ID: 1161769342

View in Genome Browser
Species Human (GRCh38)
Location 19:6222898-6222920
Sequence AATCTTAGCCTGCAGCTGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 142}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161769342_1161769351 27 Left 1161769342 19:6222898-6222920 CCCGGCAGCTGCAGGCTAAGATT 0: 1
1: 0
2: 1
3: 9
4: 142
Right 1161769351 19:6222948-6222970 GAGGGATTCAAGAAGAGCACAGG 0: 1
1: 0
2: 0
3: 16
4: 194
1161769342_1161769347 8 Left 1161769342 19:6222898-6222920 CCCGGCAGCTGCAGGCTAAGATT 0: 1
1: 0
2: 1
3: 9
4: 142
Right 1161769347 19:6222929-6222951 AATTGAACTGACATTCCCTGAGG 0: 1
1: 0
2: 0
3: 27
4: 235
1161769342_1161769352 28 Left 1161769342 19:6222898-6222920 CCCGGCAGCTGCAGGCTAAGATT 0: 1
1: 0
2: 1
3: 9
4: 142
Right 1161769352 19:6222949-6222971 AGGGATTCAAGAAGAGCACAGGG 0: 1
1: 0
2: 2
3: 17
4: 246
1161769342_1161769348 9 Left 1161769342 19:6222898-6222920 CCCGGCAGCTGCAGGCTAAGATT 0: 1
1: 0
2: 1
3: 9
4: 142
Right 1161769348 19:6222930-6222952 ATTGAACTGACATTCCCTGAGGG 0: 1
1: 0
2: 2
3: 13
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161769342 Original CRISPR AATCTTAGCCTGCAGCTGCC GGG (reversed) Intronic
900710321 1:4109267-4109289 AGGCTGAGCCTGCTGCTGCCGGG - Intergenic
906234973 1:44200873-44200895 AATTTTAGCTTTCAGCTGCTGGG - Intergenic
907265742 1:53259645-53259667 AATCATAGCCCACTGCTGCCTGG + Intronic
911263452 1:95715243-95715265 ATTCTTACCCTGCTCCTGCCTGG + Intergenic
911857460 1:102898142-102898164 CATCTTGGCCTGCAGCTCCAGGG + Exonic
915666287 1:157448171-157448193 AATCTTACCTGGCAGCTGCTGGG + Intergenic
919102732 1:193113628-193113650 GATCTTAGCCTGCAGCGGCAAGG - Intergenic
919855804 1:201705272-201705294 CATCTCAGCCTGGAACTGCCAGG - Intronic
923962779 1:239103585-239103607 ACTCCTAAACTGCAGCTGCCAGG + Intergenic
924561217 1:245156992-245157014 AAGCGCAGCCTGCAGCCGCCAGG - Intronic
924798452 1:247309844-247309866 AATCTGATCCTGCAGCAACCAGG + Intronic
1065751463 10:28891299-28891321 AGCCTTAGTCAGCAGCTGCCAGG - Intergenic
1069626333 10:69869872-69869894 AATATTTGCCAGCAGCTGCCAGG + Intronic
1070503200 10:77090591-77090613 ATGCTTCCCCTGCAGCTGCCTGG - Intronic
1074722111 10:116272575-116272597 GAGCGGAGCCTGCAGCTGCCTGG + Intronic
1076071620 10:127494544-127494566 AAAATGAGTCTGCAGCTGCCTGG - Intergenic
1076545670 10:131244464-131244486 AATCTTAGCCAGCTGCTGAGAGG - Intronic
1079786286 11:24677154-24677176 AATCTCCACCTGTAGCTGCCTGG + Intronic
1083161685 11:60858371-60858393 AATCTGAGCCTGTCGCTTCCTGG + Intergenic
1084420072 11:69056062-69056084 AAACGTAGCCTGCACCTCCCTGG - Intronic
1085730496 11:78994215-78994237 AATGTCAGCATGCAGCTGCTTGG + Intronic
1088717989 11:112565552-112565574 AATTTTACCCAGAAGCTGCCAGG + Intergenic
1088817412 11:113431238-113431260 AATCTAATCCTGTAGCTGCCAGG + Intronic
1089045522 11:115499286-115499308 AATCTGAGCCTTCAGAAGCCTGG + Intronic
1089445918 11:118552068-118552090 AATCTCAGCCAGTAGTTGCCAGG + Intronic
1089677613 11:120100227-120100249 AATCTTAGCACGCAGGTGCAGGG - Intergenic
1090620656 11:128558216-128558238 ATCCTTAGCCTGCTGTTGCCAGG + Intronic
1094019878 12:25902819-25902841 AATCTTTGCCACCAGCTCCCAGG - Intergenic
1095694242 12:45126305-45126327 AATCCTAGGCTGCAGGTGCTGGG - Intergenic
1098441283 12:70521820-70521842 AATCTTAGCCTTCAGCTACGTGG + Intronic
1101031318 12:100663090-100663112 CATCTTAAGATGCAGCTGCCTGG + Intergenic
1103616712 12:122158056-122158078 AATCTTAGCCTTGACCTCCCAGG - Intergenic
1108131584 13:47307177-47307199 GTTCCCAGCCTGCAGCTGCCTGG - Intergenic
1109285748 13:60406238-60406260 CATCTAAGGCTGCAGCTGTCCGG + Intronic
1112566257 13:100553280-100553302 CATTTTTGCCTGCATCTGCCTGG - Intronic
1113451235 13:110411416-110411438 AGTATTAGCCTGCAGCTCCAGGG + Intronic
1119205926 14:72793516-72793538 AAACTTAGCATGAAGCTGCAGGG - Intronic
1126706772 15:51413659-51413681 CACCTTAGCCTGCAGCGGCGAGG - Intergenic
1127455588 15:59153582-59153604 AATCTTACCCTGCAGCTCCCTGG + Exonic
1128621371 15:69153221-69153243 AATCTTAGCATGCTTCTGCTTGG + Intergenic
1132206622 15:99990398-99990420 AAGCTTAGTATGGAGCTGCCAGG - Intronic
1132882450 16:2168402-2168424 CATCCTGGCCTGCAGGTGCCAGG - Intronic
1133283937 16:4681977-4681999 GATCAAAGCCTCCAGCTGCCCGG - Intronic
1134100353 16:11447682-11447704 CATCCTAGCCTGGAGCTGCTTGG - Intronic
1135910445 16:26555831-26555853 AATGTAAGCCTGAAGCTACCAGG + Intergenic
1136233415 16:28900927-28900949 ACACTAAGGCTGCAGCTGCCTGG - Intronic
1136238909 16:28932444-28932466 AAACTCAGCCTGGGGCTGCCAGG + Exonic
1136856372 16:33661878-33661900 TGTCTTAGACAGCAGCTGCCAGG - Intergenic
1138413379 16:56857039-56857061 AATGTTAGCCTGGAGCTTCGTGG - Intergenic
1139527581 16:67526294-67526316 ACTCCCAGCCTGCAGCTCCCTGG - Intronic
1203117956 16_KI270728v1_random:1510356-1510378 TGTCTTAGACAGCAGCTGCCAGG - Intergenic
1143962572 17:10732689-10732711 AATGTGAGCCTGGAGCTGTCAGG + Intergenic
1144187909 17:12813830-12813852 AATGCCAGCCTGCAGCAGCCTGG - Intronic
1144733238 17:17540608-17540630 CCTCTCATCCTGCAGCTGCCTGG - Intronic
1147692176 17:42323063-42323085 AATCTTAGCAGGAAGGTGCCTGG + Exonic
1148190118 17:45672414-45672436 GATCTGAGCGTGCAGCTCCCAGG - Intergenic
1149937937 17:60828123-60828145 AATCTAAGCCTGAAGTTGACTGG - Intronic
1150205249 17:63399936-63399958 ACTCTTAAGCTGCAGCTGCCAGG - Intronic
1150276291 17:63899845-63899867 TCTCTCAGCCTGCAGCAGCCAGG - Intergenic
1151579169 17:74968485-74968507 CATGTTACCCTGCAGCTCCCTGG - Intronic
1158566927 18:58561840-58561862 AAACTTCACCTGCAGCTGCAGGG + Intronic
1161769342 19:6222898-6222920 AATCTTAGCCTGCAGCTGCCGGG - Intronic
1162738808 19:12762080-12762102 AATCATAGCTTGCTGCAGCCTGG - Intergenic
1166819971 19:45572993-45573015 ATTCTCAGCCTGCAACTTCCAGG + Intronic
925429605 2:3779790-3779812 AAACTTGCCCTGCAGCTTCCTGG + Intronic
925519210 2:4723067-4723089 AATCATAACCTGCAGATACCGGG - Intergenic
927424137 2:22962589-22962611 ATTCTTAGCCTGCTGCGGCTTGG - Intergenic
931212288 2:60208543-60208565 TATCTTAGCCTGCAGGGTCCTGG + Intergenic
931485217 2:62683850-62683872 ACTCTGGTCCTGCAGCTGCCTGG - Intronic
932831721 2:74996666-74996688 TATCTTGGCTAGCAGCTGCCAGG - Intergenic
933251876 2:80038335-80038357 ATTCTTAGCCTGGGGCTTCCTGG + Intronic
933939783 2:87235581-87235603 AATTAAAGGCTGCAGCTGCCCGG - Intergenic
936353355 2:111730192-111730214 AATTAAAGGCTGCAGCTGCCCGG + Intergenic
941188597 2:162347584-162347606 AATTTTAGCATTCAGGTGCCAGG + Exonic
942457166 2:176146389-176146411 CTTCTTAGCCTGGAGCTGGCTGG - Intergenic
943710059 2:191082987-191083009 ATTCTCATCCTGCAGTTGCCAGG - Intronic
945810369 2:214542469-214542491 AAGCTTCTCCTGCTGCTGCCTGG + Intronic
947682973 2:232052614-232052636 AATGTAAGCATGCAGCTGCATGG - Intronic
1172446124 20:34994385-34994407 ACTCACAGCCTGCAGCTGCAGGG - Exonic
1176302743 21:5106312-5106334 TCTCTAAGCCTGCAGCTGGCCGG - Intergenic
1179175798 21:39007061-39007083 AATCTTCGCCATCAGCTGCTGGG - Intergenic
1179854281 21:44155611-44155633 TCTCTAAGCCTGCAGCTGGCCGG + Intergenic
1181671594 22:24427895-24427917 AGCCTTAGCCTCCAGCTGCAGGG + Intronic
1183626144 22:39003436-39003458 CACCTGGGCCTGCAGCTGCCAGG + Intergenic
1183718409 22:39547952-39547974 AATCTCAGCCTGCAGAGGTCTGG - Intergenic
1184453494 22:44596603-44596625 CAACCCAGCCTGCAGCTGCCTGG + Intergenic
949920041 3:8993317-8993339 TGTCCTAGCCTGGAGCTGCCTGG - Intronic
950187372 3:10953459-10953481 CGTGTTAGCCTGCTGCTGCCAGG - Intergenic
952750104 3:36817948-36817970 CAGCTCAGCCTGCAGCTGACAGG + Intergenic
952889094 3:38029335-38029357 AATCTCAGCCCGCGGCTCCCTGG - Intronic
956381346 3:68667637-68667659 AATGTGATCCTGTAGCTGCCAGG - Intergenic
956884902 3:73549396-73549418 AACCTAAGCCTGCAGCAGACAGG - Intronic
963692160 3:148518626-148518648 CAACTTAGGCAGCAGCTGCCTGG + Intergenic
964393180 3:156218411-156218433 AACCTTTGTCTTCAGCTGCCAGG - Intronic
967628605 3:191715664-191715686 GATCTCAGCCTACAGCTGCAAGG + Intergenic
968420442 4:479547-479569 AATCTGTGCCTGCAGCCCCCTGG - Intronic
969073505 4:4558640-4558662 AAACTAAGCCTGGAGATGCCTGG - Intergenic
974877093 4:67714331-67714353 AAACTTAGCATGCAACTTCCAGG + Intergenic
975464368 4:74692843-74692865 AACATTAGCTTCCAGCTGCCAGG - Intergenic
978265327 4:106816953-106816975 AATCTTGGCCTCCATCTACCAGG - Intergenic
978342501 4:107733579-107733601 AATCTTACCCAGCAGCTGCTGGG - Intergenic
978567736 4:110102175-110102197 AACCTTAGACTGCAGATGCTTGG + Intronic
986653054 5:9983555-9983577 AAGGTTAGCCTGCTGCTGCATGG - Intergenic
987051792 5:14153255-14153277 AATCTTTAACAGCAGCTGCCAGG + Intronic
987167711 5:15218726-15218748 ACTATAAGCCTGCAGCTGCTGGG - Intergenic
992869601 5:80993175-80993197 AGTCTAAGCCTGCACCTCCCTGG + Intronic
995248783 5:109965486-109965508 AATTCTAGCCAGCAGGTGCCTGG - Intergenic
997298357 5:132783941-132783963 AATCTCAGCTTGCTGCAGCCTGG - Intronic
997589349 5:135063439-135063461 CATCTTGGGCTGCAGCTCCCAGG + Intronic
998171353 5:139873669-139873691 AATCTCAGCCTGGATCTGCCAGG + Intronic
998611982 5:143699373-143699395 GGTCTAAGCCTGCAGCTTCCAGG + Intergenic
998724293 5:144991827-144991849 TAACTTAACCTCCAGCTGCCAGG - Intergenic
999992204 5:157059911-157059933 AATCATAGCCTCCAACTGCTGGG - Intergenic
1002117635 5:176976247-176976269 GATCTTAGCTTGCTGCAGCCTGG - Intronic
1006386408 6:33733477-33733499 CCACTTAGCCTGCGGCTGCCCGG + Intronic
1008042350 6:46815691-46815713 AGGATTAGCTTGCAGCTGCCTGG - Intronic
1010503547 6:76629581-76629603 AACCTCAGCCTCTAGCTGCCAGG + Intergenic
1011616223 6:89200648-89200670 AAGCTTAGCCTGCAGCTACTGGG - Intronic
1013122355 6:107151903-107151925 CCTCTCAGCCTGCTGCTGCCTGG - Intergenic
1014293257 6:119586030-119586052 TATCTTATCCTCTAGCTGCCTGG + Intergenic
1014693953 6:124595860-124595882 TTTCTTAACCTGCAGTTGCCAGG + Intronic
1014871584 6:126602980-126603002 AATCTGGACCTGCAGCTCCCAGG + Intergenic
1017348009 6:153406944-153406966 AAGTTTAGCCTAAAGCTGCCTGG + Intergenic
1018138746 6:160805728-160805750 AAGTTTAGCCTAAAGCTGCCTGG - Intergenic
1019296455 7:278274-278296 AATCAAAGCTTGCAGCCGCCAGG - Intergenic
1019838735 7:3417205-3417227 AACCTCAGCCTGCAGCTGTAGGG - Intronic
1021509446 7:21419839-21419861 AATCAATGCCTGCAGCTGCTAGG + Intergenic
1021866905 7:24967309-24967331 ATTCTTACCCTACAGCTGCAAGG + Intronic
1022322116 7:29297379-29297401 CATCTTAGCCTCCTGCTGACAGG + Intronic
1022530543 7:31064212-31064234 CTCCTTAGCCTGCAGCTGCCGGG + Intronic
1022594883 7:31703920-31703942 CAGCTTAGCCTACAGTTGCCAGG + Intronic
1025191362 7:56898159-56898181 AATCTGAGGCTGAAACTGCCTGG - Intergenic
1025680586 7:63678775-63678797 AATCTGAGGCTGAAACTGCCTGG + Intergenic
1025858305 7:65303677-65303699 AATCTTATCCAGCAGCTTCTGGG - Intergenic
1026827968 7:73595865-73595887 AATCTCATCCCGCAGCTGCTGGG + Exonic
1029126826 7:98300528-98300550 AATCTCAGCCAGCAGCTTCTTGG - Intronic
1035452369 7:158985738-158985760 GATCTGACCCTGCAGCTGGCTGG - Intergenic
1040637427 8:49291172-49291194 AATCCTAGCATTCAGCTCCCAGG - Intergenic
1040991252 8:53352656-53352678 AATCTCACCCGGCAGCTGCTGGG + Intergenic
1043174267 8:77004351-77004373 AATATTAGCCTGCAGATACTAGG - Intergenic
1046405332 8:113765225-113765247 AATTTTAGCCTGGAGCAGTCTGG + Intergenic
1050388757 9:5114671-5114693 CGTCTTAGTCTTCAGCTGCCTGG + Intronic
1052743954 9:32421482-32421504 AATCCAACCCTGCAACTGCCTGG + Intronic
1053130094 9:35609707-35609729 ACACCCAGCCTGCAGCTGCCTGG + Exonic
1053273317 9:36765179-36765201 CATCTTCGCCCGCCGCTGCCAGG - Intergenic
1054823013 9:69543007-69543029 ACTCTTACTCTGCAGCTGGCTGG - Intronic
1057998798 9:99844663-99844685 CATCTGTGCCTGCAGCAGCCTGG - Exonic
1059438110 9:114288555-114288577 AATCTGAGCCTCCCGCTGCATGG + Intronic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1062454789 9:136630298-136630320 ACTCCCAGCCTGCACCTGCCAGG + Intergenic
1189957963 X:46295446-46295468 ACTCTTAGATTTCAGCTGCCAGG - Intergenic
1190886112 X:54531904-54531926 AATCTGTGCCTGCATATGCCTGG - Intronic
1197481040 X:126986162-126986184 AATCCCACCCAGCAGCTGCCGGG - Intergenic