ID: 1161768253

View in Genome Browser
Species Human (GRCh38)
Location 19:6218340-6218362
Sequence CAGGGTACTGGGAGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 921
Summary {0: 1, 1: 0, 2: 2, 3: 119, 4: 799}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161768243_1161768253 -1 Left 1161768243 19:6218318-6218340 CCTGTCTACCCAGGCAGGTGCAC 0: 1
1: 0
2: 1
3: 13
4: 114
Right 1161768253 19:6218340-6218362 CAGGGTACTGGGAGGGAGGCTGG 0: 1
1: 0
2: 2
3: 119
4: 799
1161768239_1161768253 21 Left 1161768239 19:6218296-6218318 CCGTGTGGACCACGTGGGCTCTC 0: 1
1: 0
2: 1
3: 15
4: 138
Right 1161768253 19:6218340-6218362 CAGGGTACTGGGAGGGAGGCTGG 0: 1
1: 0
2: 2
3: 119
4: 799
1161768240_1161768253 12 Left 1161768240 19:6218305-6218327 CCACGTGGGCTCTCCTGTCTACC 0: 1
1: 0
2: 2
3: 15
4: 149
Right 1161768253 19:6218340-6218362 CAGGGTACTGGGAGGGAGGCTGG 0: 1
1: 0
2: 2
3: 119
4: 799
1161768236_1161768253 29 Left 1161768236 19:6218288-6218310 CCAGGAGACCGTGTGGACCACGT 0: 1
1: 0
2: 0
3: 6
4: 42
Right 1161768253 19:6218340-6218362 CAGGGTACTGGGAGGGAGGCTGG 0: 1
1: 0
2: 2
3: 119
4: 799
1161768246_1161768253 -9 Left 1161768246 19:6218326-6218348 CCCAGGCAGGTGCACAGGGTACT 0: 1
1: 0
2: 0
3: 15
4: 147
Right 1161768253 19:6218340-6218362 CAGGGTACTGGGAGGGAGGCTGG 0: 1
1: 0
2: 2
3: 119
4: 799
1161768247_1161768253 -10 Left 1161768247 19:6218327-6218349 CCAGGCAGGTGCACAGGGTACTG 0: 1
1: 0
2: 0
3: 13
4: 175
Right 1161768253 19:6218340-6218362 CAGGGTACTGGGAGGGAGGCTGG 0: 1
1: 0
2: 2
3: 119
4: 799

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161768253 Original CRISPR CAGGGTACTGGGAGGGAGGC TGG Intronic
900013843 1:136143-136165 CGGGCTGCTGGGAGGTAGGCAGG - Intergenic
900014163 1:137360-137382 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
900043913 1:492126-492148 CGGGCTGCTGGGAGGTAGGCAGG - Intergenic
900044026 1:492562-492584 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
900065350 1:727129-727151 CGGGCTGCTGGGAGGTAGGCAGG - Intergenic
900065436 1:727468-727490 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
900155437 1:1201805-1201827 CTGGGTACTGGGCTGGAGGCTGG - Intergenic
900155450 1:1201843-1201865 CTGGGTACTGGGCTGGAGGCTGG - Intergenic
900155463 1:1201881-1201903 CTGGGTACTGGGCTGGAGGCTGG - Intergenic
900155476 1:1201919-1201941 CTGGGTACTGGGCTGGAGGCTGG - Intergenic
900155489 1:1201957-1201979 CTGGGTACTGGGCTGGAGGCTGG - Intergenic
900155502 1:1201995-1202017 CTGGGTACTGGGCTGGAGGCTGG - Intergenic
900155515 1:1202033-1202055 CTGGGTACTGGGCTGGAGGCTGG - Intergenic
900155528 1:1202071-1202093 CTGGGTACTGGGCTGGAGGCTGG - Intergenic
900155541 1:1202109-1202131 CTGGGTACTGGGCTGGAGGCTGG - Intergenic
900155554 1:1202147-1202169 CTGGGTACTGGGCTGGAGGCTGG - Intergenic
900155567 1:1202185-1202207 CTGGGTACTGGGCTGGAGGCTGG - Intergenic
900155580 1:1202223-1202245 CTGGGTACTGGGCTGGAGGCTGG - Intergenic
900155593 1:1202261-1202283 CTGGGTACTGGGCTGGAGGCTGG - Intergenic
900155599 1:1202280-1202302 CTGGGTACTGGGCTGGGGGCTGG - Intergenic
900155614 1:1202318-1202340 CTGGGTACTGGGCTGGGGGCTGG - Intergenic
900155622 1:1202337-1202359 CTGGGTACTGGGCTGGAGGCTGG - Intergenic
900155635 1:1202375-1202397 CTGGGTACTGGGCTGGAGGCTGG - Intergenic
900155648 1:1202413-1202435 CTGGGTACTGGGCTGGGGGCTGG - Intergenic
900155656 1:1202432-1202454 CTGGGTACTGGGCTGGAGGCTGG - Intergenic
900155662 1:1202451-1202473 CTGGGTACTGGGCTGGAGGCTGG - Intergenic
900155675 1:1202489-1202511 CTGGGTACTGGGCTGGGGGCTGG - Intergenic
900155704 1:1202565-1202587 ATGGGTACTGGGCTGGAGGCTGG - Intergenic
900155717 1:1202603-1202625 ATGGGTACTGGGCTGGAGGCTGG - Intergenic
900155730 1:1202641-1202663 ATGGGTACTGGGCTGGAGGCTGG - Intergenic
900155743 1:1202679-1202701 CTGGGTACTGGGCTGGAGGCTGG - Intergenic
900155756 1:1202717-1202739 CTGGGTACTGGGCTAGAGGCTGG - Intergenic
900155761 1:1202736-1202758 ATGGGTACTGGGCTGGAGGCTGG - Intergenic
900155774 1:1202774-1202796 ATGGGTACTGGGCTGGAGGCTGG - Intergenic
900187201 1:1338022-1338044 CCGGGTCCTGGTAGGCAGGCGGG + Exonic
900478426 1:2886960-2886982 CAGGGCACTGGGAGGCTGGGAGG - Intergenic
900559680 1:3297748-3297770 CAGGGGACAGGGAGGGAGTCAGG + Intronic
900662056 1:3789680-3789702 CAGGGGACAGGAAGGGAAGCGGG + Intronic
900851306 1:5145108-5145130 CAGTCTACTTGGAGGGGGGCTGG - Intergenic
900860196 1:5223398-5223420 CAGGACACAGGGAGGGAGGGAGG + Intergenic
900932906 1:5747861-5747883 AAGGGAAAGGGGAGGGAGGCAGG + Intergenic
901205535 1:7493635-7493657 CAGGGAACTGGGGGGGGGGGGGG + Intronic
901296041 1:8161650-8161672 CAGGGTGGTGGGATGGAGGATGG - Intergenic
901469850 1:9448644-9448666 CCAGGGAGTGGGAGGGAGGCCGG + Intergenic
901490626 1:9594674-9594696 CAGGGGCCTGAGGGGGAGGCTGG - Intronic
901675074 1:10878576-10878598 GAGGGAACGGGGAGGCAGGCGGG + Intergenic
901685148 1:10939589-10939611 CAGGGAAGGGGGATGGAGGCAGG + Intergenic
901801799 1:11712463-11712485 CTGGGTACTGGGAGGGAACCTGG + Intronic
902049904 1:13554998-13555020 CCGGGCACGGGGCGGGAGGCGGG - Intergenic
902139631 1:14341972-14341994 AAGGGTAGTGGGTGGGAGGAGGG - Intergenic
902237682 1:15068256-15068278 CTGGGTTCTGGGAGGGGGGATGG + Intronic
902400251 1:16153489-16153511 CAGGGGCCTGGGCGGGTGGCAGG - Intronic
902609392 1:17588289-17588311 CAGGGCTGGGGGAGGGAGGCGGG + Intronic
903224945 1:21889214-21889236 CAGGGAACTGAGATGGAGACAGG + Intronic
903285171 1:22272600-22272622 CGGGGTGGTGGGAGTGAGGCTGG + Intergenic
903344011 1:22673075-22673097 CAGGGTCCTGGGATGGAGCTAGG - Intergenic
903885740 1:26540071-26540093 CCAGGTACTAGGAGGGTGGCTGG - Intronic
903996482 1:27308065-27308087 CAGGGGGCAGGGAGGGAGGGTGG - Exonic
904078790 1:27858959-27858981 CAGAGAAATGGGAGGGCGGCTGG - Intergenic
904368928 1:30036153-30036175 CATGGCACTGGGTGGGAAGCAGG - Intergenic
904372443 1:30058412-30058434 CAGGGGAAGGGGAGGGAGGGTGG - Intergenic
904374370 1:30070851-30070873 CAGGGGACAGTGAGAGAGGCGGG - Intergenic
904489993 1:30852776-30852798 CAAGGCTCAGGGAGGGAGGCCGG + Intergenic
904876286 1:33657033-33657055 GAGGGAACTTGAAGGGAGGCTGG - Intronic
905930501 1:41783514-41783536 CAGGGTGATGGGAGGGATGCGGG + Intronic
905971239 1:42144074-42144096 CATCGTTCTGAGAGGGAGGCAGG - Intergenic
906033130 1:42735794-42735816 CAGGGTGCTGCGAGGCTGGCTGG + Intronic
906147770 1:43570076-43570098 CAGGCTACAGGGAAGGAGGAGGG - Intronic
906290209 1:44614779-44614801 CAGGGACAAGGGAGGGAGGCTGG - Intronic
906319029 1:44805421-44805443 CAGGGTGCTGGGGAGGAAGCTGG + Intronic
906872530 1:49499517-49499539 CTGGGGACTTGGGGGGAGGCTGG - Intronic
906971643 1:50520731-50520753 CCAGCAACTGGGAGGGAGGCAGG + Intronic
907310842 1:53538201-53538223 GAGGGTCCTGGGGGTGAGGCTGG + Intronic
907393273 1:54172573-54172595 CAGGGTGCTGGGAGAGTGGTTGG - Intronic
907439667 1:54471439-54471461 GAGGGTGCTGGGAGGCTGGCAGG + Intergenic
907440126 1:54473863-54473885 TTGGGCACTGGGAGGGTGGCAGG - Intergenic
907903452 1:58762693-58762715 CAGAGTACATGGGGGGAGGCCGG + Intergenic
908277261 1:62487393-62487415 CAGAGTACTGGCTGGGAGGTAGG - Intronic
908788921 1:67761797-67761819 GAGGGTGCAGGGAGAGAGGCAGG + Intronic
910819734 1:91333455-91333477 AAGGGTAGTGGGAGGGTGGAGGG + Intronic
911620029 1:100056155-100056177 AAGGGTAGTGGGAGAGAGGATGG - Intronic
911906744 1:103578852-103578874 TAGGGTACGGGGAGGGGGGAGGG + Intronic
912821867 1:112874366-112874388 CAGGGCCCTGTGAGGGAAGCAGG - Intergenic
912945316 1:114079620-114079642 CAGGGCAGCGGGAGGGAGCCAGG + Intergenic
912956518 1:114157432-114157454 CTGGGGACTTGGAGGGAGGAGGG - Intergenic
913110249 1:115651082-115651104 CAGGTGTCTGGGAGGGAGACAGG - Intronic
914241723 1:145857334-145857356 CAGAGTCCAGGGATGGAGGCGGG - Intronic
914342702 1:146773899-146773921 CAGTGTGATGGGAGGGAAGCAGG - Intergenic
914456413 1:147841146-147841168 CAGGGAACCCAGAGGGAGGCGGG - Intergenic
915004380 1:152623052-152623074 CAGGGCACTTGGGCGGAGGCTGG + Exonic
915167852 1:153958516-153958538 GCTGGTACTGGGAGGGTGGCAGG - Exonic
915244701 1:154548172-154548194 CAGGGCAGTGGAAGGGTGGCTGG - Intergenic
915334932 1:155135689-155135711 CAGGGTACTGGGAAGGCGCTCGG + Intronic
915524713 1:156468546-156468568 CAGGGTAGGGGGTGGGAGGTGGG - Intronic
915526295 1:156478370-156478392 CCGGGAATTGGGATGGAGGCAGG - Intronic
915597308 1:156902909-156902931 CAGGGCAGTCTGAGGGAGGCGGG + Intronic
916597715 1:166261691-166261713 CAGGGGCGTGGGAGTGAGGCAGG - Intergenic
916842324 1:168613268-168613290 CACGCTGCTGGGAGAGAGGCAGG + Intergenic
916901773 1:169232548-169232570 CAGGGTGTTGGGGGGGGGGCAGG + Intronic
917002040 1:170370986-170371008 CAGGGTGGGGGGAGGGAGGAGGG - Intergenic
917114788 1:171591864-171591886 CAGGGGATTGGGAGGGGGGCGGG + Exonic
917700371 1:177574489-177574511 GAGGGTCCTGGGAGGTAGCCAGG - Intergenic
918215495 1:182389937-182389959 AAGGGTTCTGGGATGGAGGTGGG - Intronic
919915104 1:202134198-202134220 AGGGCTGCTGGGAGGGAGGCAGG + Exonic
920068574 1:203286696-203286718 CACGGTGCTAGGAAGGAGGCGGG + Intergenic
921305105 1:213788533-213788555 CAGGGTATGGGGAGGGAGTCAGG - Intergenic
921819097 1:219596208-219596230 GTGGGTACTCGGAGGCAGGCAGG - Intergenic
921819777 1:219604163-219604185 GTGGGTACTCGGAGGCAGGCAGG + Intergenic
922614690 1:226954902-226954924 CAGGGTGCTGGGAGGCATGTTGG + Intronic
922734494 1:227971965-227971987 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
922734775 1:227973096-227973118 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
922975532 1:229780478-229780500 CAGAGCACTGGGTGGCAGGCAGG + Intergenic
923144204 1:231186515-231186537 CAAGGAGCTGGGAGAGAGGCCGG - Intronic
923401841 1:233623281-233623303 AAGGGTACGGGGAGGGGGGATGG + Intronic
924343437 1:243054740-243054762 CGGGCTGCTGGGAGGTAGGCAGG - Intergenic
924343490 1:243054935-243054957 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
924743147 1:246809427-246809449 CATTGAAGTGGGAGGGAGGCAGG + Intergenic
924918482 1:248599845-248599867 GAGGGTATTGGGATGCAGGCTGG - Intergenic
1062911775 10:1216361-1216383 GGAGGTGCTGGGAGGGAGGCGGG + Intronic
1062916624 10:1245099-1245121 CAGGACACTGGGTGGGAGGCTGG + Intronic
1063866138 10:10367333-10367355 CAGGATACTGGGAGTGAAGGTGG - Intergenic
1064167848 10:13001771-13001793 CAGGGGGCAGGGCGGGAGGCGGG - Intronic
1064285161 10:13985338-13985360 CATGGGACAGGGAAGGAGGCTGG + Intronic
1064456540 10:15492403-15492425 CAGGGTCCTGGGAGTGGGGTGGG + Intergenic
1064817959 10:19288422-19288444 CAGGAGGCTGGGAGGGAGGTGGG - Intronic
1065020647 10:21499756-21499778 CCGGGAGCTGGGACGGAGGCAGG - Intergenic
1066694263 10:38064072-38064094 CAGGGGCCTGGGAGGGAGTAAGG - Intronic
1066732626 10:38449169-38449191 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic
1066733032 10:38450775-38450797 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1067187900 10:44045520-44045542 CAGGATGCTGGGAGGGATGGAGG + Intergenic
1068168341 10:53360072-53360094 TAGGGGATTGGGAGGGAGGTGGG - Intergenic
1068815059 10:61300240-61300262 CAGAGGACTGGGAGGGAGCGAGG + Intergenic
1069096214 10:64262864-64262886 CAGGGCAGTGGGAGTCAGGCAGG - Intergenic
1069612191 10:69781589-69781611 GAGGCTGCAGGGAGGGAGGCAGG + Intergenic
1069694533 10:70376932-70376954 CAGGGCATTGGGAAGGAGGTAGG + Intronic
1069836432 10:71311320-71311342 CAGGGAAGTGGGAGGGCGGCAGG + Intergenic
1069917054 10:71793661-71793683 CTGGGAGCTGGGAGGGAGGTGGG - Intronic
1070828226 10:79403558-79403580 CAGGATGCTGGGAGGGAGGAAGG + Intronic
1070830863 10:79417373-79417395 CAGGGAACTTGGAGGAAGCCAGG + Intronic
1071160302 10:82737806-82737828 CAGGGGCCTGGCAGGGCGGCGGG + Intronic
1071249025 10:83796938-83796960 GAGGGGACAGGGAGGGAGGAGGG + Intergenic
1071398100 10:85242903-85242925 CATGGGCCAGGGAGGGAGGCAGG + Intergenic
1071418981 10:85470065-85470087 CAGGGTAGAGGGTGGGAGGAGGG + Intergenic
1072422045 10:95297351-95297373 CAAGGTAGTGGGAGGGAAGCGGG + Intergenic
1072564980 10:96609946-96609968 CAGGCTCCTGTGAGAGAGGCAGG - Intronic
1073073815 10:100810854-100810876 CAGGGCCATGGGGGGGAGGCGGG - Intronic
1073180673 10:101581137-101581159 CAGTGTCCTGGGGTGGAGGCAGG - Intronic
1073214316 10:101828252-101828274 CAAAGTCCTGGGAAGGAGGCAGG + Exonic
1073223208 10:101893729-101893751 GAGGGGACTGGGAGGCAGGGAGG + Intronic
1074397102 10:113107246-113107268 CTGGGTACTGGGTGGGTGGGTGG + Intronic
1075017369 10:118919898-118919920 AAGGGTACTGGGATGGATCCTGG + Intergenic
1075040505 10:119103991-119104013 GATGGTCCGGGGAGGGAGGCGGG + Intergenic
1075776933 10:124995220-124995242 CTGTGTTCTGGGCGGGAGGCAGG + Intronic
1076081618 10:127586777-127586799 CAGTGTCCTGGGATGGAGGTGGG + Intergenic
1076132483 10:128022764-128022786 CAGGGGCCTGGGAGGGGCGCTGG + Intronic
1076550182 10:131273127-131273149 CAGGGTAATGGAAGGGATGCGGG - Intronic
1076820561 10:132936745-132936767 CTCTGTGCTGGGAGGGAGGCAGG + Intronic
1076970187 11:128357-128379 CGGGCTGCTGGGAGGTAGGCAGG - Intergenic
1076970363 11:129037-129059 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1077031237 11:468896-468918 CTGGGTAATCGGAGGGAGGAGGG + Intronic
1077048715 11:557187-557209 CTGGGTACTGGGAGGCAAGAGGG - Intronic
1077076987 11:706403-706425 CGGGGCACTTGGAGGGCGGCCGG + Intronic
1077216565 11:1397592-1397614 CAGGGTTCGGGGAGGAAGCCAGG - Intronic
1077307084 11:1873264-1873286 CAGGGTCCTGGCAGGGAGGAAGG - Intronic
1077902102 11:6497855-6497877 CAGGGTACTGGGAGGTAAGAAGG + Exonic
1078060487 11:8039742-8039764 CAGGAGACTGTGAGGGAGGTGGG + Intronic
1078183319 11:9030455-9030477 CAGGGCACTGAGATGGAGGAGGG + Intronic
1078267683 11:9767030-9767052 AGGGGGACTGGGAGGGAGGCAGG - Intergenic
1078720657 11:13880678-13880700 CAAGGTAATGAGAGGGAAGCTGG - Intergenic
1078916372 11:15782481-15782503 CAGAGTAATGGGATAGAGGCAGG + Intergenic
1078927438 11:15887193-15887215 CAAGGTAATGGCAGGGAGGCTGG - Intergenic
1078976580 11:16484686-16484708 CACGGTTCTGGGTGGGAGTCTGG - Intronic
1079006498 11:16794844-16794866 CAGGGTGGTGGGAGGGTGGAAGG - Intronic
1079097318 11:17519180-17519202 CGGGGAACAGGGAGTGAGGCAGG + Intronic
1080555906 11:33417320-33417342 GATGATACTGGGTGGGAGGCAGG - Intergenic
1081489488 11:43556550-43556572 GAGGGTAGAGGGAGGGAGGGAGG - Intronic
1082261141 11:50076952-50076974 GAGGATGCTGGGAGGCAGGCAGG + Intergenic
1082569224 11:54717261-54717283 CAGGGTCCTGTCAGGGGGGCTGG + Intergenic
1082777604 11:57259444-57259466 CAGGGCACTGGGATGAATGCAGG + Intergenic
1082798329 11:57394869-57394891 CAGGGTGTGGGGAGGGATGCAGG - Intronic
1083254482 11:61487731-61487753 CAGGGCAGTGCGAGGGAGTCTGG + Intronic
1083398211 11:62405782-62405804 CAGGGTACTGGGAGGGGCCCGGG - Intronic
1083800939 11:65045908-65045930 CAGGGGGCTGGTGGGGAGGCAGG + Exonic
1084215657 11:67645638-67645660 GAGGGGAGTGGGAGGGAGGGAGG - Intronic
1084267581 11:68012782-68012804 CAGGGGACTGTGAGGGAGGTGGG + Intronic
1084599660 11:70137362-70137384 CAGCGTCCAGGGAGGCAGGCAGG - Intronic
1084676345 11:70637649-70637671 CTAGGCACTGGGAGTGAGGCTGG + Intronic
1084941467 11:72615492-72615514 GTGGGTAGAGGGAGGGAGGCAGG + Intronic
1085309014 11:75505302-75505324 CTGGATCCTGAGAGGGAGGCAGG - Intronic
1085339130 11:75719940-75719962 CAGGGGTCTGAGAGGAAGGCAGG - Intronic
1085428526 11:76426267-76426289 CTAGGAACTTGGAGGGAGGCAGG - Intergenic
1085459131 11:76682608-76682630 CAGGCTGCTGGGGGGAAGGCAGG + Intergenic
1085485754 11:76861275-76861297 CCGGGGTCTGGGAGGGAGGAAGG + Intronic
1085511195 11:77089015-77089037 CAGGTCCCTGGGAGGGAGGGGGG - Intronic
1085733100 11:79016020-79016042 CAAGGTACTGAGAGTGTGGCTGG + Intronic
1086027286 11:82309162-82309184 CAAGGTCAGGGGAGGGAGGCAGG - Intergenic
1086405931 11:86499000-86499022 CATGATTCTGGGAGGGAAGCTGG + Intronic
1087129937 11:94660026-94660048 CAGGGTCAGGGGAGGGAGTCGGG - Intergenic
1087886117 11:103484700-103484722 AAGTGTTTTGGGAGGGAGGCAGG - Intergenic
1088436468 11:109818519-109818541 CAGGGTACTGGGTTGAAGCCTGG + Intergenic
1088716440 11:112553731-112553753 AAGGGTACTGGACTGGAGGCCGG + Intergenic
1088735329 11:112723738-112723760 AAGGGTAAGGGGAGGGAGGATGG + Intergenic
1089055458 11:115581357-115581379 CAGGGAACTGGTAGGAGGGCAGG - Intergenic
1089282732 11:117385741-117385763 CAGGGGACTGAGAGGAAGCCAGG + Intronic
1089333707 11:117708082-117708104 TAGGGCACAGAGAGGGAGGCAGG - Intronic
1089345815 11:117791009-117791031 CAGGGCACAGGGAGTGGGGCAGG + Intronic
1089404505 11:118186478-118186500 CAGGGGACTGGGAAAGAGACCGG - Intergenic
1089611499 11:119672030-119672052 CAGTGTCCTGGAAGGGAGGCAGG - Intronic
1089683417 11:120132217-120132239 GAGGGTGCTGGGAGGGAAGCGGG - Intronic
1089768219 11:120783991-120784013 GAGGGGACAGGGAGCGAGGCAGG + Intronic
1090062362 11:123475162-123475184 CTGGGTACAGGGAGGGAGGAAGG + Intergenic
1090419590 11:126565063-126565085 CAGGAGCTTGGGAGGGAGGCAGG + Intronic
1091006143 11:131955684-131955706 CGGGGCACTGGGAGGGTGGGAGG - Intronic
1091168599 11:133501658-133501680 CAGGTTACTGTGAGGGGAGCTGG + Intronic
1091337913 11:134786280-134786302 CAGGGTAGGGGGTGGGAAGCAGG - Intergenic
1091347860 11:134867242-134867264 GAGGGGACTGAGAGGAAGGCTGG + Intergenic
1091752807 12:3033177-3033199 CAGGGGACAGGCAGGGAGGCTGG - Intronic
1091915338 12:4269208-4269230 CGGGGGGCGGGGAGGGAGGCGGG + Intergenic
1091949409 12:4580544-4580566 CAAAGAACTGGGAGGGAGGGAGG - Intronic
1092092138 12:5812147-5812169 CAGGGGAGTGGAGGGGAGGCAGG + Intronic
1092280361 12:7093209-7093231 CAGGCCCCTGGGAGGGAGGAGGG + Intronic
1092620905 12:10267074-10267096 AAGGCTACTGGGAGGGGGGAGGG - Intergenic
1093090037 12:14910725-14910747 GAGGGGACTGGGCAGGAGGCTGG - Intergenic
1093686148 12:22056648-22056670 GAGTGTACTGGGTGGGAAGCTGG - Intronic
1094825254 12:34264612-34264634 CAGGGTGCCGGGAGGCAGGGTGG - Intergenic
1095680326 12:44967231-44967253 AAGGGTAGTGGGAGGGGGGAGGG + Intergenic
1096148416 12:49294539-49294561 CAGGGGAGGGGGAGGGGGGCTGG + Exonic
1096445229 12:51683993-51684015 CAGGGCAGAGGGAGGGAGGTGGG + Intronic
1096532396 12:52250048-52250070 CAGGGGAGAGGGAGGGAGCCAGG + Intronic
1096557243 12:52410920-52410942 CAGAGGAGTGGGAGGGAAGCAGG - Intergenic
1096658009 12:53103689-53103711 CAGGCAAGTGGGGGGGAGGCGGG + Intronic
1096694287 12:53338939-53338961 CAGGGCACTGGGAAGGAGACTGG - Intronic
1096751092 12:53759272-53759294 CTGGGTAGAGGGTGGGAGGCTGG - Intergenic
1096766249 12:53892723-53892745 CAGGGCAGTGGGTGGGAGGTAGG + Intergenic
1097250575 12:57630415-57630437 AAGAATGCTGGGAGGGAGGCAGG - Intronic
1100008192 12:89919783-89919805 CCGGGCGCTGGGCGGGAGGCGGG + Intergenic
1100156916 12:91810461-91810483 GAGGGTAGTGGGTGGGAGGATGG + Intergenic
1100337941 12:93650168-93650190 CAGGGTAGCGGGAGGGAGGGAGG - Intergenic
1100674056 12:96847241-96847263 GAGAGTGCTGGGAGGGAGGGCGG - Intronic
1101136744 12:101751596-101751618 CAGAGGACTGGGAGTCAGGCTGG + Intronic
1101732845 12:107440737-107440759 CAGGGAAATGGAAGGGAGGCAGG + Intronic
1101821228 12:108185714-108185736 CAGAGAACAGGGAGGAAGGCAGG - Intronic
1102105246 12:110315825-110315847 CAGGTATTTGGGAGGGAGGCAGG + Intronic
1102502045 12:113359365-113359387 CCTGGCACTGGAAGGGAGGCAGG - Intronic
1102574715 12:113849138-113849160 CAGGGCACAGGGAGGGTGCCTGG - Intronic
1102745444 12:115245041-115245063 CAGGCTTCTGGGAGGGCAGCGGG + Intergenic
1102900220 12:116630859-116630881 CAGGGTCCAGGGAGGAAGGAGGG + Intergenic
1102960106 12:117086982-117087004 CTGGGCCTTGGGAGGGAGGCAGG + Intronic
1103239891 12:119404428-119404450 CAGGGTGGTGGGGGGGAGGTAGG - Intronic
1103333867 12:120174408-120174430 CAGGGTCCTGGGAGGCAGGCTGG + Intronic
1103477877 12:121232111-121232133 CAGGGTCCCTTGAGGGAGGCAGG + Intronic
1103566756 12:121819917-121819939 GAGGGTGGTGGGAGGGAGGCAGG + Intronic
1104031666 12:125069306-125069328 CAGGCTTCAGGGAGGAAGGCAGG + Intronic
1104036458 12:125100779-125100801 GAGTGTTGTGGGAGGGAGGCTGG - Intronic
1104051486 12:125197145-125197167 GAGGGTGCAGGGTGGGAGGCGGG - Intronic
1104667692 12:130659000-130659022 CATGGTGGAGGGAGGGAGGCTGG - Intronic
1104696343 12:130866916-130866938 GAGGTTACAGGGAGAGAGGCAGG + Intergenic
1104757077 12:131276034-131276056 TGGGGCCCTGGGAGGGAGGCTGG + Intergenic
1104786049 12:131448507-131448529 CAGGAGACGGGGAGGGAGGGAGG + Intergenic
1104869348 12:131983518-131983540 CAGGGCACTGACAGGGAGGCCGG + Intronic
1104929466 12:132330042-132330064 CGGGGGAGAGGGAGGGAGGCCGG - Intergenic
1104957014 12:132471919-132471941 CAGGGTACGGGGATGGGGCCTGG + Intergenic
1105531649 13:21226251-21226273 CAGGGAGCTGGAAGAGAGGCAGG + Intergenic
1106947038 13:34840167-34840189 GAAGGGACAGGGAGGGAGGCAGG + Intergenic
1108251322 13:48570772-48570794 CGGGGCACTGGGAGGGAGAGAGG + Intergenic
1109374818 13:61478603-61478625 GAGGGTAAAGGGAGGGAGGAAGG - Intergenic
1112542981 13:100335757-100335779 CAGGGGACTGGCAGGCAGACTGG + Intronic
1113543962 13:111131871-111131893 GAGGGGGCTGGGAGGGAGCCTGG + Intronic
1113741381 13:112714470-112714492 CAGGGTTCGGGGAGTGAGGAGGG - Intronic
1113781638 13:112980777-112980799 CAGTGGACTCGGAGGGAGGCTGG - Intronic
1113888658 13:113725097-113725119 CAGGGTGCAGGCTGGGAGGCCGG + Intronic
1114882928 14:26809217-26809239 CAGAGTGCTGGAAGAGAGGCTGG + Intergenic
1114953286 14:27784296-27784318 CAGCATACTGGGAGGAAGGCAGG + Intergenic
1115915416 14:38307130-38307152 CAGGGTGAAGGGAGGGAGGAGGG + Intergenic
1116018231 14:39432015-39432037 CCGGGTACTGCGGGGGCGGCCGG - Exonic
1116426588 14:44798899-44798921 CGGGGTACGGGGCGGGGGGCGGG - Intergenic
1116610766 14:47068945-47068967 CAGGATACTGTGAGAGAGGTTGG - Intronic
1117218405 14:53576076-53576098 CAGGGACCTGGGAGGGACTCTGG + Intergenic
1117964262 14:61190634-61190656 CAGGGTGGTGGGAGACAGGCTGG - Intronic
1118616035 14:67575060-67575082 CAGGGTGCCGGGAGGGAGGGAGG - Intronic
1119087244 14:71749865-71749887 AAAGGTACTGGGAGGCAGACTGG + Intergenic
1119421414 14:74509909-74509931 CAGGACACTGGCAGGTAGGCAGG + Intronic
1119825096 14:77651151-77651173 CAGGGTACTGGGAGGCAGCGGGG - Intergenic
1119865034 14:77966298-77966320 CAGGCAAAGGGGAGGGAGGCAGG - Intergenic
1120780224 14:88479849-88479871 CAGGGTAGGGGTAGGGAGACGGG + Exonic
1120953682 14:90063253-90063275 CTGGCTAATGGGATGGAGGCGGG + Intronic
1121013930 14:90536928-90536950 CAGAGTCCTTAGAGGGAGGCAGG + Exonic
1121039116 14:90730502-90730524 CAGGATACTGACAGGAAGGCTGG + Intronic
1121275303 14:92663434-92663456 CAGGCAAGAGGGAGGGAGGCCGG + Intronic
1121523083 14:94599654-94599676 CAGGGTACTGGGAGGCCAGTAGG + Intronic
1122246284 14:100405511-100405533 CAGGGGATGGGGAGGGAGGCTGG + Intronic
1122863172 14:104591624-104591646 CTGGGTCCCGGGAGTGAGGCTGG - Intronic
1122894001 14:104746403-104746425 CAGGGTGCAGGGAGGGTGGCTGG - Intronic
1122941652 14:104984243-104984265 CAGGGAGCTGGGAGGGGGGCAGG - Intergenic
1123476002 15:20592904-20592926 CAGGCTACTGTGAGGCAGGGAGG + Intergenic
1123642009 15:22407459-22407481 CAGGCTACTGTGAGGCAGGGAGG - Intergenic
1124390126 15:29247680-29247702 CAGGGTTGGGGGAGGGAAGCTGG - Intronic
1125579612 15:40776017-40776039 CAGAGAACTGGGAGGAAGACGGG + Intronic
1126242398 15:46460200-46460222 CAGAGTGCTGGGAGGGAGGTGGG + Intergenic
1126836048 15:52666330-52666352 CAGGGTACTGTGTGTGAGTCTGG - Intronic
1127449608 15:59103924-59103946 CCAGGTACTGGGAGGGGGGCGGG - Intergenic
1127660775 15:61098177-61098199 AAGGAGACAGGGAGGGAGGCAGG - Intronic
1127736144 15:61840798-61840820 AAGGGAACAGGGAGGGAGGGAGG - Intergenic
1127848925 15:62896430-62896452 CAGGGTCCTGGGTAAGAGGCTGG - Intergenic
1127867539 15:63043990-63044012 GGGGGTACAGGGAGGGAGGGGGG - Intronic
1128259286 15:66221296-66221318 CAGGAGTGTGGGAGGGAGGCAGG - Intronic
1128384183 15:67135326-67135348 CAGGGGACTGTGAAGGGGGCAGG - Intronic
1128967769 15:72077626-72077648 CAGGGTGGTGGCAGGGTGGCGGG + Intronic
1130168415 15:81486331-81486353 CAGGGTGTTGGGAGGGAGCAAGG + Intergenic
1130310624 15:82750650-82750672 CAGCGTCCTGGTAGGCAGGCAGG + Intergenic
1130972335 15:88742516-88742538 CCAGGTCCTGGGAGAGAGGCAGG - Intergenic
1131387307 15:92018185-92018207 AAGGGAACTGGGTGGGAGTCAGG + Intronic
1131489259 15:92848450-92848472 CCAGGTACTGGGAGGGTGGGCGG + Intergenic
1131849611 15:96524849-96524871 CAGGGTGGTGGGAAGAAGGCAGG + Intergenic
1132068993 15:98758797-98758819 GAGGGGACTGTGAGGGAGGCAGG + Intronic
1132322093 15:100933009-100933031 AAGAGTCCTGGGTGGGAGGCGGG - Intronic
1132537718 16:491398-491420 CAGCGTGCAGGGTGGGAGGCGGG - Intronic
1132610630 16:814208-814230 CAGGAGAGTGGGAAGGAGGCCGG + Intergenic
1132664596 16:1075863-1075885 CAGGGTAGGGGGAGAGAGGGAGG - Intergenic
1132701217 16:1222911-1222933 CAGGGACCTGGGAGGGAAGGTGG + Exonic
1132943317 16:2519200-2519222 CAGGGCTGTGGGAGGAAGGCGGG - Exonic
1133027820 16:2996387-2996409 CAGGGCCCTGGGAGGGGGCCTGG - Intergenic
1133223379 16:4328633-4328655 CTGGGTCCTGCCAGGGAGGCAGG - Intronic
1135083893 16:19459244-19459266 CAGGGCCATGTGAGGGAGGCAGG + Intronic
1136170723 16:28487631-28487653 GAGGGTAGTGGGAGGCAGGGTGG - Intronic
1136454518 16:30372689-30372711 CTGGGTACTGGTGTGGAGGCTGG - Intronic
1136553954 16:30997101-30997123 CAGGGATCAGGGAGGGAGTCAGG + Intronic
1136605221 16:31329321-31329343 CTGGGTCCTGAGAAGGAGGCTGG + Intronic
1138361090 16:56427787-56427809 GAGAGGACTGGGAAGGAGGCAGG + Intergenic
1138445261 16:57059374-57059396 CAGGGCACAGAGAGGGAAGCGGG - Intronic
1138554618 16:57764252-57764274 GAGGGTGGTGGGAGGGAGGCTGG + Intronic
1138604926 16:58082543-58082565 CAGGGATATGGAAGGGAGGCAGG - Intergenic
1138658516 16:58504092-58504114 CGGGGGACTGGAAGGAAGGCCGG - Intronic
1138941265 16:61793402-61793424 GAGGGTAGAGGGAGGGAGGAGGG - Intronic
1139991282 16:70941429-70941451 CAGTGTGATGGGAGGGAAGCAGG + Intronic
1140733894 16:77880748-77880770 AAGGGGACTGGGAGGGGGGCAGG - Intronic
1141079706 16:81039153-81039175 CAAGGAACCGGGAGGAAGGCTGG + Intronic
1141231183 16:82169372-82169394 TAGGTTACTGGGAGGGTGGAAGG - Intronic
1141399330 16:83733364-83733386 CAGGTTACCGGGAGGGCTGCAGG - Intronic
1141511849 16:84517407-84517429 CTGGGTACTGGGAGGCACCCGGG - Intronic
1141647209 16:85373906-85373928 CGGGGAGCGGGGAGGGAGGCCGG - Intergenic
1142114480 16:88349081-88349103 CATGGCTCTGGGCGGGAGGCAGG + Intergenic
1142216786 16:88834013-88834035 CAGGGTGCTGGGTGGGGGGAGGG - Intronic
1142356964 16:89605848-89605870 GAGGCTTCTGGGAGGGAGACAGG - Intergenic
1142449888 16:90168445-90168467 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic
1142450490 16:90170775-90170797 CGGGCTGCTGGGAGGTAGGCAGG + Intergenic
1142457072 17:62916-62938 CGGGCTGCTGGGAGGTAGGCAGG - Intergenic
1142457198 17:63401-63423 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1142969491 17:3601491-3601513 TGGGGTACTGGGATGGAGGAGGG - Intergenic
1143106770 17:4534104-4534126 CAGGTTAGTGGCTGGGAGGCTGG + Intronic
1143109547 17:4545507-4545529 CAGGCTCCCGGCAGGGAGGCTGG + Intronic
1143270260 17:5670012-5670034 CAGGCTGATGGAAGGGAGGCAGG - Intergenic
1143348458 17:6268117-6268139 GAGGGTAGAGGGTGGGAGGCGGG - Intergenic
1143563133 17:7706845-7706867 CAGAGAAGTGTGAGGGAGGCTGG - Intronic
1144425061 17:15133700-15133722 AAGGGTACGGGGCGGGGGGCGGG - Intergenic
1144717008 17:17442618-17442640 CCCGGTACCGGGAGGGAGGTGGG - Intergenic
1144742519 17:17591909-17591931 AAAGGCACTGGGCGGGAGGCCGG - Intergenic
1145252908 17:21306078-21306100 CAGGGCACTGGGTGGGTGTCTGG - Intronic
1145323668 17:21781838-21781860 CAGGGCACTGGGTGGGTGTCTGG + Intergenic
1146055065 17:29576831-29576853 CAGGGGAGTGGGAAGGAGGGTGG + Intronic
1147025429 17:37578631-37578653 CAGGGTGCTGGGAGGGATCTTGG - Intronic
1147401170 17:40180856-40180878 CAAGGTGCAGGGAGGGAGCCAGG - Intronic
1147455609 17:40536388-40536410 CAGGGGGCTTGGAGAGAGGCAGG + Intergenic
1147545419 17:41397537-41397559 CATAGTGCTGGGAGGGAGGGAGG + Exonic
1147550556 17:41438759-41438781 CAGGGTGCTGGGGGAGATGCGGG - Exonic
1147643153 17:42017431-42017453 CAGAGAGCTGGGTGGGAGGCCGG + Exonic
1147947293 17:44087254-44087276 AAGGGGAGTGGGAAGGAGGCCGG - Intronic
1148150027 17:45391440-45391462 CAGGGGAAAGGGAAGGAGGCAGG + Intergenic
1148474287 17:47916824-47916846 CAGGGGGCTGGGAGGCAGGAAGG - Exonic
1148794074 17:50188869-50188891 GAGGGTACTGGCATGGGGGCTGG + Intronic
1148841159 17:50498254-50498276 CAGGGATCTGGGAGGCAGGTGGG - Intergenic
1148860139 17:50600430-50600452 CAGGGGGCTGGGCTGGAGGCAGG + Intronic
1148861094 17:50604678-50604700 CAGCGTGCTGGCAGGCAGGCGGG + Intronic
1148887822 17:50786463-50786485 CAGGGTAGGAGGAGGGAGGATGG + Intergenic
1148897211 17:50845887-50845909 CAGGAGCCTGGGAGGCAGGCAGG - Intergenic
1149446252 17:56715594-56715616 CAGGGTCCTGTGAGGGATGTGGG - Intergenic
1149517635 17:57292491-57292513 CAGGGTACCTGGAGGAAGGGTGG + Intronic
1149637218 17:58180747-58180769 CAGGGTGCAGGGAGGGAAGGGGG - Intergenic
1150130468 17:62666299-62666321 CAGTGTTCCTGGAGGGAGGCTGG + Intronic
1150309839 17:64119064-64119086 CAGGATACTGTGAAGGAGCCTGG + Intronic
1150838732 17:68588378-68588400 CAGGGAACTGAGATGGAGACAGG + Intronic
1151221308 17:72615146-72615168 CAGGGTGATGGGAGGGAGGGAGG - Intergenic
1151227083 17:72655584-72655606 GGGGCTCCTGGGAGGGAGGCGGG - Intronic
1151452955 17:74210539-74210561 CAGGGTACTGGGATGGGGGGAGG + Exonic
1151569738 17:74920278-74920300 CAGGGTGCTGGACGTGAGGCTGG + Exonic
1151833599 17:76569588-76569610 AACGGGACTGGGAGGGAGACTGG + Intronic
1151990165 17:77569708-77569730 CAGGGCCCTGGGAAGCAGGCTGG + Intergenic
1152158825 17:78654143-78654165 CAGGGTAGTGTGCGGGATGCTGG - Intergenic
1152334000 17:79690095-79690117 CGGGGTCGTGGGAGGGAGGAAGG - Intergenic
1152565009 17:81096467-81096489 CAGGGAACTGCCAGGGATGCTGG - Intronic
1152690804 17:81716881-81716903 CAGGGTTCTGGGGGGCAGGCAGG + Intronic
1152930526 17:83107450-83107472 CAGGGGACTGTGAGGGCTGCGGG + Intergenic
1154136675 18:11785871-11785893 CAGGGGAGTGGGAGGAAGGTGGG - Intronic
1155053118 18:22165194-22165216 CAGGCCGCGGGGAGGGAGGCCGG + Intergenic
1155630540 18:27887533-27887555 CAGGGAAGGAGGAGGGAGGCAGG - Intergenic
1156483451 18:37450404-37450426 CAGGGGAGAGGGAGGGAGGGAGG - Intronic
1157126830 18:44964077-44964099 CAAGGAACTGGGATGTAGGCTGG + Intronic
1157484351 18:48076412-48076434 GAGGGTAAGGGGAGGGAGGTGGG + Intronic
1157565579 18:48676986-48677008 GGGGGTCCTGGGCGGGAGGCCGG + Intronic
1157604832 18:48919533-48919555 TAGGGTAATGGGAAGGAGACAGG - Intergenic
1158435873 18:57435483-57435505 GAGGGGACGGGGAGGGAGGGAGG - Intergenic
1158622472 18:59045035-59045057 CATTCTGCTGGGAGGGAGGCAGG + Intergenic
1159599589 18:70416206-70416228 CAGGGAACGGGGAGGGAGACAGG + Intergenic
1160073300 18:75647575-75647597 GAGGGCACTGGTAGGGAGGGAGG - Intergenic
1160121057 18:76130809-76130831 CAGGGACCTGTGAGAGAGGCGGG + Intergenic
1160544156 18:79641825-79641847 CAGGAGGCTGGGAGGGAGCCTGG - Intergenic
1160625535 18:80201828-80201850 CAGGGTGCTGGGTGGGAGGCGGG - Intronic
1160646985 19:198275-198297 CGGGCTGCTGGGAGGTAGGCAGG - Intergenic
1160647557 19:200506-200528 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1160659375 19:291165-291187 CAGGGTCCTCGGAGGGACGAGGG + Exonic
1160774480 19:848695-848717 CAGGGGACGGGGAGGAGGGCAGG + Intergenic
1160879849 19:1314409-1314431 AGGGGTAGAGGGAGGGAGGCAGG + Intergenic
1160888007 19:1360959-1360981 CAGAGGCGTGGGAGGGAGGCGGG - Exonic
1161078596 19:2299210-2299232 CAGGGTGCTGCCGGGGAGGCAGG + Intronic
1161111692 19:2474641-2474663 CGGGGCACTGGGCTGGAGGCGGG - Intergenic
1161241144 19:3224641-3224663 CGGGGGCCCGGGAGGGAGGCGGG + Intergenic
1161380703 19:3963710-3963732 CACGGTCCTGGGAGGGTGGGCGG - Intronic
1161664718 19:5568234-5568256 GAGGCTCCAGGGAGGGAGGCTGG + Intergenic
1161768253 19:6218340-6218362 CAGGGTACTGGGAGGGAGGCTGG + Intronic
1162017448 19:7853204-7853226 CAGGGTACTGGTAAGAAGGGGGG + Intronic
1162536327 19:11264645-11264667 CAGGCTGCTGGGAGCTAGGCTGG + Intergenic
1162565141 19:11441806-11441828 CTGTGTACTGGGCAGGAGGCTGG + Intronic
1162565635 19:11444790-11444812 GAGGATACAGGGAGGGAGACCGG - Intronic
1162651471 19:12092106-12092128 CAGGGCACAGGGAGGGAGGTGGG + Intergenic
1162743435 19:12786225-12786247 CAGGGACACGGGAGGGAGGCTGG + Intronic
1163000391 19:14363360-14363382 GAGGGTGCTGGGACGGAAGCGGG - Intergenic
1163389509 19:17021888-17021910 CAGGGGCATGGGAGGGAGGGAGG - Intronic
1163668084 19:18612443-18612465 CAGGGAACGGAGAGGGAGGAAGG - Intronic
1163779710 19:19239922-19239944 CAGAGGAATGGGAGGGAGGAAGG - Intronic
1164598379 19:29545191-29545213 GATGGCACTGGGAGGCAGGCAGG + Intronic
1164891067 19:31824057-31824079 CAGGATACTGGGATGGGGGTGGG + Intergenic
1165469358 19:35994525-35994547 CGGGGCACTGGGAGAGACGCCGG - Intergenic
1165893347 19:39127606-39127628 CCGGGTGCTGGGAGTGTGGCAGG + Intronic
1165898017 19:39155058-39155080 CAGGGTAGTGGGAAGGACCCAGG + Intronic
1166046364 19:40233124-40233146 CACGGGGCTGGGAGGCAGGCAGG + Exonic
1166090049 19:40502957-40502979 CAGGGTAAAGGGACGGAGGGCGG + Intronic
1166230656 19:41424384-41424406 CAGGGTCCTGCATGGGAGGCCGG + Intronic
1166301243 19:41913204-41913226 CGGGGAGCGGGGAGGGAGGCTGG - Intronic
1166357218 19:42234328-42234350 CAGAGTTATGGGAGGGTGGCGGG - Intronic
1166381656 19:42358069-42358091 CAGGGGACCGGGAGGTCGGCGGG + Intronic
1166752714 19:45172335-45172357 CCCTGAACTGGGAGGGAGGCGGG + Intronic
1166784555 19:45359733-45359755 CAGGAGACTGGGTGGCAGGCAGG - Intronic
1166785627 19:45365007-45365029 CAGGGCTGAGGGAGGGAGGCAGG - Intronic
1167121690 19:47521113-47521135 CAGGGGACAGGGAGGGTGGGGGG + Exonic
1167146255 19:47682047-47682069 CTGGGTCTTGGGCGGGAGGCGGG - Exonic
1167149774 19:47701953-47701975 CAGGGCACGGGGAGGCAGCCCGG + Exonic
1167156317 19:47741434-47741456 CAGGGCCATGGGAGGGGGGCCGG - Exonic
1167253006 19:48410852-48410874 CTGGGTAGCGGGAGGGAGGAAGG + Intronic
1167324909 19:48818451-48818473 GTGGGCACTGGGAGGGAGGGAGG - Intronic
1167374001 19:49101730-49101752 GAGGGAACTGGGTGGGGGGCTGG + Intronic
1167458944 19:49614324-49614346 CAGGGTACTGGGTGGGCAGGAGG + Intronic
1167571860 19:50293408-50293430 CAGGAAACTGGGAGGTGGGCGGG + Intronic
1167672143 19:50859463-50859485 CAGGAGCCTGTGAGGGAGGCTGG - Intronic
1167674896 19:50877889-50877911 CAGGAGACTGTGAGGGAGGCTGG - Intronic
1167713157 19:51124667-51124689 AAGGGCATTGAGAGGGAGGCAGG + Intergenic
1167959432 19:53094496-53094518 CAGGGTACCAGGAGGGGTGCAGG - Intronic
1168059181 19:53882007-53882029 CAGGGTGGTGGGGGGGAGCCAGG + Intronic
1168254437 19:55157954-55157976 CAGGGTCCTGGGACTGAGGGAGG - Intronic
1168352823 19:55686337-55686359 CTCAGGACTGGGAGGGAGGCTGG + Intronic
925134819 2:1519096-1519118 ACAGGAACTGGGAGGGAGGCCGG + Intronic
926020128 2:9487282-9487304 CAGGGCAATGGGAGGGAGACTGG + Intronic
926187137 2:10699496-10699518 CAGAGTGCTGGGTGCGAGGCGGG + Intergenic
926228402 2:10984437-10984459 CTGGGCACTGAGAAGGAGGCAGG - Intergenic
926544490 2:14222583-14222605 CTAGGTACTGGGAGACAGGCAGG - Intergenic
926965385 2:18404205-18404227 CATGGTAGTGGGAGGTAGGATGG + Intergenic
927149242 2:20186257-20186279 CAGGGTCCCTGGAGGGAGCCGGG + Intergenic
927158518 2:20236326-20236348 CAGTGCCCTGGGATGGAGGCTGG + Intergenic
927206605 2:20615183-20615205 CTGGGTCCTGGGAGGAAGCCAGG - Intronic
928069709 2:28202374-28202396 CAGGGGCATGGGAGGGAAGCAGG - Intronic
928129573 2:28640126-28640148 CAGGGTATTGCCAGGGAGGGAGG - Intronic
928174469 2:29024461-29024483 AAGGGTGCAGGGAGGGAGGGAGG + Intronic
929511688 2:42569397-42569419 CAGAAGACTGGGAAGGAGGCAGG - Intronic
929640742 2:43576906-43576928 CAGCCTACTGGGAGGGTAGCTGG + Intronic
931241972 2:60461792-60461814 CCGGGGGCTGGGAGGGAGGAGGG + Exonic
931804384 2:65790155-65790177 CAGTGGACTGGGAGCAAGGCAGG + Intergenic
932063972 2:68533693-68533715 CATGGTACAGGGAGGGAGGTGGG - Intronic
932129790 2:69177601-69177623 CAGGGATTGGGGAGGGAGGCCGG - Intronic
932493871 2:72137170-72137192 CAGGGCACCGGGTGAGAGGCAGG - Intronic
932494324 2:72138973-72138995 CAGGGCACGGGGTGAGAGGCAGG - Intronic
932564970 2:72900491-72900513 CAGCGTGCTGGGAGAGAGGGAGG - Intergenic
932589850 2:73058852-73058874 CAGGGCACTGGGAGAGAGAGGGG - Intronic
932849863 2:75174040-75174062 CTGGGTTTTGGGAGTGAGGCAGG - Intronic
933772312 2:85752436-85752458 CAGGGTGCTGGGAGGTGGGATGG - Intronic
934064616 2:88329484-88329506 ATGGGTACAGGGAGGGAAGCAGG - Intergenic
934484036 2:94685153-94685175 CAGCACACTGGGAGGAAGGCAGG - Intergenic
934763023 2:96866641-96866663 CAGGCTGCTGGGAGGAAGGAAGG + Intronic
935192584 2:100790889-100790911 CCAGGGACTGGGAGGGAGGCGGG - Intergenic
935801452 2:106700918-106700940 CAGGGTACTGGAAGAGAGACAGG + Intergenic
936463432 2:112727446-112727468 CAGGATAGTAGGAGCGAGGCTGG + Intronic
936795343 2:116196536-116196558 CAGCGGAATGGGAGGGGGGCAGG - Intergenic
937956126 2:127422695-127422717 CAGGGACGTGGGATGGAGGCTGG + Intronic
938092110 2:128440907-128440929 CAGGCTGCTGGGAGGGCTGCCGG - Intergenic
939093468 2:137805288-137805310 TGGGGTAGTGGGAGGGAGGAGGG + Intergenic
939198077 2:138998260-138998282 CAGAGTACAGGGAAGGAAGCAGG + Intergenic
939671244 2:145015367-145015389 CAGGGTAGAGGGAGGGAGAGGGG - Intergenic
939674079 2:145050142-145050164 TAGGGTCCTGGGTGGGAGGAAGG - Intergenic
940089737 2:149902006-149902028 CAGGGAACTACGAGGAAGGCTGG - Intergenic
940141769 2:150499376-150499398 CAGGGGAAAGGGTGGGAGGCAGG - Intronic
942241571 2:173967103-173967125 AAGTGGACTGGGAGGGAGGAAGG + Intergenic
942243879 2:173989813-173989835 CAGAGCACTGGGAGGGAGGGGGG - Intergenic
942620420 2:177839158-177839180 CATGGTGATGGCAGGGAGGCTGG - Intronic
942944411 2:181657128-181657150 CAGGGACCCAGGAGGGAGGCGGG + Intronic
942965853 2:181891901-181891923 GAGGGGACAGGGAGGGAGGGAGG - Exonic
943220959 2:185105339-185105361 CAGGCTGCTGGGAGGAAGGGGGG - Intergenic
944034569 2:195278211-195278233 CAGTGGACTGGGAGAGAGGCAGG - Intergenic
944505051 2:200402474-200402496 CAGGGGAATGGGAGGGAAGGTGG - Intronic
945336926 2:208603462-208603484 AAGGGTAGTGGGAGGAAGGTGGG + Intronic
945653298 2:212591842-212591864 CAGGGTACCTTGAGGGAGGAGGG - Intergenic
946029178 2:216691576-216691598 CAGGGTGCTGAGAGCGAGCCTGG - Intronic
946260493 2:218486458-218486480 CAGGCAACTGGGTGGGAGGGAGG + Intronic
947986284 2:234450364-234450386 CAGGGCAGTGGGAGGGAGAGTGG + Intergenic
948232105 2:236356236-236356258 CAGGGCGCAGGGAAGGAGGCTGG - Intronic
948232339 2:236359084-236359106 CAGGGCGCAGGGAAGGAGGCTGG + Intronic
948345935 2:237298275-237298297 CATGGTAGTGGGAGGGAGAGTGG - Intergenic
948612049 2:239176183-239176205 CCGGGCAGAGGGAGGGAGGCCGG - Intronic
948612078 2:239176267-239176289 CCGGGCAGAGGGAGGGAGGCCGG - Intronic
948612086 2:239176286-239176308 CCGGGCAGAGGGAGGGAGGCCGG - Intronic
948770132 2:240247635-240247657 CAGTGTCCTGGGAAGCAGGCAGG + Intergenic
948770274 2:240248232-240248254 GATGGGCCTGGGAGGGAGGCAGG - Intergenic
949050398 2:241894785-241894807 CAGGGTGCAGGGAGGCAGGCGGG - Intronic
1168750523 20:278518-278540 CAGGTTTCTGGGAGTGAGGTTGG - Intronic
1168821276 20:775173-775195 CAGGAGCCTGGGAAGGAGGCTGG - Intergenic
1169930930 20:10832349-10832371 CATGCTACTGGGAGATAGGCTGG - Intergenic
1170337330 20:15284206-15284228 GATGATACAGGGAGGGAGGCTGG - Intronic
1170824882 20:19784879-19784901 GAGGTTACTGGGAGAGAGGAGGG + Intergenic
1170898360 20:20436786-20436808 CAGGCTCCTGGAAGGGAGGGAGG + Intronic
1170927608 20:20740133-20740155 CAGGGTAAAGGGTGGGAGGGGGG + Intergenic
1171170548 20:23011696-23011718 CTGGGTTGTGGGAGGGAGGTGGG + Intergenic
1171209357 20:23304851-23304873 CAGGATGCTGGTGGGGAGGCAGG - Intergenic
1171462718 20:25308059-25308081 CAGGGAACTGAGAGGTAGGCAGG + Intronic
1171779997 20:29409882-29409904 CATGGTGCTGGCAAGGAGGCTGG + Intergenic
1172039878 20:32036309-32036331 CAGGGAAGTGGGGAGGAGGCTGG + Intergenic
1172434785 20:34921301-34921323 CAGGGGAATGGGAGAGAGGAAGG - Intronic
1172705131 20:36877576-36877598 CATGGTCCTGGGTGGGTGGCAGG - Intronic
1173003610 20:39123199-39123221 GAGTGTAAGGGGAGGGAGGCAGG + Intergenic
1173062859 20:39679003-39679025 CAGGGTACAGGGATGGAGTCTGG - Intergenic
1173316751 20:41951374-41951396 CAGGCTCATGGGAGGCAGGCTGG + Intergenic
1173380487 20:42535322-42535344 GAGGGTAGAGGGAGGGAGGAGGG + Intronic
1173647553 20:44642873-44642895 CAGGGAGCTGGGCAGGAGGCAGG + Intronic
1174096828 20:48096424-48096446 CCAGGCACTGGGAGGGAGGCTGG - Intergenic
1174323659 20:49762057-49762079 AAGAGTACTGGGGGGGTGGCCGG - Intergenic
1174398371 20:50261759-50261781 AAGGGTCCTGGGAGGGCTGCGGG - Intergenic
1175683338 20:61007490-61007512 CAGGGAACTGGGAGGGATCAAGG - Intergenic
1175749530 20:61485588-61485610 CAGGGTACTGGTGGGGAGGGTGG + Intronic
1175948614 20:62570363-62570385 CAGCGTGCTGGGGGCGAGGCTGG + Intronic
1176022338 20:62968167-62968189 CAGGGCAGTGGGTGGGTGGCGGG + Exonic
1176286478 21:5021692-5021714 CAGGGATCAGGGAGGGAGGGCGG + Intergenic
1176409000 21:6437598-6437620 GAGGACACTGGCAGGGAGGCAGG - Intergenic
1177959147 21:27640313-27640335 CAGGATATTGGGAGGGAAGGAGG - Intergenic
1178405421 21:32319287-32319309 CAGGCTCCTGGGAGCTAGGCTGG + Exonic
1178416625 21:32410516-32410538 CAGGGGACTTGGAGGTAGGCAGG - Intergenic
1179086221 21:38220196-38220218 GAGGGCACAGGGAGGGAGGAGGG + Intronic
1179150235 21:38803599-38803621 CAGGGACCTGGGTGGGAGGCAGG + Intergenic
1179462508 21:41547211-41547233 GAGGCTGCTGGCAGGGAGGCTGG + Intergenic
1179684493 21:43045920-43045942 GAGGACACTGGCAGGGAGGCAGG - Intergenic
1179727753 21:43349754-43349776 TAGGTCCCTGGGAGGGAGGCTGG + Intergenic
1179870703 21:44241783-44241805 CAGGGATCAGGGAGGGAGGGCGG - Intergenic
1179883948 21:44305529-44305551 ATGGGTGCTGGGAGGGAGGCAGG + Intronic
1180010930 21:45050707-45050729 CAGGGGACGGGGCGGGAGCCAGG + Intergenic
1180130747 21:45825452-45825474 AAGGGTGCTGGGCGGCAGGCAGG - Intronic
1180247427 21:46557536-46557558 CAGGGTGCTGGGTGGGCGGGCGG + Intronic
1181031078 22:20149130-20149152 CAGGGCCCTGGGTGGGGGGCTGG + Intronic
1181318190 22:21984822-21984844 CAGGGTGGTGGCAGGGAGGCAGG - Intergenic
1181456209 22:23061516-23061538 AAGGGGCCTGGGTGGGAGGCGGG + Intronic
1181512251 22:23394272-23394294 CAGGGTGCTGGGTGGGGGGCTGG - Intergenic
1181675056 22:24445885-24445907 CAGGGTCCTCTGAGGGAGGTGGG + Intergenic
1181956262 22:26589877-26589899 CTGGGATCTGGGAGGCAGGCAGG - Intronic
1182047700 22:27288713-27288735 CAGGGTACTGGGAGTGCAGCAGG - Intergenic
1182062033 22:27405245-27405267 GAGGGAAGAGGGAGGGAGGCAGG - Intergenic
1182086309 22:27563547-27563569 CAGGGCAGAGGGATGGAGGCAGG - Intergenic
1182107461 22:27699529-27699551 CAGCCTCCTGGGAGGGAGGGCGG + Intergenic
1182148863 22:28014513-28014535 AACGGAGCTGGGAGGGAGGCTGG - Intronic
1182212188 22:28685898-28685920 CAGCATTTTGGGAGGGAGGCGGG + Intergenic
1183033936 22:35126595-35126617 CATGCTGTTGGGAGGGAGGCAGG + Intergenic
1183362081 22:37387967-37387989 CTGGGAACTGGGAGAGAAGCAGG - Intronic
1183483659 22:38078064-38078086 CAGGGTGGTGGGAGGGAGTCTGG - Intergenic
1183656565 22:39189000-39189022 CAGGGAACTGGGAGTAATGCTGG - Intergenic
1183754394 22:39746727-39746749 CAGGGTGCTGGGAGGCCAGCAGG + Intronic
1183792849 22:40087776-40087798 CTGGAGACTGAGAGGGAGGCAGG + Intronic
1184088979 22:42282684-42282706 CAGAGACCTGGGAGGGAGGCCGG + Intronic
1184169989 22:42753008-42753030 CTGGGTCCTGGGAGGGTGACAGG - Intergenic
1184446076 22:44547652-44547674 CAGGGGCCTGGGAGCCAGGCAGG - Intergenic
1184592361 22:45493563-45493585 CAGGGAGCTGGGAGGGCAGCTGG + Intergenic
1184858710 22:47161006-47161028 CAGGGTGCTGGGAAGAAGGGGGG + Intronic
1185229276 22:49670914-49670936 CTGGGGATGGGGAGGGAGGCTGG + Intergenic
1185288740 22:50013844-50013866 CGGGGTGGTGGGAGGGAGGGAGG - Intergenic
1185309416 22:50145907-50145929 CAGTGCTCAGGGAGGGAGGCAGG + Intronic
1185361977 22:50413824-50413846 CAGGCTACTGGGCTGGGGGCTGG - Intronic
949313947 3:2730830-2730852 CAGGCTGCTGGAAGCGAGGCTGG - Intronic
949414508 3:3800269-3800291 CCGGGGACGGGGAGGGAGGAGGG + Intronic
949540962 3:5031775-5031797 CAAGGAACTTGGAAGGAGGCTGG + Intergenic
950026148 3:9821188-9821210 CAGGATGCTTGGTGGGAGGCAGG - Intronic
950496739 3:13338308-13338330 CAGGGTACAGGGACGAATGCAGG + Intronic
950542426 3:13620396-13620418 ATGGGGAGTGGGAGGGAGGCTGG + Intronic
950602973 3:14051560-14051582 CAGGGTGATGGAAGGGAGGGGGG - Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
952815304 3:37442326-37442348 CAGGACTCTGAGAGGGAGGCGGG + Intergenic
953017902 3:39096029-39096051 CAGGGACTAGGGAGGGAGGCAGG + Exonic
953043743 3:39277560-39277582 CAGGATACTGGGTCAGAGGCTGG + Intronic
953259478 3:41323667-41323689 CAGGACACTGGGAGGGGGGTCGG - Intronic
953451262 3:43008375-43008397 CAGAGGACTAGGAAGGAGGCAGG - Intronic
953616806 3:44497964-44497986 CAGTGTAATGGGAGGGAGACGGG + Intergenic
953888931 3:46736275-46736297 CAGGGGCATGGGACGGAGGCTGG - Intronic
954034886 3:47846149-47846171 CAGGGTACTGGAGGGCAGGGAGG - Exonic
954411520 3:50373352-50373374 GAGGTCACTGGGAGGGAGGCTGG - Intronic
954479862 3:50788779-50788801 CAGAGCGCAGGGAGGGAGGCAGG + Intronic
954483495 3:50823804-50823826 CAATTTACTGGGAGGGAGGTGGG - Intronic
954699621 3:52444353-52444375 TCGGGGAGTGGGAGGGAGGCAGG - Intronic
954849099 3:53585306-53585328 CAGGATACTGGGAGTCAGGCTGG + Intronic
954994841 3:54871901-54871923 CACTGTACTGGGAAGAAGGCTGG - Intronic
955353779 3:58213728-58213750 CAGGGTGCAGGGAGGGATGCAGG + Intronic
955675535 3:61444356-61444378 CAGGGTGGAGGGAGGGAGGGAGG - Intergenic
955769113 3:62371986-62372008 CAGGGTTCGGCGAGGGGGGCCGG - Intronic
955932903 3:64075831-64075853 AAGGGTAGGGGGAGGGAGGTGGG - Intergenic
957467073 3:80608069-80608091 AAGGGGAGTGGGAGGGAGGAGGG + Intergenic
958827324 3:99046974-99046996 CAGGTTAGTGGGTGGGAGGAAGG + Intergenic
959401621 3:105909297-105909319 CAGGGTTTGGGGAGGGAGGTGGG - Intergenic
959976993 3:112472124-112472146 CAAGGTAGGGGGAGGGAGGCTGG + Intronic
960343608 3:116505557-116505579 CAGGGTAGGGGGAGGGGGGACGG - Intronic
960901760 3:122561140-122561162 AAGGGTGCTGGGAATGAGGCAGG - Intronic
960934392 3:122888615-122888637 CAGTGTATTAGGATGGAGGCGGG - Intergenic
961206527 3:125086812-125086834 CAGGGCCCAGGGATGGAGGCTGG - Intronic
961506095 3:127371447-127371469 GGGGGTACTGGGAGCCAGGCGGG - Intergenic
962462760 3:135629914-135629936 CAGAGAACGGGGAGGGAGGAAGG - Intergenic
962821079 3:139047610-139047632 CAGCATACTGGGAGGGGGTCGGG + Intronic
963038675 3:141052773-141052795 CAGGGCTCTGGGAAGGAGGGAGG + Intronic
963837338 3:150070482-150070504 CAGCAAACTGGCAGGGAGGCAGG - Intergenic
963963121 3:151332886-151332908 GAGGGTAGTGGGTGGGAGGAGGG - Intronic
964321321 3:155500715-155500737 CAGAGTACTGGCAAGGAGGGTGG - Exonic
964627868 3:158776610-158776632 CAGGGTACTGGGATGCATGGGGG - Intronic
965597378 3:170422063-170422085 CAGGGCACTGTGGGTGAGGCAGG + Intronic
965921749 3:173925528-173925550 AATGGTTCTGTGAGGGAGGCAGG - Intronic
966923102 3:184627298-184627320 CTGGCTACTTGGAGGGATGCAGG - Intronic
967125083 3:186416027-186416049 CAGGGACCTGGGAAAGAGGCTGG - Intergenic
968267934 3:197376938-197376960 CAGAGTACTGGGGGTCAGGCTGG + Intergenic
968370285 3:198219607-198219629 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic
968370697 3:198221248-198221270 CGGGCTGCTGGGAGGTAGGCAGG + Intergenic
968478879 4:825390-825412 GCGGGGACTGGGAGGGCGGCGGG + Intronic
968711989 4:2126053-2126075 CTGCATACTGGGTGGGAGGCAGG + Intronic
968731619 4:2271801-2271823 CGGGGTATGGTGAGGGAGGCGGG + Intronic
968800754 4:2742057-2742079 CAGGGAACTGCCAGTGAGGCTGG - Exonic
969174875 4:5390833-5390855 CTGGAAACTGGGAGAGAGGCAGG - Intronic
969330907 4:6472890-6472912 CGGGGTGCTGGGAAGGGGGCAGG + Intronic
969393438 4:6906138-6906160 AAGGGGATTGGGAGGGAGGATGG + Intergenic
969481598 4:7449378-7449400 GAAGGTGCTGGGAGGGAGGGAGG - Intronic
969496398 4:7528878-7528900 CCGGATGCTGGGAGAGAGGCAGG - Intronic
969629933 4:8330117-8330139 CAGGGGACTGAGAGGGAAGTGGG + Intergenic
969651687 4:8471742-8471764 CAGGGTATGGGGAGGCAGGAGGG + Intronic
970367186 4:15371768-15371790 AAGGGGGCTGGGAGGGATGCAGG + Intronic
970658655 4:18260369-18260391 GAGGGCAGTGGGAGTGAGGCTGG - Intergenic
971358178 4:25913526-25913548 CAGGGAACAGGGAGAGAGGATGG + Intronic
971774598 4:30946471-30946493 CAGTGTGGTGGGAGGGAGGTGGG - Intronic
975395348 4:73868914-73868936 CAAGGTGCTGGGAGATAGGCTGG - Intergenic
975661124 4:76689720-76689742 CTGGGCACGGAGAGGGAGGCGGG + Intronic
977257718 4:94758503-94758525 CCGGGAAATGGGAGGGAGCCCGG + Intronic
977307955 4:95348970-95348992 AAGGGTAGTGAGAGGGAGGGCGG + Intronic
978430956 4:108633055-108633077 CAGGGTAGAGGGTGGGAGGAGGG - Intergenic
978543068 4:109839603-109839625 AAGGGTAGAGGGAGGGAGGAGGG - Intronic
979301114 4:119088463-119088485 GAGGGTGATGGGAGGGAGGAGGG - Intergenic
979535455 4:121814935-121814957 CAAGGAACTGGGAGCTAGGCTGG + Intronic
980340097 4:131533301-131533323 CAGGTTATTGGGAGGGAGAAAGG + Intergenic
982212054 4:153045779-153045801 CAGGATCCTGGGACTGAGGCAGG - Intergenic
982271342 4:153592528-153592550 TAGGGTACAAGGAGAGAGGCAGG - Exonic
982721379 4:158863490-158863512 CAGGGAAGAGGGAGGGAAGCCGG + Intronic
982748647 4:159132960-159132982 AAGGGAACTGGGAGTTAGGCAGG - Intronic
984500601 4:180553963-180553985 CACTGTACTGGGATGTAGGCAGG + Intergenic
985493693 5:193181-193203 ATGGGTGCTGGGAGGGAGCCTGG + Intronic
985638757 5:1053254-1053276 GTGGGTGCTGGGAGTGAGGCTGG - Intronic
986299343 5:6466062-6466084 CAGGGCCCTGGGAGGGTGGCAGG - Intronic
986308783 5:6535940-6535962 CAGGGGCCTTGGATGGAGGCAGG - Intergenic
987773814 5:22338426-22338448 AAGGGTACTGAGAGGGTGGTGGG + Intronic
989160578 5:38386981-38387003 CAGGGAACTGGGAGGTAGCGTGG + Intronic
989263184 5:39442244-39442266 GAAAGTACTGGAAGGGAGGCTGG - Intronic
991900306 5:71454003-71454025 GAAAGTAATGGGAGGGAGGCTGG - Intergenic
992273511 5:75090434-75090456 AAGGGGACTGGGAGGGAGAGTGG + Intronic
992429185 5:76691124-76691146 CACTGTAGTGGGAGGGAGGTGGG + Intronic
992528034 5:77630388-77630410 CTGGGGCCGGGGAGGGAGGCGGG + Exonic
994085300 5:95751678-95751700 GAGGGTGGTGGGAGGGAGGAGGG - Intronic
994117651 5:96078935-96078957 GAGGGTGCTGGGTGGGAGGCAGG + Intergenic
994670763 5:102758824-102758846 CAGGGTAGGGGGAGGGGGGAAGG + Intronic
995127253 5:108590581-108590603 CAGGGTAATGGCAGGGAGAATGG + Intergenic
995211515 5:109544901-109544923 GAGGGTAGTGGGTGGGAGGAGGG - Intergenic
995227283 5:109715090-109715112 GAGGGTACTGGGAGAGCTGCAGG + Intronic
996404673 5:123093883-123093905 CTAGGACCTGGGAGGGAGGCGGG + Intronic
996868511 5:128158343-128158365 GAGGCTACTGGGTGGGAGGAGGG - Intronic
996949433 5:129108281-129108303 CAGGGTGGTGGGAAGCAGGCAGG + Intronic
997860447 5:137410846-137410868 CAATGCACTGGGAGGGAGGAGGG + Intronic
998059488 5:139108529-139108551 CAGGGCTGTGGGAGGCAGGCTGG + Intronic
998164830 5:139837020-139837042 GAGGGGCATGGGAGGGAGGCTGG + Intronic
998738469 5:145170833-145170855 GAGGGTATAGGGAGGGAGGTGGG - Intergenic
999327010 5:150649892-150649914 CATGGTAGAGGGAGGCAGGCGGG - Exonic
999349980 5:150860647-150860669 CAGGGATCTGGGTGGAAGGCTGG - Intronic
999715422 5:154356354-154356376 CAGGGTACTGTGAGGGCTGGGGG + Intronic
999759857 5:154691654-154691676 CAGGGAACAGGGACGGAGGGAGG - Intergenic
1000029457 5:157389624-157389646 CAGTGTAGTGGGGGTGAGGCAGG - Intronic
1000042040 5:157491938-157491960 CAGTGCAATGGGAGGGATGCTGG + Intronic
1000160930 5:158597244-158597266 CAGGGTACTGGGGCTGGGGCTGG - Intergenic
1000194325 5:158943043-158943065 GAGGGAAGTGGGAGGGAGGGAGG + Intronic
1000541395 5:162544862-162544884 TAGGATGCTGTGAGGGAGGCAGG - Intergenic
1001092395 5:168751042-168751064 GAGGCTAGGGGGAGGGAGGCTGG + Intronic
1001281442 5:170389156-170389178 CACGGGGCAGGGAGGGAGGCAGG - Intronic
1001288913 5:170442794-170442816 CAGGGGACAGGAATGGAGGCAGG + Intronic
1001961060 5:175880560-175880582 CTGGGATCTGGGTGGGAGGCTGG + Exonic
1002104889 5:176875148-176875170 AAGGGCACTGGGAGGGAGCTCGG - Intronic
1002340733 5:178515263-178515285 GAGGCTGCAGGGAGGGAGGCTGG - Intronic
1002457573 5:179354281-179354303 CAGGCTGCTGGGAGGGAGGATGG + Intergenic
1002495316 5:179607673-179607695 CAGGGCACTGGGAGGGTGGGTGG - Intronic
1002729817 5:181326367-181326389 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic
1002729930 5:181326803-181326825 CGGGCTGCTGGGAGGTAGGCAGG + Intergenic
1002842851 6:921257-921279 CAGGGTTTTGGAAGAGAGGCAGG - Intergenic
1003091146 6:3104633-3104655 CAGGGTACAAGCAGAGAGGCTGG + Intronic
1003116441 6:3286814-3286836 CTGGGTGCAGGGAGGGAAGCTGG - Intronic
1003228488 6:4227878-4227900 AAGGGTAGTGGGAAGGAGGGAGG + Intergenic
1003683495 6:8278387-8278409 AAGGGGACTGGGAAGCAGGCAGG + Intergenic
1004237200 6:13884717-13884739 AGGGGTACAGGGAGGCAGGCAGG - Intergenic
1004406317 6:15337082-15337104 CAGGGTTTTGGAAGAGAGGCAGG - Intronic
1004828551 6:19451120-19451142 CAGGGTGGTGGGTGGGAGGAGGG - Intergenic
1005293454 6:24401080-24401102 CAGGGTACTGGGACTGGGGATGG - Intergenic
1006793482 6:36718137-36718159 CCGGGCAGTGGGAAGGAGGCAGG - Intronic
1006810875 6:36819809-36819831 CTGACTCCTGGGAGGGAGGCTGG - Intronic
1006830309 6:36964301-36964323 CAGGGGACTGGGAGGGGCCCGGG - Intronic
1007316550 6:40993854-40993876 CAGGGTACTGGGAAGGATGGAGG - Intergenic
1007399157 6:41593943-41593965 CAGGGTCCAGGGATGCAGGCAGG + Intronic
1007957400 6:45929990-45930012 CTGGGGGCTGGGAGGGAGGAAGG + Intronic
1008836458 6:55837797-55837819 AAGGGTAGTGGGAGGCTGGCAGG - Intronic
1009566569 6:65318457-65318479 GTGGGTACTCGGAGGCAGGCAGG + Intronic
1010252612 6:73723741-73723763 GAGGGTAGAGGGAGGGAGGAGGG + Intronic
1010328674 6:74595327-74595349 GAGGGTACTTGGACAGAGGCTGG - Intergenic
1010507219 6:76675401-76675423 GAGGGTAGAGGGAGGGAGGAGGG - Intergenic
1010661641 6:78578431-78578453 CAGGTTACTGAGACTGAGGCAGG - Intergenic
1011139951 6:84141735-84141757 CAGGGAACTGGCAGCCAGGCTGG + Intronic
1011274859 6:85620701-85620723 CAGGATACTGGTAGTGAGGAAGG + Intronic
1011305755 6:85924650-85924672 AAGGGTTGTGGGAGGGAGGAGGG - Intergenic
1012948864 6:105496225-105496247 CGGGCTACTGAGATGGAGGCAGG + Intergenic
1012958105 6:105592543-105592565 CAGGTTACTGGGAGTGACTCAGG - Intergenic
1013605824 6:111746812-111746834 GAGGGTAGAGGGAGGGAGGCAGG + Intronic
1014379213 6:120717888-120717910 CAGGGTAGTGGGACGGAGCGGGG + Intergenic
1015935235 6:138402300-138402322 CTGGGGACAGGGAAGGAGGCAGG + Intergenic
1016828368 6:148408937-148408959 AAAGGTGGTGGGAGGGAGGCAGG - Intronic
1017014712 6:150090681-150090703 CCGGGTAGTGGAAGGAAGGCAGG + Intergenic
1017777509 6:157691597-157691619 GAGGGAACTGGTAGGGTGGCAGG - Intergenic
1017777522 6:157691643-157691665 GAGGGAACTGGTAGGGTGGCAGG - Intergenic
1017813248 6:157999389-157999411 CAGGCTAAGGGGAGGGAGACAGG - Intronic
1017964282 6:159250655-159250677 CATGGTCCTGGGAGTAAGGCAGG - Intronic
1018147021 6:160900798-160900820 CAGGGTACTGAGAGGGAGCATGG + Intergenic
1018433592 6:163742545-163742567 CAGGGTGGTGGGAGGCATGCAGG - Intergenic
1018468138 6:164071146-164071168 CTGGGTACTGGGATGGAGAGAGG + Intergenic
1018707758 6:166475437-166475459 CAGAGTAGTGGGAGGAAGGAAGG - Intronic
1019168841 6:170117325-170117347 CACGGCCCTCGGAGGGAGGCTGG - Intergenic
1019188520 6:170236045-170236067 CAGGAGACAGGGAGGGGGGCAGG - Intergenic
1019327744 7:446527-446549 CAGGGTCCTGGGAGGGGGAGAGG - Intergenic
1019389467 7:777857-777879 CACGGGACGGGGAGGGACGCGGG + Intronic
1019423821 7:963830-963852 AAGGGTCCTGAGAGGGAGGCAGG + Intronic
1019471879 7:1225367-1225389 CAGGGGAGAGGGAGGGAGGGAGG + Intergenic
1019704249 7:2490010-2490032 CAGGGTCCTGGGATGGTGGGTGG - Intergenic
1020120907 7:5502714-5502736 CAAGCTACTGGGGAGGAGGCAGG + Intronic
1020731336 7:11884721-11884743 TAGGGTACAGGGTGGGAGGAGGG + Intergenic
1021492973 7:21239939-21239961 CAGGTTAGTGAGAGGGAGGTTGG - Intergenic
1021501758 7:21339501-21339523 CAGGGCAATGGGAGGGATGGGGG - Intergenic
1022113387 7:27244463-27244485 GAGGGTTATGGGAAGGAGGCTGG - Intronic
1022954031 7:35364909-35364931 AAGGTAACTGGCAGGGAGGCAGG + Intergenic
1023037622 7:36147331-36147353 GAGGGGACTGGCAGGCAGGCTGG - Intergenic
1023158500 7:37275275-37275297 CTGGGTGCTGGGTGGGAGGAGGG + Intronic
1023221321 7:37922071-37922093 CAGGGCTCTGGAAGGGAGACAGG - Intronic
1023747639 7:43336493-43336515 CAGAGTCCTGAGAGGGAAGCTGG - Intronic
1024076868 7:45825520-45825542 CAGGTGACAGGGAAGGAGGCCGG - Intergenic
1024094221 7:45971687-45971709 CAGGGAGCAGGGAGGGAGGCAGG - Intergenic
1024511402 7:50207491-50207513 CATGCTCCTGGGAGGGTGGCAGG + Intergenic
1025052923 7:55743908-55743930 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025055576 7:55762057-55762079 CAGGGCATTGGGAGGGTGGGAGG - Intergenic
1025127551 7:56355903-56355925 CAGGTGACAGGGAAGGAGGCCGG + Intergenic
1025178120 7:56812097-56812119 CAGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025178550 7:56813836-56813858 CAGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025178988 7:56815626-56815648 CAGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025179444 7:56817512-56817534 CTGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025179893 7:56819350-56819372 CAGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025180368 7:56821332-56821354 CAGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025180811 7:56823170-56823192 CAGGCTGCTGGGAGGCAGGCAGG + Exonic
1025181238 7:56824921-56824943 CAGGCTGCTGGGAGGCAGGCAGG + Intronic
1025181686 7:56826759-56826781 CAGGCCGCTGGGAGGCAGGCAGG + Intronic
1025258506 7:57400834-57400856 GCAGGCACTGGGAGGGAGGCCGG + Intergenic
1025602782 7:63015461-63015483 CAGGTGACAGGGAAGGAGGCCGG + Intergenic
1025690231 7:63750236-63750258 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025690679 7:63752059-63752081 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025691130 7:63753882-63753904 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025691562 7:63755658-63755680 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025692004 7:63757481-63757503 CAGGCTGCTGGGAGGCAGGCAGG - Exonic
1025692453 7:63759304-63759326 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025692897 7:63761127-63761149 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025693313 7:63762806-63762828 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025693756 7:63764629-63764651 CAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025695827 7:63773819-63773841 GAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025910386 7:65824094-65824116 CAGGGCATTGGGAGGGTGGGAGG + Intergenic
1025912488 7:65839756-65839778 AAGGCTGCTGGGAGGTAGGCAGG - Intergenic
1025912675 7:65840689-65840711 GAGGCTGCTGGGAGGCAGGCGGG - Intergenic
1026282333 7:68933080-68933102 CAGGGTAGAGGGAGGAAGGAAGG - Intergenic
1026822079 7:73556855-73556877 CAGGGAAATTAGAGGGAGGCTGG + Intronic
1026898056 7:74021950-74021972 CAGGATGCTGGGTGGGAGGCAGG - Intergenic
1026950338 7:74342488-74342510 CAGGGACCTGGGATGGAGCCAGG + Intronic
1026959036 7:74397058-74397080 CAGGCTCCTGGGGGTGAGGCGGG - Exonic
1027195166 7:76025082-76025104 AAGTGTACTGGGAATGAGGCTGG + Intronic
1029092407 7:98058406-98058428 CGGGGTGCTGGCAGGGAGCCTGG + Intergenic
1029501047 7:100930025-100930047 CAAGGTTCTGGGAGGTAGGAGGG + Intergenic
1029540380 7:101179288-101179310 CAGGGGACAGGCAGGGAAGCCGG + Intronic
1031870058 7:127081529-127081551 CAGGTTAGTGGGAGAGAGACAGG - Intronic
1032051600 7:128653727-128653749 CGGGCTGCTGGGAGGTAGGCAGG + Intergenic
1032425016 7:131815570-131815592 CAGGGTACTGAGAGTGACGGAGG - Intergenic
1032625003 7:133582118-133582140 GAGGGTAGAGGGAGGGAGGAAGG - Intronic
1034276078 7:149824439-149824461 CAGGGCGCTGGGCGGCAGGCAGG - Intergenic
1034409632 7:150933310-150933332 CAGGGTAGAGGGAGGTGGGCAGG - Intergenic
1034470812 7:151253428-151253450 CAGGGTCCTGTGTGGCAGGCAGG + Intronic
1035023669 7:155813243-155813265 CAGGGTGTTGGGGGGGGGGCAGG + Intergenic
1035238697 7:157516491-157516513 CAGGGTGCTGACAGGGAGGGTGG + Intergenic
1035724064 8:1813805-1813827 CAGGGGTCGGGGAGGGGGGCAGG - Intergenic
1036213755 8:6863130-6863152 CAGGGAGCGGGTAGGGAGGCTGG + Intergenic
1036661229 8:10710429-10710451 AGGGGGCCTGGGAGGGAGGCTGG + Intronic
1037767238 8:21779856-21779878 CCAGGTGCTGGGAGGGAGGGAGG - Intronic
1037823624 8:22147827-22147849 CGGGGTGCTGGGAGCGAGGGGGG - Exonic
1037884443 8:22589048-22589070 CAGGGTCCAGAGAGGGAGGGAGG - Intronic
1037905445 8:22713597-22713619 CAGGGGCCTGAGAGGGAGGCCGG + Intronic
1038308096 8:26422537-26422559 TAGGGGACTGGGAAGGAGACGGG + Intronic
1039830752 8:41211998-41212020 CAGGGCACTGGCAGGGAGATTGG - Intergenic
1039901793 8:41758016-41758038 CAGGTAAGTGGGATGGAGGCAGG - Exonic
1040675960 8:49750061-49750083 TAAGGGCCTGGGAGGGAGGCAGG + Intergenic
1041197025 8:55410654-55410676 CAGGGTCCCGGGGGAGAGGCAGG - Intronic
1041281225 8:56212104-56212126 CAGGGAACTGGGGGTGGGGCCGG - Intronic
1041344586 8:56883496-56883518 CAGGGGAAGGGGTGGGAGGCGGG + Intergenic
1041437437 8:57858128-57858150 CTGGGAGCAGGGAGGGAGGCAGG + Intergenic
1042369196 8:67971385-67971407 CAGGGTGCGGGGAGAGAGGGTGG + Intronic
1045349979 8:101329758-101329780 CAGGGGAGTGGGAAGGAGGGAGG - Intergenic
1046002182 8:108434304-108434326 AAGGGTACAGGGAGGGAGGGAGG + Intronic
1046048198 8:108987982-108988004 GAGGGTAGAGGGAGGGAGGAGGG + Intergenic
1046241894 8:111507155-111507177 CAGGGGATAGGGTGGGAGGCGGG + Intergenic
1047037623 8:120956724-120956746 CAGAGTGGTGGGAGAGAGGCAGG + Intergenic
1048089024 8:131218611-131218633 CAGAGTACTGTGAGGGTGACAGG + Intergenic
1048206130 8:132416811-132416833 CAGGGTACAGACAGGAAGGCTGG + Intronic
1048244241 8:132775745-132775767 CGAGTTACGGGGAGGGAGGCGGG - Intronic
1048343283 8:133556865-133556887 GAGGGAAGTGGGAGGGAGGTTGG + Intronic
1048484062 8:134831709-134831731 CAGGGTATGGGGCGGGCGGCGGG - Intergenic
1048608341 8:135993866-135993888 AAGGGTAGTGGGAGGGAAGTAGG + Intergenic
1049261676 8:141642266-141642288 CAGGGTCCTGGGAGGGGTGCAGG + Intergenic
1049312155 8:141938935-141938957 CTAGGTGCTGGGAGGCAGGCCGG + Intergenic
1049331507 8:142056499-142056521 CATCATGCTGGGAGGGAGGCAGG - Intergenic
1049413843 8:142486157-142486179 CAGGGTCCTGGGAGTGAGTGAGG - Intronic
1049434361 8:142579609-142579631 CCCAGTACTGGGAAGGAGGCAGG - Intergenic
1049686947 8:143942820-143942842 CAGGGCCCAGGGAGGAAGGCAGG + Intronic
1050441545 9:5669279-5669301 CAGGGAAAAGGGTGGGAGGCGGG - Intronic
1051450630 9:17193614-17193636 AAGGCAGCTGGGAGGGAGGCTGG - Intronic
1051680554 9:19603490-19603512 CAGGGTGAGGGGAGGGAGGGGGG + Intronic
1052763015 9:32611879-32611901 CAGGGAGCTGGGGGGGAGGATGG - Intergenic
1052834881 9:33242850-33242872 CAGAGCACTGGGATGGGGGCAGG - Intronic
1052998929 9:34566548-34566570 CAGGTTTTTGGAAGGGAGGCTGG - Intronic
1053673749 9:40399237-40399259 CAGCACACTGGGAGGAAGGCAGG + Intergenic
1053923551 9:43025597-43025619 CAGCACACTGGGAGGAAGGCAGG + Intergenic
1054384854 9:64539302-64539324 CAGCACACTGGGAGGAAGGCAGG + Intergenic
1054510878 9:65977053-65977075 CAGCACACTGGGAGGAAGGCAGG - Intergenic
1055149508 9:72979014-72979036 CAGAGTACTGGTTGGGAGCCAGG - Intronic
1055166297 9:73199512-73199534 AAGGGCACTGAGAGGGAGGATGG + Intergenic
1055467650 9:76581769-76581791 CTGGGTACTCAGAGGGTGGCTGG - Intergenic
1055611467 9:78030454-78030476 CTGTGTACTGGGGGCGAGGCGGG - Intronic
1056182985 9:84103442-84103464 CTGGGGAGGGGGAGGGAGGCAGG + Intergenic
1056461876 9:86816616-86816638 TAGGGTACTGGTAGGGAGTAGGG + Intergenic
1056771546 9:89481274-89481296 GAGGGTCCAGCGAGGGAGGCGGG + Intronic
1057548989 9:96038429-96038451 CTGGGCACTGGGAGAGAGGCAGG + Intergenic
1058606725 9:106731024-106731046 CAGGGTATTGGGAAGGAGCAGGG - Intergenic
1059236114 9:112761995-112762017 AAGGCCACTGGGAGGAAGGCCGG + Intronic
1059341919 9:113602158-113602180 CGGGGCAGAGGGAGGGAGGCTGG + Intergenic
1059431874 9:114255292-114255314 CTGACCACTGGGAGGGAGGCCGG - Intronic
1059725182 9:117001529-117001551 CAGAGCACTGGGAGAGTGGCAGG - Intronic
1060186125 9:121565170-121565192 CAGGTGACTGGGAGGAAGTCAGG - Intergenic
1060251154 9:121987762-121987784 CAGGGGAGGGGGAGGGAGCCAGG - Intronic
1060327186 9:122628716-122628738 GAGAGTTCTGGAAGGGAGGCTGG + Exonic
1060813888 9:126624879-126624901 CAGGCTCCGGGGAGGGAGGTGGG + Intronic
1060879892 9:127110818-127110840 CAGGGTGGTGGCAGGGAGGTGGG - Intronic
1060985160 9:127815529-127815551 CAGGCCTCTGAGAGGGAGGCGGG + Exonic
1060991756 9:127853597-127853619 CAGGGAGGTAGGAGGGAGGCAGG + Intronic
1061036800 9:128118737-128118759 AAGGGTACAGGGATGGAGGATGG + Intergenic
1061415545 9:130445131-130445153 CCGGGGACTGGGACCGAGGCAGG + Intronic
1061890286 9:133615715-133615737 GAGGGTGCAGAGAGGGAGGCTGG - Intergenic
1061898711 9:133662138-133662160 CAGGGGACAGGGAGGGGTGCTGG + Intergenic
1062170816 9:135133701-135133723 CAGGGTGCAGGGAGGGTGACTGG + Intergenic
1062347588 9:136122522-136122544 CAGGGTACAGGGCAGGAGCCTGG + Intergenic
1062723763 9:138059379-138059401 CTAGGTCCTGGGAGGGAGGCAGG + Intronic
1062754229 9:138278879-138278901 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic
1062754345 9:138279317-138279339 CGGGCTGCTGGGAGGTAGGCAGG + Intergenic
1203377059 Un_KI270442v1:384684-384706 CATGGTGCTGGCAAGGAGGCTGG + Intergenic
1203577789 Un_KI270745v1:21636-21658 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic
1203578249 Un_KI270745v1:23477-23499 CGGGCTGCTGGGAGGTAGGCAGG + Intergenic
1185706802 X:2273620-2273642 GAAGGTAGGGGGAGGGAGGCAGG - Intronic
1186349992 X:8731429-8731451 CGGGGCACTGGGAGGGAGTCTGG - Intronic
1187706225 X:22012255-22012277 CAGGGCACTAGGAGGGCTGCTGG + Intergenic
1187833952 X:23411869-23411891 ATGGGTAGTGGGAGGGTGGCGGG + Intergenic
1188012167 X:25068792-25068814 AAGGGTTCTTAGAGGGAGGCAGG - Intergenic
1188529645 X:31125533-31125555 CAGTGTTCTGGGAGACAGGCTGG - Intronic
1189251914 X:39606878-39606900 CAGGGGACAGGAAGGCAGGCTGG - Intergenic
1190059355 X:47201012-47201034 AAGGGGACAGGGAGGGAGGTGGG - Intronic
1190116236 X:47627657-47627679 GAGGGTAATGGGATGGAGGTGGG + Intronic
1190133057 X:47768753-47768775 GGGGGGACTGGGAGGGGGGCAGG - Intergenic
1190480136 X:50869192-50869214 TGGGGAACTGGGAGGGAGGTGGG - Intergenic
1190708820 X:53050782-53050804 GAGGGTAGTGGAAGGGAGGCAGG + Intronic
1192561822 X:72132231-72132253 CAAGGTACCGAGAGGGAGGGGGG + Intergenic
1194202395 X:90969598-90969620 AAGGGTAGTGGGAGGGTGGAGGG + Intergenic
1195487508 X:105426040-105426062 CATTCTACTGGGAGGGAGACAGG - Intronic
1196466238 X:115973879-115973901 CAGAGTGCTGGCAGGGAGCCAGG - Intergenic
1196756053 X:119158288-119158310 AAGGGGTATGGGAGGGAGGCAGG + Intergenic
1197199472 X:123735210-123735232 CAGAGGAGTGGGAGGGAAGCAGG - Intergenic
1197708188 X:129648683-129648705 CAGGGCCCTGGCAGGGAGGTCGG - Exonic
1197863544 X:130995363-130995385 CACGGTCCTGGGATGGTGGCTGG + Intergenic
1198690523 X:139279117-139279139 AAGGGTAGTGAGAGGGAGGTGGG + Intergenic
1198831886 X:140759605-140759627 CAGTGACTTGGGAGGGAGGCAGG - Intergenic
1199341271 X:146680061-146680083 CTGGATACAGGGAGGGAGGGTGG - Intergenic
1199608753 X:149596357-149596379 CGGGGTAGTGGGAGGAAGGAGGG - Intergenic
1199630369 X:149773003-149773025 CGGGGTAGTGGGAGGAAGGAGGG + Intergenic
1200053587 X:153447045-153447067 CAGGCGACTGGGATGGAGGGGGG + Intronic
1200102866 X:153696721-153696743 CTGGGGACTGGGAAGGGGGCAGG + Intergenic
1200116082 X:153770266-153770288 TAGGGGGCTGGGATGGAGGCTGG + Intronic
1200267872 X:154655501-154655523 CTGGGGACTGGGAAGGGGGCAGG + Intergenic
1200403791 Y:2787761-2787783 CAGGGTACTAGGGGGTAGGCTGG - Intergenic
1201010227 Y:9544437-9544459 CAGGGCAGTGGGAGTGAGGATGG + Intergenic
1202380884 Y:24276087-24276109 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1202489900 Y:25394038-25394060 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic