAGCAGCAGG - Exonic
1168121025 19:54252593-54252615 AGTTGTGTGTGCAGGGCAGCTGG - Intronic
1202648786 1_KI270706v1_random:162550-162572 GGGCGTGTTTGGAGAGTAGCTGG + Intergenic
924967340 2:90982-91004 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
924977515 2:191713-191735 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
925814260 2:7732369-7732391 AAGTGGGAATGGAGAGGAGCAGG - Intergenic
926161935 2:10495429-10495451 AGGTGAGGATGGAGAGCAACTGG - Intergenic
926367903 2:12150424-12150446 AGGTGCGCATGGGGAGAAGCAGG - Intergenic
926474809 2:13308661-13308683 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
926850630 2:17193544-17193566 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
927137392 2:20106898-20106920 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
927541768 2:23918511-23918533 CAGTGTGTAGGGAGAGGAGCAGG - Intronic
927680736 2:25137346-25137368 AGATGTGTCTGTAGAGCTGCTGG - Exonic
927777766 2:25915491-25915513 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
927900391 2:26814461-26814483 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
927912192 2:26907595-26907617 GGGTGCGTGTGGGGAGCAGCTGG - Intronic
928880542 2:36092231-36092253 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
929109836 2:38397301-38397323 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
929804634 2:45134089-45134111 AGATGTGTATGAAGATCAGTTGG + Intergenic
930258145 2:49115058-49115080 AGATGTGCATGGAAAGGAGCTGG + Intronic
931106934 2:59066918-59066940 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
931157824 2:59655354-59655376 CGGTGAGTATTGAGAGCAGAGGG - Intergenic
932178242 2:69622073-69622095 AGGTGTGGAGGGAGAGGTGCGGG + Intronic
932768837 2:74489322-74489344 AGGAGGGATTGGAGAGCAGCTGG + Intronic
933166924 2:79086791-79086813 ATGTGAGTGAGGAGAGCAGCAGG - Exonic
933511505 2:83246296-83246318 AGGTGTGGAGGGAGAGGGGCAGG - Intergenic
933712184 2:85334721-85334743 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
934085087 2:88503128-88503150 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
934976917 2:98809214-98809236 AGGAGAGTAGGGAGATCAGCAGG + Intronic
935109167 2:100076126-100076148 GGGTATGGATGCAGAGCAGCTGG + Intronic
935790271 2:106584409-106584431 AGGTGTGAAGGGAGAGGCGCCGG + Intergenic
935836860 2:107064395-107064417 AGGGATGAATGGAGAACAGCAGG + Intergenic
936172739 2:110190563-110190585 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
937042937 2:118835418-118835440 AGGGGTGACTGGAGAGCAGCGGG + Intergenic
937181098 2:119996973-119996995 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
937403460 2:121606050-121606072 ATGTGTGTCTGAAGAGCAGCTGG + Exonic
937425054 2:121791839-121791861 AGAGGTGTATTCAGAGCAGCTGG + Intergenic
937716277 2:125037325-125037347 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
937989973 2:127656904-127656926 TGGGGTGTATGGAGAGCAGTAGG - Intronic
938177217 2:129144610-129144632 AGGTGTGGAGGGAGAGGTGCCGG - Intergenic
938664896 2:133524623-133524645 AGGTGCACATGGAGAGCAGTGGG - Intronic
938728739 2:134129932-134129954 AGGTGTGGAGGGAGAGGCGCAGG + Intronic
938777361 2:134553742-134553764 AGCTGTGCATGGTGACCAGCTGG + Intronic
938931239 2:136088393-136088415 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
939262606 2:139829638-139829660 AGGTGGTTATTGAGAGCAGCAGG - Intergenic
939275250 2:139991069-139991091 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
940485607 2:154291668-154291690 AGGTGTGGAGGGAGAGGTGCGGG - Intronic
940907056 2:159179111-159179133 TGGCTTGTATGGAGAGCAGACGG + Exonic
941068390 2:160928788-160928810 AGGTGTGTAGGGAGAGGAAAAGG + Intergenic
941476631 2:165957438-165957460 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
942049054 2:172121704-172121726 AGGAGTGTATGGATGGCATCTGG + Intergenic
942368704 2:175257373-175257395 AGGTGTGGAGGGAGAGGCGCCGG - Intergenic
943365252 2:186962258-186962280 AGGTGTGGAGGGAGAGACGCCGG + Intergenic
943790013 2:191921647-191921669 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
943942684 2:194020151-194020173 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
944058523 2:195547682-195547704 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
944688244 2:202136710-202136732 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
945069609 2:205977220-205977242 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
945302601 2:208228054-208228076 AGGTGTGGAGGGAGAGGCGCTGG - Intergenic
945363820 2:208926627-208926649 TGGTGAGTATGAAGAGAAGCTGG + Intergenic
945385574 2:209195863-209195885 AGGAGGGAAGGGAGAGCAGCAGG + Intergenic
945664260 2:212721433-212721455 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
946053955 2:216885239-216885261 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
946376467 2:219312810-219312832 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
946929106 2:224655288-224655310 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
947536357 2:230942506-230942528 AGGTGTGGGGGGAGAGCGGCAGG + Intronic
947572765 2:231249036-231249058 AGGTGAGTAGGGAGAGAAGAAGG + Intronic
948770449 2:240248953-240248975 AGGTGAGTATGGGGGGCAGAGGG + Intergenic
948820057 2:240538271-240538293 AGGTGTGGAGGGAGAGGCGCAGG + Intronic
1168980427 20:1998875-1998897 TGGTGTGTTTGAGGAGCAGCAGG - Intergenic
1169044613 20:2525394-2525416 AGGTGAGGATGGAGAGCATCTGG + Intergenic
1169630269 20:7622816-7622838 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1170230906 20:14045153-14045175 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
1171870397 20:30520312-30520334 GGGTGTGGTTGGAGAGTAGCTGG + Intergenic
1173300644 20:41799364-41799386 AGCTGAGTATGGAGGGAAGCTGG + Intergenic
1174092241 20:48058764-48058786 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1174162921 20:48564433-48564455 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1174489626 20:50883750-50883772 AGGAGTGAGTGGAGGGCAGCAGG + Intergenic
1174718033 20:52781212-52781234 AGGTTTATGTGGGGAGCAGCAGG - Intergenic
1174718067 20:52781410-52781432 AGGTTTATATGGGGAGCAGCAGG + Intergenic
1176304920 21:5118303-5118325 AGGTGTGGAGGGAGAGCAGCCGG - Intronic
1176603032 21:8809991-8810013 GGGCGTGTTTGGAGAGTAGCTGG - Intergenic
1176663186 21:9660025-9660047 AGGTGTGGAGGGAGAGGTGCAGG + Intergenic
1177549060 21:22597791-22597813 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1177716002 21:24840453-24840475 AGGTGTGTGGGGAGAGGCGCGGG - Intergenic
1178074141 21:29000166-29000188 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1178082250 21:29077488-29077510 AGGTGTGGAGGGAGAGGTGCGGG - Intronic
1178984427 21:37290756-37290778 AGATGTGTATGGATATCAGGCGG + Intergenic
1179250349 21:39666722-39666744 TGGTGTGTTTGAAGAGGAGCAGG - Exonic
1179783945 21:43719309-43719331 GGCTCTGTATGGAGAGCACCCGG - Exonic
1179852134 21:44143727-44143749 AGGTGTGGAGGGAGAGCAGCCGG + Intronic
1180228232 21:46411018-46411040 AGGTGGGTGTGGAGTGCATCCGG + Intronic
1180345318 22:11701548-11701570 GGGCGTGTTTGGAGAGTAGCTGG - Intergenic
1180353095 22:11819789-11819811 GGGCGTGTTTGGAGAGTAGCTGG - Intergenic
1180353139 22:11820080-11820102 GGGCGTGTTTGGAGAGTAGCTGG - Intergenic
1180385150 22:12172568-12172590 GGGCGTGTTTGGAGAGTAGCTGG + Intergenic
1180385808 22:12176302-12176324 GGGCGTGTTTGGAGAGTAGCTGG - Intergenic
1181077701 22:20392727-20392749 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1181800919 22:25347277-25347299 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1182113277 22:27739578-27739600 AGGTGGGTAGGGAGTCCAGCGGG - Intergenic
1183001617 22:34864339-34864361 AGGTGTGTATGGAGGGTGGGCGG - Intergenic
1183219926 22:36506080-36506102 AGTAGTGTCTGAAGAGCAGCCGG + Exonic
1183390027 22:37540424-37540446 CTGTGTGTTTGGAGAGCAGTGGG - Intergenic
1184745078 22:46451374-46451396 GGGTGTGTCTGGAGATCATCTGG - Intronic
1185180525 22:49358228-49358250 AGTTGTGTTTGCAGAGGAGCTGG - Intergenic
949418396 3:3837631-3837653 TGATGTGAATGGACAGCAGCAGG + Intronic
949725574 3:7040683-7040705 AGGTGTGTCTTGGGACCAGCAGG + Intronic
950068978 3:10136736-10136758 AGGTGTGGAGGGAGAGGTGCGGG - Intergenic
950188236 3:10958560-10958582 AGCTGTGGAAGGAGAGCTGCTGG - Intergenic
950470131 3:13179745-13179767 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
950492444 3:13314277-13314299 AGGTCAGTGTGGAGAGGAGCAGG - Intergenic
950601191 3:14037188-14037210 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
950632600 3:14293197-14293219 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
951415401 3:22416942-22416964 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
951551915 3:23882905-23882927 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
951734761 3:25851755-25851777 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
951849664 3:27125028-27125050 AGGTGTCTATTCAGAGCAGGAGG - Intronic
952076277 3:29701567-29701589 AGGTGTGGAGGGAGAGGCGCAGG + Intronic
952142757 3:30498242-30498264 AGGATGGTATGGAGAGGAGCTGG - Intergenic
953830110 3:46289709-46289731 AGATGGGTGTGGAGAGCAGAGGG + Intergenic
954089368 3:48272293-48272315 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
955688748 3:61569651-61569673 AGGAGTGTATGGAAAGCGGACGG + Intronic
956030096 3:65028229-65028251 AAGTGTGCATAGAGAGCAACTGG + Intergenic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
957121814 3:76103455-76103477 AGCTGTGTATTGTGAGCAGAGGG - Intronic
957209468 3:77240454-77240476 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
957446101 3:80314493-80314515 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
957919899 3:86733448-86733470 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
958080439 3:88739781-88739803 AGCTGTGTATGTACAGCAACAGG + Intergenic
958524648 3:95240517-95240539 AGGTGAGCATGCAGACCAGCAGG + Intergenic
958810788 3:98858294-98858316 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
959430908 3:106253933-106253955 AAGTGTGTTTGGAGGGTAGCTGG - Intergenic
959538308 3:107512257-107512279 AAGTGTGAATGGAGAAGAGCTGG - Intergenic
960199443 3:114813024-114813046 AGGTGTGGAGGGAGAGGTGCGGG - Intronic
960945130 3:122961163-122961185 AGGTGTGGATGGACAGTAGGGGG - Exonic
961461995 3:127056476-127056498 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
962177285 3:133167762-133167784 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
962998097 3:140651414-140651436 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
963397845 3:144756876-144756898 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
963651863 3:147989750-147989772 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
963745607 3:149121700-149121722 AGATGAGTATGGGGAGCAACTGG - Intergenic
963760554 3:149284011-149284033 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
964064026 3:152559426-152559448 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
964138394 3:153370129-153370151 AGGTGTGGAGGGAGAGGTGCGGG - Intergenic
964375015 3:156041309-156041331 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
964376225 3:156051768-156051790 AGGTGTGGAGGGAGAGGCGCTGG + Intronic
964378491 3:156073151-156073173 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
965003484 3:162987341-162987363 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
965092210 3:164179243-164179265 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
965139220 3:164814242-164814264 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
965744248 3:171907420-171907442 AGGTGTGGAGGGAGAGGCGCCGG - Intronic
965943527 3:174212342-174212364 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
966425497 3:179775859-179775881 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
966548996 3:181183357-181183379 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
966717771 3:183030696-183030718 AAGTGTGTATGTTGAGAAGCTGG - Intronic
967457887 3:189710809-189710831 AGCTGTGTAAGAAGAGCAGGAGG - Intronic
967718305 3:192789022-192789044 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
968119517 3:196115107-196115129 AGGTGGGTACTGGGAGCAGCAGG + Intergenic
968483599 4:848354-848376 GGTTATGTGTGGAGAGCAGCGGG - Intergenic
968717215 4:2169305-2169327 AGGTGTGAAGGATGAGCAGCAGG + Intronic
968882468 4:3308509-3308531 AGGTGTATGGGGAGAACAGCTGG + Intronic
969303195 4:6309394-6309416 AGGTGTGCAGGGAGAGGCGCGGG - Intergenic
969501102 4:7553646-7553668 AGGTATGGATGGAGACCAGGTGG + Intronic
970182560 4:13415389-13415411 AGGTGTGGAGGGAGAGGCGCAGG + Intronic
970525782 4:16930684-16930706 AGGTATCAATGCAGAGCAGCTGG + Intergenic
971222913 4:24725549-24725571 AGGTGTGTGTGGACAGCACCTGG + Intergenic
971564231 4:28117511-28117533 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
971792391 4:31185340-31185362 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
971798547 4:31259301-31259323 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
972204615 4:36757362-36757384 TGGTGTGTCTGGAGAGAAGGAGG - Intergenic
972344603 4:38182569-38182591 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
972610328 4:40650322-40650344 AGGGGTGTGGGGAGTGCAGCAGG - Intergenic
973374992 4:49280369-49280391 GGGCGTGTTTGGAGAGTAGCTGG + Intergenic
973375891 4:49286391-49286413 GGGCGTGTTTGGAGAGTAGCTGG + Intergenic
973376814 4:49292554-49292576 GGGCGTGTTTGGAGAGTAGCTGG + Intergenic
973377735 4:49298709-49298731 GGGCGTGTTTGGAGAGTAGCTGG + Intergenic
973378678 4:49304989-49305011 GGGCGTGTTTGGAGAGTAGCTGG + Intergenic
973379540 4:49310665-49310687 GGGCGTGTTTGGAGAGTAGCTGG - Intergenic
973380383 4:49316514-49316536 GGGCGTGTTTGGAGAGTAGCTGG - Intergenic
973381332 4:49322827-49322849 GGGCGTGTTTGGAGAGTAGCTGG - Intergenic
973381521 4:49323850-49323872 GGGCGTGTTTGGAGAGTAGCTGG - Intergenic
973382419 4:49329872-49329894 GGGCGTGTTTGGAGAGTAGCTGG - Intergenic
973385958 4:49514484-49514506 GGGCGTGTTTGGAGAGTAGCTGG - Intergenic
973386004 4:49514775-49514797 GGGCGTGGATGGAGAGTAGCTGG - Intergenic
973386084 4:49515213-49515235 GGGTGTGGTTGGAGAGTAGCTGG - Intergenic
973764349 4:54149669-54149691 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
974186757 4:58456922-58456944 AGGTGTGGAGGGAGAGGCGCTGG + Intergenic
974258797 4:59497723-59497745 TGATGAGTATGTAGAGCAGCAGG + Intergenic
974838265 4:67275613-67275635 AGGTGTGGAGGGAGAGTCGCAGG - Intergenic
975033927 4:69658293-69658315 AGGTGTGGAGGGAGAGGAGCAGG - Intergenic
975160665 4:71120918-71120940 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
975898392 4:79121923-79121945 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
975994903 4:80302828-80302850 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
976565501 4:86547310-86547332 AGGTGTGGAGGGAGAGGCGCTGG + Intronic
976690643 4:87864035-87864057 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
976846036 4:89490047-89490069 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
978463652 4:108984722-108984744 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
978466217 4:109012464-109012486 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
978529380 4:109698885-109698907 AGTTGAGAATGGAGAGCAGAGGG - Intronic
978886511 4:113772326-113772348 AGGTGTGGAGGGAGAGGCGCTGG + Intergenic
978944773 4:114482051-114482073 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
979004527 4:115275289-115275311 ATGTATGTATGGAAACCAGCAGG - Intergenic
979780910 4:124650734-124650756 AGGTGTGGAGGGAGAGACGCGGG + Intergenic
979920423 4:126490010-126490032 AGGTGTGGAGGGAGAGGTGCAGG + Intergenic
979949546 4:126874808-126874830 AGGTGTGGAGGGAGAGGTGCCGG - Intergenic
980115182 4:128672653-128672675 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
980739230 4:136929005-136929027 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
980988381 4:139717604-139717626 AGGTGTTTTTGGAGAGGAGGCGG - Exonic
982692744 4:158566934-158566956 AGGTGTGGAGGGAGAGGGGCAGG + Intronic
982700684 4:158657481-158657503 AGGTGTGGAGGGAGAGATGCGGG + Intergenic
983526790 4:168767951-168767973 TGGTGGGTATGGATAACAGCTGG - Intronic
983656700 4:170091221-170091243 AGGTGTGTAGGGAGAGGCACGGG + Intronic
983843220 4:172482242-172482264 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
984069255 4:175092102-175092124 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
984901711 4:184591899-184591921 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
985423579 4:189807257-189807279 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
985516001 5:344908-344930 AGGTGTGTGTGGAGGGCTGTGGG + Intronic
986918989 5:12661897-12661919 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
986993242 5:13578502-13578524 AGGTGTGAAGGGAGAGGCGCTGG + Intergenic
987347468 5:16991308-16991330 AGGTGTGGAAGGAGAGGCGCCGG - Intergenic
987352318 5:17032762-17032784 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
987696563 5:21341386-21341408 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
988020558 5:25614925-25614947 AGGTGTGGAGGGAGAAGAGCAGG - Intergenic
988177222 5:27743452-27743474 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
988291790 5:29296807-29296829 AGGTGTGTAGGGAGAGGCACAGG - Intergenic
988605228 5:32673460-32673482 AGGTGTGGAGGGAGAGGTGCGGG - Intergenic
988755640 5:34245184-34245206 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
989207120 5:38821888-38821910 AGGTGTGGAGGGAGAGGTGCCGG + Intergenic
990057551 5:51603145-51603167 GGGTGTGTTTTGAGAGCAGGTGG - Intergenic
990665749 5:58069480-58069502 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
990782302 5:59378870-59378892 GGATGTGTGTGGAGAGGAGCTGG - Intronic
990869438 5:60415446-60415468 AGGTGTGGAGGGAGAGGTGCAGG + Intronic
990880189 5:60530310-60530332 AGGTGTGGAGGGAGAGGCGCTGG + Intergenic
991330262 5:65485801-65485823 AGGTGTGGAGGGAGAGGTGCAGG - Intergenic
991743891 5:69710955-69710977 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
991753818 5:69844287-69844309 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
991795463 5:70290687-70290709 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
991803435 5:70401014-70401036 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
991823261 5:70586223-70586245 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
991833134 5:70719400-70719422 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
991887830 5:71290206-71290228 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
993492645 5:88570563-88570585 AGATGGGTGTGGAGAGAAGCTGG + Intergenic
993770243 5:91917268-91917290 AGGTGTGGAGGGAGAGGTGCTGG + Intergenic
994411371 5:99410650-99410672 AGGTGTGAAGGGAGAGGTGCTGG - Intergenic
994482456 5:100354597-100354619 AGGTGTGAAGGGAGAGGTGCTGG + Intergenic
994799670 5:104356898-104356920 AGGTGGCTATGGACAGCAGCAGG + Intergenic
995206690 5:109488172-109488194 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
995326440 5:110894356-110894378 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
995597042 5:113758566-113758588 AGGTGAGATTGTAGAGCAGCTGG + Intergenic
995707367 5:114999327-114999349 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
996298594 5:121954321-121954343 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
996530358 5:124521614-124521636 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
996566383 5:124883411-124883433 AGGTGTGGAAAGAGAGCATCAGG - Intergenic
996731150 5:126718597-126718619 AGGTGAGTACGAAGAGCTGCCGG - Intergenic
996747138 5:126854899-126854921 AGGTGTGGAGGGAGAGGCGCCGG - Intergenic
996815536 5:127569446-127569468 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
996988911 5:129604110-129604132 AGGTGGGGAGGGAGAGCATCAGG + Intronic
997044717 5:130300413-130300435 AGTGGTTTATGGAGAGCAGCGGG + Intergenic
998109890 5:139493083-139493105 TGATGTGTGTGCAGAGCAGCAGG + Intergenic
998173686 5:139887198-139887220 AGGGGAGTATGGAGAGGGGCTGG + Intronic
998691728 5:144595124-144595146 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
999363511 5:151006216-151006238 GGGTGGGTTTGGAGAGCAGGAGG - Intergenic
999809541 5:155114833-155114855 AGGTGTGGAGGGAGAGATGCAGG + Intergenic
1000084714 5:157879301-157879323 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
1000085831 5:157886847-157886869 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1000212328 5:159119164-159119186 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1001093881 5:168761365-168761387 AGGTATTCAGGGAGAGCAGCAGG + Intronic
1002576178 5:180175374-180175396 GGATGAGTCTGGAGAGCAGCAGG - Intronic
1002616407 5:180459163-180459185 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1002790768 6:435907-435929 AGGTGTGGAAGGAGAGGCGCAGG - Intergenic
1002817671 6:694618-694640 AGGTGTGGAGGGAGAGGCGCTGG + Intergenic
1003213709 6:4090133-4090155 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
1003284888 6:4725675-4725697 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1003508958 6:6763432-6763454 AGGTGTGTTTGGAGAGGCCCCGG + Intergenic
1003578329 6:7317103-7317125 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1003824875 6:9942166-9942188 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
1003956639 6:11171065-11171087 AGGTGTGGAGGGAGAGGGGCGGG + Intergenic
1004250275 6:14018026-14018048 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1004483259 6:16040686-16040708 AGGTGTGGAGGGAGAGACGCAGG - Intergenic
1005059248 6:21761150-21761172 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1005554278 6:26956959-26956981 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1005561407 6:27045277-27045299 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1006127929 6:31852048-31852070 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1006351136 6:33521855-33521877 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1007547421 6:42704918-42704940 AGGTGGGTAGGAGGAGCAGCAGG + Intronic
1007662411 6:43495020-43495042 AGGTCCCTAAGGAGAGCAGCTGG - Intronic
1009290725 6:61878188-61878210 ATGTGTCTATGCAGGGCAGCAGG - Intronic
1009402720 6:63275299-63275321 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1009418864 6:63443309-63443331 AGGTGTGGAAGGAGAGGCGCGGG - Intergenic
1009746651 6:67825393-67825415 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1010066259 6:71686151-71686173 AGGTGTGGAGGGAGAGGTGCAGG + Intergenic
1010277983 6:73990999-73991021 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1010852722 6:80797532-80797554 AGGTGAGCAGGGAGAGCATCAGG + Intergenic
1011178094 6:84587423-84587445 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1011338384 6:86285145-86285167 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1011974731 6:93282638-93282660 AGGTGTGGAGGGAGAGGGGCAGG + Intronic
1012429770 6:99152266-99152288 AAATGTGTAGGGAGTGCAGCTGG + Intergenic
1012598823 6:101070254-101070276 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
1012819337 6:104065483-104065505 AAGAGTGTATGGAGAGCAATAGG + Intergenic
1012850959 6:104446327-104446349 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
1013665406 6:112342515-112342537 AGATGAGGCTGGAGAGCAGCAGG + Intergenic
1013694855 6:112689760-112689782 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1014088416 6:117373655-117373677 AGGTGTGGAGGGAGAGACGCAGG - Intronic
1014738957 6:125125844-125125866 AGGTGTGGAGGGAGAGGTGCAGG + Intronic
1015717660 6:136208807-136208829 AGGTGGGTTTGGAGACCTGCAGG - Intergenic
1015721747 6:136249937-136249959 CGCTGTGTTTGGAGAGCACCAGG - Intronic
1015886756 6:137925912-137925934 AGTCCTGTATGGAGAGGAGCTGG - Intergenic
1016104765 6:140148489-140148511 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1016183490 6:141175085-141175107 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
1016859097 6:148698950-148698972 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1017929305 6:158938510-158938532 AGGAAGGTAGGGAGAGCAGCAGG + Intergenic
1018616815 6:165694532-165694554 AGGTGGGGCAGGAGAGCAGCGGG + Intronic
1019285798 7:222352-222374 AGTTGGGTACTGAGAGCAGCTGG + Intronic
1019607029 7:1915122-1915144 AGGTATGTGTGGAGAGGTGCTGG + Intronic
1019618388 7:1977487-1977509 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
1020784480 7:12556527-12556549 AGGTGTGGAGGGAGAGGCGCTGG - Intergenic
1021065796 7:16170941-16170963 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
1021133839 7:16942980-16943002 AGGTGTGGAGGGAGAGGAGCTGG + Intergenic
1022174178 7:27857381-27857403 AGGTGTGGAGGGAGAGGCGCAGG - Intronic
1022519069 7:30994371-30994393 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1023181771 7:37492082-37492104 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1023216335 7:37867107-37867129 ATTTGTGTCTGGTGAGCAGCGGG + Intronic
1023575138 7:41619216-41619238 AGGTGGGGAGGGAGAGCATCAGG - Intergenic
1024144846 7:46503521-46503543 AGATGTATTTGGAGACCAGCCGG - Intergenic
1024465862 7:49711245-49711267 AGGTGTGGAGGGAGAGGTGCTGG + Intergenic
1024735860 7:52303286-52303308 AGGTGTGGAGGGAGAGGTGCGGG - Intergenic
1024741741 7:52362642-52362664 AGGTGTGGAAGGAGAGGCGCAGG + Intergenic
1025801322 7:64789218-64789240 AGGTGTGGGAGGAGGGCAGCAGG - Intergenic
1026023739 7:66729471-66729493 AGGTGAGGATGGAGAGCAGGAGG - Intronic
1026516527 7:71077981-71078003 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1027668712 7:81071100-81071122 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
1027674431 7:81141738-81141760 AGGTGTGAAGGGAGAGGAGCGGG + Intergenic
1027706326 7:81537799-81537821 TGGTGAGTATGTGGAGCAGCAGG - Intergenic
1027778925 7:82499604-82499626 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
1028058776 7:86282523-86282545 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1028303329 7:89229097-89229119 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1028727140 7:94100884-94100906 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1029216979 7:98957590-98957612 AGGGGTGCATTGAGAGCAGAGGG - Intronic
1029407051 7:100381719-100381741 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
1029485251 7:100836299-100836321 AGATGTGTGTGGGGAGGAGCAGG + Intronic
1030292656 7:107887978-107888000 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1030367054 7:108657585-108657607 AGGTGTGGAGGGAGAGGTGCAGG - Intergenic
1030772256 7:113488495-113488517 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1031056570 7:116998367-116998389 AGGTGTGGAGGGAGAGGTGCAGG - Intronic
1031109932 7:117596139-117596161 AGGTGTGGAGGGAGAGGCGCTGG + Intronic
1031253172 7:119413697-119413719 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1031513352 7:122674199-122674221 AGGTGTGAAGGGAGAGGTGCGGG - Intronic
1031605559 7:123763540-123763562 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1031902830 7:127429157-127429179 AGGTGTGGAGGGAGAGGCGCAGG + Intronic
1031987776 7:128174491-128174513 CGGTGTGTGCTGAGAGCAGCGGG + Intergenic
1032269360 7:130389483-130389505 AGGTGTGAATGTGGAGCAGGGGG + Intergenic
1032360597 7:131251378-131251400 ATGTGTGAATTGAGAGCAACCGG - Intronic
1032437077 7:131909318-131909340 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1032611847 7:133423738-133423760 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
1032720885 7:134550118-134550140 AGGTGAGTAAGGAGGTCAGCAGG - Intronic
1032786976 7:135208704-135208726 ATGCCTGTATGGAGACCAGCGGG + Intronic
1033065046 7:138146155-138146177 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1033531297 7:142266546-142266568 AGGTGAGTAGGGAGAGGAGAGGG + Intergenic
1033771470 7:144557392-144557414 TAGTGTGTGTGGAGAGCAGAAGG - Intronic
1034102023 7:148458218-148458240 AGGTGTGTCTGGAAAGTAGCTGG - Intergenic
1034275606 7:149822512-149822534 AGGAGTGTGTGTGGAGCAGCTGG + Intergenic
1034967147 7:155398518-155398540 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1035259736 7:157653795-157653817 GGGTGGGTGTGGGGAGCAGCGGG - Intronic
1035259779 7:157653947-157653969 GGGTGGGTGTGGGGAGCAGCGGG - Intronic
1035463940 7:159063500-159063522 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1036123860 8:6045387-6045409 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1036554689 8:9848125-9848147 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1036928690 8:12931674-12931696 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1037542832 8:19888794-19888816 AGCTGTGGGTGGAGAGGAGCTGG - Intergenic
1037916620 8:22777062-22777084 AGGTGAGTGTGCAGAGAAGCAGG + Intronic
1038250837 8:25902903-25902925 ATGGGTGTGTGGTGAGCAGCAGG + Intronic
1038412084 8:27366804-27366826 GGCTGTGTGTGGAGAGCAGAGGG + Intronic
1038650420 8:29397985-29398007 AGGTTTGTATGCAGAGAAGCAGG - Intergenic
1039186249 8:34919923-34919945 AAGTGTTTGTGGAAAGCAGCTGG - Intergenic
1039398162 8:37245144-37245166 TGGTGGAGATGGAGAGCAGCAGG + Intergenic
1039587578 8:38719856-38719878 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1039641720 8:39230036-39230058 AGGTGTGCATGGATGGCACCAGG - Intronic
1040046286 8:42967258-42967280 AGGTGTGTGTGGAGGGCAGCCGG - Intronic
1040583454 8:48716355-48716377 AGGTGTGGATGGAGAGGCGCAGG - Intronic
1040638786 8:49306503-49306525 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1040794138 8:51271232-51271254 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1040804306 8:51377508-51377530 AGGTGTGGAGGGAGAGGTGCAGG + Intronic
1040806872 8:51405148-51405170 AGGTGTGGAAGGAGAGGCGCGGG - Intronic
1041145843 8:54875219-54875241 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1042169516 8:65978149-65978171 AAGTGTGGAGGGAGAGCAGCAGG - Intergenic
1042490095 8:69387394-69387416 TGGTGGGTAGGGAGAGCAGCAGG + Intergenic
1043002117 8:74771963-74771985 AGGTGTGAAGGGAGAGGCGCGGG - Intronic
1043621074 8:82192619-82192641 AGGTGTGGAGGGAGAGGCGCCGG - Intergenic
1043640129 8:82441413-82441435 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1044456034 8:92393919-92393941 AGGTGTGGAGGGAGAGGTGCTGG - Intergenic
1044457116 8:92401497-92401519 AGGTGGGGAGGGAGAGGAGCAGG - Intergenic
1044618088 8:94162827-94162849 AGATGTGTGTGGAGTGCAGGTGG + Intronic
1044853534 8:96452311-96452333 AGGTGTGGAAGGAGAGGCGCGGG + Intergenic
1045306059 8:100957477-100957499 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1045678451 8:104633254-104633276 AGGTGTGGAGGGAGAGGCGCGGG - Intronic
1046621181 8:116531078-116531100 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1046671895 8:117065446-117065468 AGGTATGTAGGGACACCAGCAGG - Intronic
1047124696 8:121948027-121948049 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1048655450 8:136530779-136530801 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1048742802 8:137580671-137580693 AGGTGTGTACTGAGGGCAGCAGG - Intergenic
1049129727 8:140827547-140827569 GGGTGGGGATGGAGAGCAGTAGG + Intronic
1049157668 8:141076678-141076700 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1049443087 8:142618051-142618073 AGGTGTGTGTGGCCAGCAGTGGG - Intergenic
1050294872 9:4195288-4195310 AGGTGTGGAGGGAGAGGCGCGGG + Intronic
1051419744 9:16877423-16877445 AGGTGTGGAGGGAGAGGTGCAGG - Intergenic
1051449444 9:17178754-17178776 AGGTGTGGAGGGAGAGACGCTGG - Intronic
1051549812 9:18315699-18315721 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1051760744 9:20461023-20461045 ATGTGTGGATGGAGAGGAGAAGG - Intronic
1051935815 9:22441021-22441043 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
1052122754 9:24738518-24738540 AGGTGTGGAGGGAGAGACGCGGG + Intergenic
1052313396 9:27092645-27092667 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1055654894 9:78442061-78442083 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
1055925585 9:81507365-81507387 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1056234720 9:84583251-84583273 AGGAGTCTATGGGAAGCAGCTGG - Intergenic
1056328437 9:85501681-85501703 AGGTGTGGATGAAGTGCAGGTGG - Intergenic
1056735901 9:89209394-89209416 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1056743707 9:89282422-89282444 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1057726877 9:97574209-97574231 AGGTGTGGAGGGAGAGGCGCCGG + Intronic
1057933662 9:99218485-99218507 ATCTGTTGATGGAGAGCAGCAGG + Exonic
1058235724 9:102487308-102487330 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1058585404 9:106501661-106501683 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1058727481 9:107817784-107817806 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1058847455 9:108975235-108975257 GGGTCTGTCTGGAGAGCTGCTGG + Intronic
1059891484 9:118809585-118809607 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1059998529 9:119937299-119937321 AGGTGGCTATGGAGAACTGCAGG + Intergenic
1060091314 9:120746370-120746392 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1060305414 9:122406524-122406546 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1060548048 9:124472078-124472100 AGGTGAGGATGGAGAGCATCAGG - Intronic
1060954542 9:127629221-127629243 GGGAGTGTGTGGAGAGCAGTCGG + Intronic
1061159173 9:128883218-128883240 AGGTGTGGAGGGAGAGCACCTGG + Intronic
1062121889 9:134838345-134838367 AGGTGTGAAGGGAGCGCAGAGGG + Intronic
1062177941 9:135174706-135174728 AGGCGTGGCTGGAGAGCAGAGGG - Intergenic
1062287014 9:135777840-135777862 AGCTGGGAATGGAGAGTAGCTGG - Intronic
1062710019 9:137970370-137970392 AGGTGTGTCTGTACAGGAGCTGG - Intronic
1203698669 Un_GL000214v1:118327-118349 GGGTGTGATTGGAGAGTAGCTGG + Intergenic
1203698716 Un_GL000214v1:118618-118640 GGGCGTGTTTGGAGAGTAGCTGG + Intergenic
1203699666 Un_GL000214v1:124916-124938 GGGCGTGTTTGGAGAGTAGCTGG + Intergenic
1203700565 Un_GL000214v1:130908-130930 GGGCGTGTTTGGAGAGTAGCTGG + Intergenic
1203701529 Un_GL000214v1:137218-137240 GGGCGTGTTTGGAGAGTAGCTGG + Intergenic
1203549563 Un_KI270743v1:156246-156268 GGGCGTGTTTGGAGAGTAGCTGG - Intergenic
1203550498 Un_KI270743v1:162411-162433 GGGCGTGTTTGGAGAGTAGCTGG - Intergenic
1203660974 Un_KI270753v1:42603-42625 AGGTGTGCAGGGAGAGGTGCAGG + Intergenic
1203662913 Un_KI270753v1:61740-61762 AGGTGTGGAGGGAGAGGTGCAGG - Intergenic
1203672156 Un_KI270755v1:25812-25834 AGGTGTGGAGGGAGAGGTGCAGG + Intergenic
1186293149 X:8121579-8121601 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1186295676 X:8145277-8145299 AGGTGTGGAGGGAGAGGCGCCGG - Intergenic
1187454550 X:19429706-19429728 AAGTGTGGATGGAGAGAAGGTGG + Intronic
1188111969 X:26204793-26204815 AGGTGTGGAGGGAGAGGCGCCGG + Intergenic
1188166993 X:26874030-26874052 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1189165578 X:38857737-38857759 TGGAGTGTCTGGAGAGCTGCAGG + Intergenic
1189187931 X:39070193-39070215 AGGTGTGGAGGGAGAGGCGCAGG - Intergenic
1189209800 X:39275607-39275629 AGGTGTGGAGGGAGAGGAGTGGG + Intergenic
1189467156 X:41286078-41286100 AGGTGTGGAGGGAGAGACGCGGG - Intergenic
1190047871 X:47127133-47127155 AGGTGTGGAAGGAGAGCATTTGG - Intergenic
1190396299 X:49988525-49988547 GGGTGTGTATAGAGAGCCGGGGG - Intronic
1190730569 X:53223069-53223091 AGGTGTGCATGGCCAGCAGGAGG - Intronic
1190732034 X:53232951-53232973 GGGGCTGTATGGAGAGGAGCTGG - Exonic
1190738338 X:53270377-53270399 TGGTCTGTTTGGGGAGCAGCAGG - Intronic
1191105049 X:56767482-56767504 AGGTGTGGAGGGAGAGCCGCGGG + Intergenic
1192022432 X:67408651-67408673 AGGTGTGGAGGGAGAGGTGCGGG + Intergenic
1193709005 X:84856972-84856994 AGGTGTGGAGGGAGAGGTGCGGG - Intergenic
1195460294 X:105116077-105116099 AGGTGTGAAGGGAGAGGCGCAGG - Intronic
1195909642 X:109876228-109876250 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1196616106 X:117769058-117769080 AGGTGTGAAGGGAGAGGCGCTGG + Intergenic
1197007812 X:121523843-121523865 AAGTTTGGAGGGAGAGCAGCAGG + Intergenic
1197533814 X:127663340-127663362 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1197607879 X:128606595-128606617 AGGTGTGGAGGGAGAGGCGCGGG + Intergenic
1197978716 X:132194085-132194107 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1198256097 X:134925658-134925680 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1198872339 X:141188869-141188891 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1198984325 X:142431861-142431883 AGGTGTGTATGGGGAGCATATGG - Intergenic
1199094879 X:143726587-143726609 AGGTGTGGAGGGAGAGGCGCGGG - Intergenic
1199443721 X:147897343-147897365 AGGTGTGGAGGGAGAGGTGCTGG - Intergenic
1199628071 X:149758559-149758581 AGGTGTGGAGGGAGAGGCGCAGG + Intergenic
1199772207 X:150982489-150982511 GGGTGTGTCAGGAGAGCAGAGGG + Intronic
1201406867 Y:13658587-13658609 AGGTAGCTATGGTGAGCAGCTGG + Intergenic
1201650129 Y:16275961-16275983 AGGTAGCTATGGTGAGCAGCTGG - Intergenic