ID: 1161768429

View in Genome Browser
Species Human (GRCh38)
Location 19:6219063-6219085
Sequence GACTCAGGACCTTGAGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 203}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161768422_1161768429 17 Left 1161768422 19:6219023-6219045 CCATGCAAGGGAAGCCGTGAACG 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1161768429 19:6219063-6219085 GACTCAGGACCTTGAGTGCCTGG 0: 1
1: 0
2: 1
3: 12
4: 203
1161768424_1161768429 3 Left 1161768424 19:6219037-6219059 CCGTGAACGGAGTACTGAGCTGG 0: 1
1: 0
2: 0
3: 4
4: 69
Right 1161768429 19:6219063-6219085 GACTCAGGACCTTGAGTGCCTGG 0: 1
1: 0
2: 1
3: 12
4: 203
1161768420_1161768429 24 Left 1161768420 19:6219016-6219038 CCGCCAGCCATGCAAGGGAAGCC No data
Right 1161768429 19:6219063-6219085 GACTCAGGACCTTGAGTGCCTGG 0: 1
1: 0
2: 1
3: 12
4: 203
1161768421_1161768429 21 Left 1161768421 19:6219019-6219041 CCAGCCATGCAAGGGAAGCCGTG 0: 1
1: 0
2: 2
3: 9
4: 111
Right 1161768429 19:6219063-6219085 GACTCAGGACCTTGAGTGCCTGG 0: 1
1: 0
2: 1
3: 12
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161768429 Original CRISPR GACTCAGGACCTTGAGTGCC TGG Intronic
900956871 1:5891775-5891797 TACTCAGCACCTCCAGTGCCAGG + Intronic
901983012 1:13051511-13051533 GCCTCAGCCTCTTGAGTGCCTGG - Intronic
901999078 1:13177407-13177429 GCCTCAGCCTCTTGAGTGCCTGG + Intergenic
902152220 1:14452586-14452608 GAGGCAGGACCTTGAGTGGCAGG + Intergenic
902954871 1:19918737-19918759 CATTCAGGACCTTGAGGGCAGGG - Intergenic
903729634 1:25482724-25482746 GACTCTGGAGCTAGACTGCCTGG + Intronic
904332212 1:29767438-29767460 GACGCAGGCGCTTGTGTGCCCGG - Intergenic
905244702 1:36604533-36604555 GACTCAGAACCTTGTGTCCTGGG + Intergenic
905867489 1:41383901-41383923 TACTGAGAACCTTTAGTGCCAGG + Intergenic
911518338 1:98896651-98896673 GAGTCTGGTCCTTGAGTGCAGGG + Intronic
916160182 1:161903791-161903813 GACTCTGGAGCTAGACTGCCTGG - Intronic
917142456 1:171850531-171850553 GACTCAGAACCATGAATGCTAGG - Intronic
922238489 1:223739085-223739107 GTCTTGGGAACTTGAGTGCCTGG - Intronic
923522681 1:234748108-234748130 TACAGAGGGCCTTGAGTGCCAGG - Intergenic
1064801083 10:19073027-19073049 GCCTCAGGCCCTTGAGTAGCTGG + Intronic
1067699117 10:48555913-48555935 GCCTCAGGAGCCAGAGTGCCAGG - Intronic
1068695652 10:59965644-59965666 AGCTCAGGACCTTCAGTGACTGG - Intergenic
1070735859 10:78863256-78863278 GAAGCATGACCTTGGGTGCCTGG - Intergenic
1070936834 10:80304879-80304901 CACTCCGGACCTTGTTTGCCTGG - Intergenic
1071573054 10:86708461-86708483 GACTCAGGACCTGTAGCTCCTGG + Intronic
1072685960 10:97537144-97537166 TTCTCAGCCCCTTGAGTGCCCGG + Intronic
1074162173 10:110844262-110844284 GAATCAGGACCTTGAGTTCCTGG + Intergenic
1077187406 11:1241509-1241531 GCCTAAGGACATAGAGTGCCAGG + Exonic
1078185900 11:9051951-9051973 GACTCTGGACCCAGACTGCCTGG + Intronic
1079909140 11:26287508-26287530 GACTCTGGAACCAGAGTGCCTGG - Intergenic
1081294045 11:41363508-41363530 GACTAATGACCTTAAGTCCCTGG + Intronic
1084207497 11:67604505-67604527 CACAAAGGACCTTGAATGCCAGG + Exonic
1086571650 11:88291687-88291709 GACTCTGGAGCTGTAGTGCCTGG - Intergenic
1088716187 11:112551805-112551827 TAGGAAGGACCTTGAGTGCCGGG - Intergenic
1089654895 11:119940200-119940222 GACTCAGGGCCTTGTGTGAAGGG - Intergenic
1089856862 11:121553121-121553143 GACTCTGGATCCAGAGTGCCTGG + Intronic
1091440414 12:508392-508414 ACCTCAGGCTCTTGAGTGCCTGG + Intronic
1091613132 12:2028650-2028672 GACTCTGGACCTAGACTTCCTGG + Intronic
1096230014 12:49891576-49891598 GACTCTGGAGCCAGAGTGCCTGG - Intronic
1099018882 12:77378997-77379019 GACTCAGGAAGTTAAGTGACTGG + Intergenic
1101016652 12:100508086-100508108 GATTCAGGAACATGACTGCCAGG + Intronic
1102919904 12:116784092-116784114 GACTCAGGGGCCTGACTGCCTGG - Intronic
1105304547 13:19159507-19159529 GCCTCAGGACCTTGAGGTCTTGG - Intergenic
1106885463 13:34179805-34179827 GACTCAGGGCCTTGGGTACCAGG + Intergenic
1107719114 13:43229504-43229526 CACGCAGGACCTTGTGTGCCAGG + Intronic
1108131483 13:47306203-47306225 CACTCAGGACCTGAAGTCCCTGG - Intergenic
1108626245 13:52231294-52231316 AACTGTGGATCTTGAGTGCCAGG + Intergenic
1108659821 13:52575188-52575210 AACTGTGGATCTTGAGTGCCAGG - Intergenic
1115465820 14:33713098-33713120 AACTCAGGACTTTGAGTGTGTGG - Intronic
1119926441 14:78498750-78498772 GACTCTGGAGCTAGAATGCCTGG + Intronic
1120741508 14:88113633-88113655 GACTCAGGGCCAAGTGTGCCTGG + Intergenic
1122327496 14:100891315-100891337 GACCGAGGTCCTTGAATGCCAGG + Intergenic
1122828273 14:104382881-104382903 GACTCAGAACCATGGCTGCCCGG - Intergenic
1123100328 14:105793352-105793374 GAGTCAGGATCTTGATTGGCAGG + Intergenic
1123744638 15:23310204-23310226 GATTCTGGCCCTTTAGTGCCTGG - Intergenic
1124379188 15:29150222-29150244 GACTCAGACCCTGGAGCGCCTGG + Intronic
1125796271 15:42406300-42406322 GACTCTGGACCCAGACTGCCTGG - Intronic
1128528305 15:68427443-68427465 GGCTTAGGACCTAGACTGCCCGG - Intronic
1129760510 15:78126572-78126594 GACGCAGGACATGGAGTGGCTGG - Intronic
1134112586 16:11524449-11524471 GACTCTGGAGCCAGAGTGCCTGG - Intergenic
1135787312 16:25361558-25361580 GACTCTGGAACTCAAGTGCCTGG - Intergenic
1136408628 16:30064171-30064193 GAGTCTGGCCCTTGAGTACCGGG + Intronic
1136619116 16:31416310-31416332 GACTCAGAAGCCTGAGTGTCTGG - Intronic
1137884974 16:52093182-52093204 GACTGGGGACCTTGAGACCCAGG + Intergenic
1138105392 16:54284953-54284975 GACTCAGGACCGGTAGTGGCCGG + Exonic
1138279326 16:55761052-55761074 GACTCTGGAGCCAGAGTGCCTGG + Intergenic
1138574858 16:57901077-57901099 GACACAGGACCATGGGGGCCAGG - Intronic
1139409186 16:66745391-66745413 GCCTCAGGCTCTTGAGTGGCTGG + Intronic
1140204679 16:72924032-72924054 GACTGCTGAACTTGAGTGCCTGG - Intronic
1140754574 16:78055995-78056017 GAGACAGGACATTGAGTCCCGGG + Intronic
1141742250 16:85901501-85901523 GCCTCAGCCCCTTGAGTACCTGG - Intronic
1142811760 17:2398923-2398945 GACTCTTGACCTTGAGAGGCCGG + Intronic
1143568716 17:7740982-7741004 GAGTCATGACCGTAAGTGCCTGG + Exonic
1144191266 17:12848671-12848693 GACTCAGCTCCTTGAGTGCAGGG + Intronic
1145068943 17:19786597-19786619 GACTCAGGCTCTTGAGTAGCTGG - Intronic
1146009548 17:29182235-29182257 GACTCTGGAGCTGGATTGCCTGG + Intergenic
1146841251 17:36156345-36156367 GACTCAGGAGCCAGACTGCCTGG - Intergenic
1146853496 17:36243979-36244001 GACTCAGGAGCCAGACTGCCTGG - Intronic
1146869405 17:36367871-36367893 GACTCAGGAGCCAGACTGCCTGG - Intronic
1146911039 17:36648730-36648752 GCGTGGGGACCTTGAGTGCCAGG - Intergenic
1147072280 17:37968495-37968517 GACTCAGGAGCCAGACTGCCTGG - Intergenic
1147083804 17:38048032-38048054 GACTCAGGAGCCAGACTGCCTGG - Intronic
1147099750 17:38171999-38172021 GACTCAGGAGCCAGACTGCCTGG - Intergenic
1148481942 17:47965655-47965677 GACTCTTGACATTGAGTGTCAGG - Intergenic
1148547696 17:48530070-48530092 GACCCAGGACCTGGTGTGCATGG - Intronic
1148579910 17:48736344-48736366 GGCCCAGAACCTTGAGGGCCTGG - Intergenic
1148624170 17:49056209-49056231 GACTCAGGTCCCTGAGAACCAGG - Intergenic
1149858324 17:60104811-60104833 GACTCAGGAGCCAGACTGCCTGG + Intergenic
1149886133 17:60342199-60342221 CACTCAAGACCTTGTTTGCCTGG + Intronic
1150082758 17:62255293-62255315 GACTCAGGAGCCAGACTGCCTGG - Intergenic
1150513231 17:65778109-65778131 CACGAAGGACCTTGAGTACCAGG - Intronic
1151088301 17:71406379-71406401 GCCTCAGGCTCCTGAGTGCCTGG + Intergenic
1151939759 17:77285195-77285217 AACTCAGAACCTAGAGAGCCAGG - Intronic
1152094819 17:78266918-78266940 GACAGAGGACCTTGAAAGCCAGG + Intergenic
1153667567 18:7379807-7379829 GACTCAAGAACTGGAGAGCCAGG - Intergenic
1157176578 18:45457729-45457751 GGCTCAGGAGCTGGACTGCCTGG + Intronic
1157262561 18:46188801-46188823 GACTCAGGATCTTGAACTCCTGG - Intronic
1157519387 18:48334894-48334916 GACTTGGGACCTGGAGTGGCTGG + Intronic
1158652591 18:59301075-59301097 GCCTTAGGACCTTGGGTGCATGG + Intronic
1159026401 18:63185836-63185858 AACTCAGGACCCAGATTGCCTGG - Intronic
1159497792 18:69228320-69228342 TAGTCAGGATCTTGAGTGACCGG - Intergenic
1161410965 19:4117269-4117291 TTCTCAGGACCTAGAGTCCCTGG + Intronic
1161768429 19:6219063-6219085 GACTCAGGACCTTGAGTGCCTGG + Intronic
1166219767 19:41356934-41356956 CATGCAGGGCCTTGAGTGCCAGG - Intronic
1166733347 19:45070799-45070821 GGATCGGGACCTTGAGCGCCTGG - Exonic
1167426987 19:49434457-49434479 GACTCTGGACCTGGACTCCCAGG - Intronic
1167721721 19:51184391-51184413 GACTCAGGGCCATGAGAGACAGG - Intergenic
1168691571 19:58380744-58380766 CACTCGCGACCTTGAGTTCCGGG - Intronic
925242628 2:2345737-2345759 GACTCAGCACGTGGAGAGCCTGG - Intergenic
926198689 2:10778397-10778419 GGCTCAGGACCTCGAGGTCCAGG - Intronic
928118289 2:28563700-28563722 GAATCAGGCCCTTGAGAGCCTGG + Intronic
929466290 2:42147440-42147462 GACTCAGGAGCCAGACTGCCTGG - Intergenic
929666932 2:43840495-43840517 CACTCAGCACCTGGAGTGACAGG - Intronic
931463909 2:62470586-62470608 GACTGAGGACCCTGTGTGCCTGG - Intergenic
932585162 2:73023019-73023041 GACTCTGGCCCTTGAGTGTCGGG + Intronic
937858668 2:126691292-126691314 CACTCAGGACCTTGAGAGTGAGG - Intronic
940352323 2:152703802-152703824 GACTAAGGACCTTGTTTACCAGG + Intronic
942654556 2:178201487-178201509 GCCTCAGCCCCCTGAGTGCCTGG + Intronic
944125543 2:196288868-196288890 GACTCTGGAGCTGGACTGCCTGG + Intronic
945528631 2:210922201-210922223 GACTCAGCCCCCTGAGTACCTGG - Intergenic
946561185 2:220915771-220915793 GACTCTTGACCCAGAGTGCCAGG + Intergenic
948087099 2:235260060-235260082 GACTCAAGACCTTCAGTGTGGGG - Intergenic
948327539 2:237137996-237138018 TACTCTGGACCTAGAGTGGCAGG - Intergenic
948836485 2:240628557-240628579 GACTGGGGACCTGGAGTTCCCGG + Intronic
1170077874 20:12439412-12439434 GACACAGGAACTTGAATACCAGG - Intergenic
1172209521 20:33187095-33187117 GACTGAGGACAGTGAGGGCCAGG + Intergenic
1172227864 20:33317189-33317211 GATGCAGGGCCTTGAATGCCAGG - Intergenic
1172452717 20:35039281-35039303 GACTTAGAACCCTGAGTACCGGG - Intronic
1172657103 20:36543963-36543985 CACACAGGGCCTTGAATGCCAGG + Intronic
1174168502 20:48601500-48601522 GACTCTGGATCTAGAATGCCTGG + Intergenic
1174583500 20:51589995-51590017 GCCTCAGGACCCTGAGTAACTGG - Intergenic
1174904173 20:54532613-54532635 GACTCAAGACTTTATGTGCCGGG + Intronic
1175486440 20:59350172-59350194 GACTGAGGGCCAGGAGTGCCTGG - Intergenic
1179117449 21:38507166-38507188 AACTGAGGACCCTGAGTGCAGGG + Intronic
1179506683 21:41845665-41845687 GACTAAGACCCTTCAGTGCCAGG - Intronic
1180926707 22:19560086-19560108 CAGGCAGGACCTTCAGTGCCTGG + Intergenic
1181053502 22:20248647-20248669 GGCCCTGGACCGTGAGTGCCTGG - Intronic
1181427172 22:22851211-22851233 GATTCAGGAACTTAAGTGCTAGG - Intronic
1182132219 22:27863329-27863351 AACTAAGGTCCTTGAGGGCCAGG + Intronic
1182800441 22:33028065-33028087 GACCCAGGACCTAGACTGCCTGG - Intronic
1184711841 22:46255148-46255170 GCCTCAGCCCCTTGAGTACCTGG + Intergenic
1184907680 22:47499797-47499819 GACTCTGTGCCTTCAGTGCCTGG - Intergenic
949652816 3:6180515-6180537 CACTCAGGGCCTTGTGAGCCAGG + Intergenic
951860106 3:27242526-27242548 GACTCTAGACCTGGATTGCCTGG - Intronic
952643509 3:35626784-35626806 CACTCAGGACCTTTTGTTCCTGG + Intergenic
952744208 3:36762631-36762653 GACTCAGAACAGGGAGTGCCTGG - Intergenic
954359806 3:50115246-50115268 CAGTCAGGTCCTTGAGTGCTAGG - Intronic
954996794 3:54889186-54889208 GGCTCAGGACCTTGGGAGTCAGG + Intronic
960300142 3:115992889-115992911 GTCACAGGACCTTGAGGGCTTGG + Intronic
961496856 3:127299463-127299485 GACTCAGGAGGGTGAGTGCTGGG - Intergenic
972453314 4:39226563-39226585 GACTCAGGAGCCAGACTGCCTGG + Intronic
972641090 4:40925465-40925487 GACTCTGGACCCAGACTGCCCGG - Intronic
973290938 4:48469812-48469834 GAATCCTGACCTTCAGTGCCTGG + Intergenic
975623333 4:76315958-76315980 GAATCTGAACCTTGAGTTCCGGG + Intronic
975756775 4:77579094-77579116 GCCATAGGGCCTTGAGTGCCTGG + Intronic
976627854 4:87206367-87206389 CAATGAGGACCTTGAATGCCAGG - Intronic
978399791 4:108318914-108318936 GCCTCAGGTTCTTGAGTACCTGG + Intergenic
980818302 4:137978004-137978026 GACTCTGGACCCTGACTGCCTGG - Intergenic
981243315 4:142505122-142505144 GCCTCAGCACCTTGAGTAGCTGG - Intronic
984169146 4:176340460-176340482 GACTCAGGACATTGAGCTCAGGG + Intergenic
984701197 4:182819737-182819759 GACTCAGGGCCCTGAATGCCTGG - Intergenic
984866960 4:184289079-184289101 GACTCGGGACAATCAGTGCCTGG + Intergenic
986239002 5:5940117-5940139 GACTCCAGAAATTGAGTGCCTGG + Intergenic
990592979 5:57284169-57284191 GCCCCAGGACCTTGAGCTCCAGG + Intergenic
996320045 5:122205281-122205303 CACTCAAGACCTTGTTTGCCTGG - Intergenic
997201733 5:132013880-132013902 GACTCAGGCCCTAGACTGCATGG + Intergenic
997323219 5:132996429-132996451 GACTCTGGAAGTTGAGTCCCTGG - Intergenic
999290155 5:150419728-150419750 GACTCAGGAACTGGTGTGTCGGG + Intergenic
999299893 5:150484905-150484927 GACTCAGGATCTCCAGGGCCGGG + Intergenic
1000022199 5:157327785-157327807 GACTGAGGACCCTGAGAGCAAGG + Intronic
1001689631 5:173623534-173623556 GACTCTGGACCGTGAGGCCCAGG + Intergenic
1002229849 5:177754714-177754736 CACTCCGGACCTTGTTTGCCTGG - Intronic
1002317032 5:178350004-178350026 GCCTGAGGACCTTGAAGGCCAGG - Intronic
1002409613 5:179063124-179063146 GACTCAGGAGCTTGACTTCATGG + Intronic
1004742612 6:18476687-18476709 AACAGAGAACCTTGAGTGCCAGG + Intergenic
1006358942 6:33576889-33576911 GACTCAGGACCCCAAATGCCCGG - Intronic
1006785487 6:36663942-36663964 GACTCTGGAACTAGACTGCCTGG + Intergenic
1007292075 6:40795442-40795464 GACTCTGGAGCTAGACTGCCTGG - Intergenic
1007315368 6:40983997-40984019 GACTCAGGAGCTTGAATGTTAGG - Intergenic
1007998757 6:46336634-46336656 AGCTGAGGACTTTGAGTGCCAGG + Intronic
1008359570 6:50599396-50599418 GTCACAGGACCTTGAGTGATTGG - Intergenic
1009677659 6:66846940-66846962 GCCTAAGGACCATGAGTTCCTGG - Intergenic
1011501626 6:87996989-87997011 CACTCAGGACACTGAATGCCAGG - Intergenic
1011798600 6:90983779-90983801 GTCACAGGACCGGGAGTGCCTGG - Intergenic
1018736861 6:166693460-166693482 GGCGCAGGACCCTGAGTGCACGG - Intronic
1025810214 7:64870847-64870869 GCCTCAGGACAATGAGTACCTGG - Intronic
1028466054 7:91153169-91153191 GACTCAGGAACTTGAATTCTAGG + Intronic
1028754989 7:94424342-94424364 CCCTGAGGACCTGGAGTGCCAGG - Exonic
1030023281 7:105296934-105296956 GCCTCTGGAGCTGGAGTGCCTGG - Intronic
1031471571 7:122174377-122174399 GACTCAGGACCTTCATCCCCTGG - Intergenic
1031996643 7:128236489-128236511 GACTCAGGAGCATGAGTGAGGGG - Intergenic
1035421440 7:158731976-158731998 TCCCCAGGGCCTTGAGTGCCTGG - Exonic
1035900627 8:3455575-3455597 CACTCCAGACCTTGTGTGCCTGG + Intronic
1036136506 8:6166611-6166633 GACACAGGACCTGCAGTGACTGG + Intergenic
1036555034 8:9851908-9851930 GACTCAGCAATTTGAGTACCAGG + Intergenic
1039647580 8:39304305-39304327 GACTCAGCACCCTGAGTAGCTGG - Intergenic
1043540702 8:81259016-81259038 GACTCTGGAGCCAGAGTGCCTGG + Intergenic
1045333581 8:101178809-101178831 CAGTCAGGACGTTGAGTGACTGG - Intronic
1045850354 8:106688791-106688813 GAATCTAGACCTTGACTGCCAGG - Intronic
1047887094 8:129263585-129263607 GACTCAGCATTTAGAGTGCCAGG + Intergenic
1049392059 8:142376779-142376801 GACCCGGGGCCTGGAGTGCCAGG + Intronic
1050475966 9:6041249-6041271 GGCTGAGGCACTTGAGTGCCTGG - Intergenic
1050874721 9:10619553-10619575 GACTCAGGAGCCAGACTGCCTGG - Intergenic
1053412502 9:37924885-37924907 GCTTCAGGGCCTTGAATGCCAGG - Intronic
1055267595 9:74515360-74515382 GACTCAGGAGATAGAGTGCCTGG - Intronic
1056850805 9:90082165-90082187 GACTCAGAACCTTGACTCCAAGG + Intergenic
1057743861 9:97736007-97736029 GACTCTGGAGCTAGAATGCCTGG + Intergenic
1059472654 9:114518079-114518101 GCCTCAGCTCCTTGAGTGGCTGG + Intergenic
1060069101 9:120531055-120531077 GACCTAGGACCTGGAATGCCTGG - Intronic
1061883394 9:133578979-133579001 GTCTCAGGACCTTCAAGGCCAGG + Exonic
1061920778 9:133781246-133781268 GACACAAGACCTTAGGTGCCAGG + Intronic
1062077227 9:134597287-134597309 GGCCCAGGACCTGGCGTGCCTGG + Intergenic
1062173426 9:135147952-135147974 GACCCAGGACCCTGGGTGCCAGG + Intergenic
1185775992 X:2803503-2803525 AACTCTGGACCCTGAATGCCTGG - Intronic
1191862184 X:65674844-65674866 GACTCTGGAACTAGACTGCCTGG + Intronic
1192639325 X:72847393-72847415 TACTGAGGAGCTTGGGTGCCTGG - Intronic
1192642386 X:72873412-72873434 TACTGAGGAGCTTGGGTGCCTGG + Intronic
1193660033 X:84246384-84246406 GCCTCAGCACCTTGAGTAACTGG + Intergenic
1197549555 X:127873170-127873192 GTCTCAGGCCCCTGAGTGGCTGG - Intergenic
1198460242 X:136856286-136856308 GACTCAGCCCCCTGAGTGGCTGG - Intronic
1200121935 X:153795188-153795210 TGCGCAGGGCCTTGAGTGCCAGG + Intronic
1201294005 Y:12448198-12448220 AACTCTGGACCCTGAATGCCTGG + Intergenic