ID: 1161770698

View in Genome Browser
Species Human (GRCh38)
Location 19:6229187-6229209
Sequence GTGGAAAAGCGGAGCCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 230}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161770687_1161770698 27 Left 1161770687 19:6229137-6229159 CCAAAAACACCTACTGCAAACGT 0: 1
1: 0
2: 2
3: 9
4: 96
Right 1161770698 19:6229187-6229209 GTGGAAAAGCGGAGCCAGGAGGG 0: 1
1: 0
2: 2
3: 17
4: 230
1161770693_1161770698 -6 Left 1161770693 19:6229170-6229192 CCTGGCCATGAAAGAAGGTGGAA 0: 1
1: 0
2: 3
3: 47
4: 466
Right 1161770698 19:6229187-6229209 GTGGAAAAGCGGAGCCAGGAGGG 0: 1
1: 0
2: 2
3: 17
4: 230
1161770689_1161770698 18 Left 1161770689 19:6229146-6229168 CCTACTGCAAACGTGGTGAAAAC 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1161770698 19:6229187-6229209 GTGGAAAAGCGGAGCCAGGAGGG 0: 1
1: 0
2: 2
3: 17
4: 230
1161770686_1161770698 28 Left 1161770686 19:6229136-6229158 CCCAAAAACACCTACTGCAAACG 0: 1
1: 0
2: 1
3: 8
4: 91
Right 1161770698 19:6229187-6229209 GTGGAAAAGCGGAGCCAGGAGGG 0: 1
1: 0
2: 2
3: 17
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161770698 Original CRISPR GTGGAAAAGCGGAGCCAGGA GGG Intronic
900390208 1:2430541-2430563 GCGGAAGAGCTGGGCCAGGAAGG - Intronic
900391590 1:2436214-2436236 GAGGAAAGGAGGAGGCAGGAAGG - Intronic
900546440 1:3231825-3231847 GTGGAGAAGCTGAACCAGGAAGG - Intronic
901400399 1:9011604-9011626 GTGGAAAAGTGGAGAGATGAGGG - Intronic
901662409 1:10806809-10806831 GTGGAAAAGGGCACCCTGGATGG - Intergenic
901868570 1:12123885-12123907 GTGGATTGGGGGAGCCAGGAGGG + Intronic
902105516 1:14032671-14032693 TTGGAAGAGCTGAGCCAGGATGG - Intergenic
903429796 1:23286620-23286642 GGGGAAAATGGGAGCCAGGCTGG - Intergenic
904054749 1:27662751-27662773 GCGGAAAAGGGGTCCCAGGAAGG - Intergenic
904062937 1:27725672-27725694 GTGGAGAGGCGGAGCGAGGGCGG + Intergenic
905337629 1:37256398-37256420 ATGGAAGAGGGAAGCCAGGAAGG - Intergenic
905604201 1:39282719-39282741 GTGTTAAAGCAGAGCCATGAGGG + Intronic
905941087 1:41864062-41864084 GGGAAAATGCAGAGCCAGGAGGG - Intronic
907911804 1:58833729-58833751 CTGTAAAAGTGGAGGCAGGAAGG + Intergenic
909967020 1:81926090-81926112 GTGGAAAAGAAGAGCCATAAGGG + Intronic
915095877 1:153461599-153461621 GTGGAAAGGCTGACCCAGGTAGG + Intergenic
915493036 1:156262162-156262184 GTGAAAAAGCTCAGCCAGGCTGG - Intronic
915636882 1:157193793-157193815 TTGGAAATGCAGAGCCACGAGGG + Intergenic
917975410 1:180234792-180234814 GTGGAAAACCAGAGCTAGGCGGG + Intronic
919368018 1:196690151-196690173 TTGGAAGAGCGTAGCCAGGATGG - Exonic
919374684 1:196779885-196779907 TTGGAAGACCGTAGCCAGGATGG - Exonic
920220000 1:204389982-204390004 GTGGAAAGGGGGAGCCATGGAGG - Intergenic
923450249 1:234110391-234110413 CTGGAATGGCAGAGCCAGGAAGG + Intronic
923475407 1:234326853-234326875 GAGGAAAAGTGAAGCCAAGACGG + Intergenic
1063663442 10:8048807-8048829 GCGGAAAGGGGGAGACAGGAAGG - Intergenic
1064292319 10:14047244-14047266 GTGGAAAAGAAGAACCAAGAAGG + Intronic
1066008568 10:31171070-31171092 GTGGAAAAGAGGGACGAGGAAGG - Intergenic
1072627251 10:97120589-97120611 GTGAAAATGTGGAGCCAGGAAGG - Intronic
1073347549 10:102795434-102795456 CTGGGAAAGCGGAGGCAGAACGG + Intronic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1078437972 11:11341035-11341057 GTAGAAAGGCAGAGCCAGGCAGG - Intronic
1078596246 11:12689136-12689158 GGTGAAAAGTGGAGGCAGGAAGG - Intronic
1081451724 11:43177323-43177345 ATGGAAAAAGGGAGGCAGGAGGG - Intergenic
1081581633 11:44356238-44356260 GAGGAAAACTGGGGCCAGGAGGG + Intergenic
1081716798 11:45256232-45256254 GTGGAGAAGAGGAGGGAGGAAGG - Intronic
1081845541 11:46238166-46238188 GCGGAACAGCGGACCCAGGCCGG + Intergenic
1083635627 11:64119337-64119359 CTGGCCAAGCTGAGCCAGGATGG - Intronic
1083677091 11:64332255-64332277 GTGGGAAGCCAGAGCCAGGAAGG - Intergenic
1083678565 11:64341032-64341054 AGGGAAAGGCGGAGACAGGAGGG + Intronic
1083994770 11:66266473-66266495 GTGGAAGAGCCGACCCAGGTAGG + Exonic
1084393236 11:68892097-68892119 GTGGAGAAGGGGAGCGAGGTGGG + Intronic
1084532525 11:69736611-69736633 GTGGAAAAGCAGATCCATGCTGG + Intergenic
1085273793 11:75285491-75285513 GTGGAAGAGGAGGGCCAGGATGG + Intronic
1088469264 11:110176407-110176429 GTGGAAGGCAGGAGCCAGGAGGG - Intronic
1090049053 11:123361160-123361182 GTGGAAAAGCAAAGGCTGGAAGG - Intergenic
1090338446 11:125992511-125992533 ATGGGAAAGCAGAGCCTGGAAGG - Intronic
1091297687 11:134485485-134485507 TTGGGGAAGGGGAGCCAGGAGGG + Intergenic
1092448458 12:8580213-8580235 GTGGACTAGAAGAGCCAGGAAGG + Intergenic
1092984337 12:13831092-13831114 GTGGGAGAGCGGAAGCAGGAAGG - Intronic
1093816374 12:23553524-23553546 GTGGAAGAAGGGAGGCAGGAGGG + Intronic
1098259257 12:68651317-68651339 GTGCAACAGCGGGGCCAGGTTGG - Intronic
1098469900 12:70831438-70831460 GTGTAAATGAGGAGCCAGGCTGG + Intronic
1101874938 12:108591740-108591762 GAGGAGAAGGGCAGCCAGGAGGG - Exonic
1103024228 12:117560410-117560432 GTGCAGAAGGGGAGCAAGGAGGG + Intronic
1113101296 13:106722160-106722182 GTGGAAAGGGGGAGCAGGGAGGG + Intergenic
1113775528 13:112943037-112943059 ATGGAAATGCAGAGCCAGGAAGG + Intronic
1114649896 14:24277828-24277850 GTGGGGAAGCGGGGCCAGCAAGG + Intergenic
1117068442 14:52033857-52033879 GTGGAACAGCAGAGCCATGAGGG + Intronic
1117069545 14:52044057-52044079 CTGGAAACGAGGAGACAGGAGGG + Intronic
1117119678 14:52553538-52553560 GTGGAGAACTGGAGACAGGAGGG - Exonic
1117406565 14:55409865-55409887 GTACAAAAGGGGAGCAAGGACGG + Intronic
1117671948 14:58117057-58117079 CTGGAGAAGTGGAGGCAGGAGGG - Intronic
1118851702 14:69588760-69588782 GTGGCAAAAGGGAGCCAGGTGGG + Intergenic
1119331816 14:73800571-73800593 ATGGAAAACCAGAACCAGGAAGG - Intergenic
1119657452 14:76427269-76427291 GTCAATAAGCTGAGCCAGGAAGG + Intronic
1119997687 14:79271485-79271507 GGGGAAAAAAGGAGACAGGAAGG - Intronic
1121891533 14:97596577-97596599 CTGGAAAAGGGGATACAGGAGGG + Intergenic
1122481266 14:102049022-102049044 GTGGAAAAGCAGGGGCAGGCGGG + Intronic
1122610923 14:102983022-102983044 GAGGAAAAGAGGAAACAGGATGG + Intronic
1125382285 15:39099552-39099574 GGGGAAAAGGCAAGCCAGGAAGG + Intergenic
1126302542 15:47214346-47214368 GTGGAAAAGCACAGTCTGGAAGG + Intronic
1126634085 15:50765277-50765299 GTGGAAAAGAGGAGGGTGGAAGG + Intronic
1127276007 15:57444753-57444775 GTGGGAACACAGAGCCAGGATGG + Intronic
1128451169 15:67806718-67806740 GAGGAGAGGCGGAGCCAGCAGGG + Exonic
1129442132 15:75588976-75588998 GAGGAAAAGGGGAGGGAGGAGGG + Intergenic
1129908014 15:79203348-79203370 GTTGGAAAGAGGAGACAGGAGGG + Intergenic
1132985303 16:2763315-2763337 TTGGAGAAGAGGAGCCAGAATGG - Exonic
1133587736 16:7212031-7212053 CTGGAAAAGTGGGGCCAAGAAGG + Intronic
1134680881 16:16124637-16124659 TTGAAAAAGCAGTGCCAGGAAGG + Intronic
1136911338 16:34146980-34147002 GTGGAGAAGCGGGGACAGGGGGG - Intergenic
1137548223 16:49418593-49418615 GTGAAAAACCTCAGCCAGGAGGG - Intergenic
1141410549 16:83830017-83830039 GTGGCACCGCAGAGCCAGGAGGG + Intergenic
1141890457 16:86923283-86923305 GTGGAAATCCAGACCCAGGAGGG - Intergenic
1142173463 16:88634550-88634572 CTGGAAAAGCGGCGGCAGGAAGG - Intergenic
1142341050 16:89522836-89522858 GGGGAAAAGGACAGCCAGGATGG - Intronic
1142632061 17:1231498-1231520 CTGGAAAAGTGGGACCAGGACGG - Intergenic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144996547 17:19273300-19273322 CTGCCAAAGGGGAGCCAGGAAGG - Intronic
1147670918 17:42176331-42176353 GAGGGAAAGAGGAGCCAAGATGG + Intronic
1149700541 17:58651476-58651498 GTGGAAATAAGGAGCAAGGAAGG + Intronic
1150069570 17:62139683-62139705 CTGGAACAGATGAGCCAGGAGGG - Intergenic
1150632019 17:66886439-66886461 GTGGGAAACCGGAGCCAGGAGGG + Intergenic
1151185880 17:72363607-72363629 GTGGGGAAGCTGAGCTAGGAAGG - Intergenic
1151577056 17:74958211-74958233 GTGGAACACCTGTGCCAGGAGGG + Exonic
1151719640 17:75847808-75847830 GTGGATAGGGGTAGCCAGGAGGG + Exonic
1152645102 17:81465172-81465194 GTGGAAAAGGGGGCCCAGAAAGG - Exonic
1152822289 17:82443547-82443569 GTGGAGAGGCGGGGCCAGGCCGG - Exonic
1153269975 18:3310748-3310770 GTGGAAAAGAGGAGTGAGGGAGG + Intergenic
1155362534 18:25016691-25016713 GTGGAGAAGGGCAGCCAGGAGGG + Intergenic
1159005171 18:63004663-63004685 GTGGAGACCCAGAGCCAGGAGGG + Intergenic
1160075074 18:75667044-75667066 GTTGAAAACTGGAGTCAGGAAGG + Intergenic
1160317586 18:77861873-77861895 GTGGAAGAGAGGAGGCAGGAGGG - Intergenic
1160727691 19:624879-624901 CTGGAACAGATGAGCCAGGAGGG - Exonic
1160840372 19:1144079-1144101 GTGGTTCTGCGGAGCCAGGAAGG - Intronic
1161770698 19:6229187-6229209 GTGGAAAAGCGGAGCCAGGAGGG + Intronic
1162975591 19:14205900-14205922 GTGGAAGAGGGGAGGCGGGAAGG - Intronic
1163569686 19:18073545-18073567 GTGGAGCAGCTGGGCCAGGATGG - Exonic
1164858224 19:31541921-31541943 ATGGAAAAGAGGAGGCAGAAGGG + Intergenic
1165116760 19:33533387-33533409 GTGGAGAAGCTGCTCCAGGACGG + Intergenic
1165317679 19:35066409-35066431 GTGGAAGAGAGGACCCTGGAGGG - Exonic
1165904840 19:39187536-39187558 GTGGGAAAGTGCAGCCAGGTCGG - Intergenic
1166212579 19:41316618-41316640 GTGGTACAGCTGGGCCAGGATGG - Exonic
1166214207 19:41325170-41325192 GTGGAAAGGCTGAGTCAGGGAGG + Intronic
1167964445 19:53132196-53132218 GTAGAAAACCTGAGACAGGAAGG - Intronic
1168522032 19:57059162-57059184 GTAGAAAAGATGAGGCAGGAGGG - Intergenic
928097481 2:28413424-28413446 GGGGAAAGGCGGAGCCCGGCAGG - Exonic
928400610 2:30975979-30976001 GGGGAAGAGAGGAGACAGGAGGG - Intronic
929924670 2:46198306-46198328 ATGGAAAAGCTGAGGCAGGAAGG - Intergenic
932014101 2:68006963-68006985 GTGGAAAAGTGAGACCAGGAAGG + Intergenic
932127600 2:69157963-69157985 CTGGAGAAGTGGGGCCAGGATGG - Intronic
932688982 2:73896538-73896560 GTGGGAAAGGGGAACCAGGAGGG + Intronic
934864358 2:97792664-97792686 GGGGCAAAGCAGAGCCAGCACGG - Exonic
935675649 2:105592991-105593013 ATGGAGAAGCCGTGCCAGGAAGG - Intergenic
937218202 2:120326031-120326053 GAGGAAAAGTAGAGCGAGGAGGG + Intergenic
937304321 2:120861854-120861876 GTGGAATTGCAGAGCCAGGCAGG + Intronic
937469189 2:122160890-122160912 GTGTAAAGGCGGAGGCAAGATGG + Intergenic
937873964 2:126806297-126806319 CTGAGAAAGAGGAGCCAGGAGGG - Intergenic
938574818 2:132594064-132594086 GTGGAAAATTACAGCCAGGATGG + Intronic
938946293 2:136215012-136215034 CTGGAAAATTGGAGCCTGGAGGG + Intergenic
939139464 2:138336334-138336356 GAGGGAAAGCTGAGCCAGGCAGG - Intergenic
940745789 2:157566344-157566366 GTGGGAATGTGGAGCCAAGATGG + Intronic
944686762 2:202124458-202124480 TTGGACCAGGGGAGCCAGGAGGG - Intronic
946010032 2:216557274-216557296 GTGGAAATGCAGGGCCAGGCCGG - Intronic
947164742 2:227250440-227250462 TTGGGAAAGCTGAGACAGGAAGG + Intronic
947760414 2:232599956-232599978 GTGAAGAAGCAGAGCCCGGAAGG + Intergenic
1169137022 20:3203642-3203664 CTGGAAAGGTGGAGCCGGGAGGG - Intronic
1170032400 20:11956817-11956839 GTGGGACAGCAGAGGCAGGAGGG - Intergenic
1170131235 20:13022528-13022550 CTGGAGAAGCTGGGCCAGGAGGG + Intronic
1171094269 20:22316535-22316557 GGGGACAAGCTGAGCCAGGCAGG - Intergenic
1173224288 20:41152891-41152913 GTGCAAAGGCTGAGGCAGGAAGG + Intronic
1173360254 20:42337823-42337845 GAGGAAAAGCAAAGGCAGGACGG + Intronic
1174090045 20:48039561-48039583 GTGGGAAAATGAAGCCAGGAAGG + Intergenic
1175387884 20:58608823-58608845 GGGGAGAATCGGAGCCAGGTGGG - Intergenic
1175494998 20:59408164-59408186 CTGGAAAACAGGAGCCAGGGTGG + Intergenic
1178690665 21:34747002-34747024 TTGGAAAAGGGCAGGCAGGAGGG - Intergenic
1179292422 21:40030370-40030392 GTGGAGAAGCAAATCCAGGAAGG + Intronic
1180045756 21:45304372-45304394 GTGGGCAAGCTCAGCCAGGAGGG - Intergenic
1180135432 21:45859239-45859261 CAGGAACAGCTGAGCCAGGAGGG + Intronic
1181418162 22:22775139-22775161 GAGGAATAGCCCAGCCAGGAGGG - Intronic
1182067700 22:27442345-27442367 GGGGGAAAGGGGGGCCAGGATGG - Intergenic
1183040455 22:35173950-35173972 GTGGAAATGCAGAGACAGAAAGG - Intergenic
1183063775 22:35350230-35350252 GTGGCCCAGGGGAGCCAGGAGGG - Intergenic
1184507721 22:44914263-44914285 GTGGAAAAGGTGTGTCAGGAGGG - Intronic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185270861 22:49928869-49928891 GGGGAGAAGAGGAGCCAGGCAGG + Intergenic
952277794 3:31894300-31894322 GAGGACAAGGGGAGGCAGGAAGG + Intronic
953902738 3:46852426-46852448 ATGGAGTAGCGGTGCCAGGAAGG - Intergenic
954364385 3:50138515-50138537 GGGGGAATGAGGAGCCAGGAGGG - Intergenic
960375007 3:116890076-116890098 GTGCAGAAACGGATCCAGGAAGG - Intronic
962342281 3:134595713-134595735 GTGGCAAAGCCAAGCCATGAAGG - Intergenic
967068057 3:185938091-185938113 GAGGAAAGGCAGAGCGAGGAGGG - Exonic
968026978 3:195450802-195450824 GTGGAAATGGGCAGACAGGAAGG - Intergenic
969121583 4:4915126-4915148 GTAGAAAAGCAGGGCCAGGGAGG + Intergenic
969315608 4:6379957-6379979 GTGGAGAAGGGGAGGTAGGAGGG - Intronic
969603286 4:8189456-8189478 GAGGAGAAGGGGTGCCAGGAAGG + Intronic
977285084 4:95094393-95094415 GAGGAAGAGGAGAGCCAGGAAGG + Intronic
979620319 4:122791334-122791356 GAGGAAAAGCTGACCCAGGGAGG - Intergenic
980079793 4:128331850-128331872 GTGGAAAAGTGGTTCCATGAAGG + Intergenic
986706483 5:10458271-10458293 CTTGAAAGGCGCAGCCAGGAGGG - Intronic
987397188 5:17435781-17435803 ATGCAAAAGCAGAGCCAGGTGGG + Intergenic
988818579 5:34858872-34858894 ATGGAAAAGCTGAGCCACAAGGG - Intronic
990360963 5:55019741-55019763 GAGGAAAGGTGGAGGCAGGAAGG - Intronic
990424944 5:55678002-55678024 GTGGTAAAGTAGAGCTAGGAGGG + Intronic
992195626 5:74336272-74336294 GTGGAAGAGGTGACCCAGGAGGG - Intergenic
994212132 5:97099140-97099162 GTGGAGGAGAGGGGCCAGGAGGG - Intronic
994470874 5:100204391-100204413 GAGAAAAAACAGAGCCAGGAGGG + Intergenic
995418689 5:111938039-111938061 GAGGGAAAGCTGAGCCAGAATGG - Intronic
996800192 5:127395249-127395271 GTAGAAAAGGGGAGCAGGGAAGG - Intronic
996934365 5:128931346-128931368 GAAGAAAAGCAGAGCCAGTAAGG - Intronic
998353094 5:141513725-141513747 GTGGAAAAGCACCGACAGGAAGG - Intergenic
998981256 5:147705238-147705260 GTGGATTATTGGAGCCAGGAAGG + Intronic
999816710 5:155184317-155184339 TTGAAATAGAGGAGCCAGGAGGG - Intergenic
1001584087 5:172820978-172821000 CTGGTAAACGGGAGCCAGGATGG + Intergenic
1001942712 5:175751839-175751861 GGGGAAAAGCAAGGCCAGGAAGG + Intergenic
1003793030 6:9567902-9567924 GGGGAAAAAAGAAGCCAGGAGGG - Intergenic
1009372339 6:62921680-62921702 GGGGAAAAGAAGAGCCAGAAAGG - Intergenic
1012695985 6:102384464-102384486 GTGGAAGTGAGGAGTCAGGAAGG - Intergenic
1014502585 6:122210814-122210836 GGGGAAAAGTGGAACCAAGAAGG + Intergenic
1015255516 6:131175260-131175282 GTGGAAGTGGGGAGGCAGGAGGG + Intronic
1017960729 6:159218453-159218475 GGGGAAAAGCGGGTGCAGGATGG + Intronic
1018630361 6:165816871-165816893 GTGGAAGAGTGCAGGCAGGAAGG + Intronic
1019524860 7:1476358-1476380 GCGGAGACGCGGAGCCAGGACGG - Exonic
1019697500 7:2454134-2454156 CTTGAAAAGCTGAGACAGGAGGG + Intergenic
1020345303 7:7155757-7155779 TTGGAAAAGTGGAGCCAGAATGG - Intergenic
1020512338 7:9073411-9073433 TTGGAGAAGCTGAGGCAGGAGGG - Intergenic
1020922095 7:14278864-14278886 TTGGAAAGGAGGAGCCAAGACGG + Intronic
1024271764 7:47647787-47647809 GAGAAAAAGCAGAGCTAGGAGGG - Intergenic
1024937130 7:54721746-54721768 GTGACAATGCTGAGCCAGGAGGG + Intergenic
1024953195 7:54886859-54886881 GTGGAGAAGTGAAGCCAGGCAGG - Intergenic
1024991936 7:55241740-55241762 CTGGAAAAGCTGAGCCATGAGGG - Intronic
1026167294 7:67921813-67921835 GGGGAACAGGGGAGGCAGGATGG + Intergenic
1027448733 7:78304706-78304728 GTGAAAAATCAAAGCCAGGAAGG + Intronic
1028327907 7:89549670-89549692 GTGGAAGAGCAAAGCCAGGTGGG + Intergenic
1028574652 7:92333523-92333545 GTAGAAAACCGGAGTCAGGGAGG - Intronic
1031020684 7:116624640-116624662 GGGGCAAAGCGGTGCCAGGGAGG + Intergenic
1031604693 7:123754615-123754637 GTGGCAAAGGGCAGCAAGGATGG - Intergenic
1032008864 7:128328051-128328073 GTGGAAGATAGGAGGCAGGAGGG - Intronic
1032501506 7:132403620-132403642 GAGGAAAAGCCAGGCCAGGAAGG - Intronic
1034068150 7:148156468-148156490 GTGGTCAAGCGGAGGAAGGAGGG - Intronic
1034967276 7:155399097-155399119 GTGGCAAGCCGGAGCCAGGCTGG + Intergenic
1036089021 8:5644931-5644953 GTGGAAATGCAGACACAGGAAGG - Intergenic
1039944983 8:42121214-42121236 CTGGAAAAGAGCAGCCAGAAGGG - Intergenic
1042959466 8:74288192-74288214 GTGGAAAAGCAGCCCCAGGAGGG + Intronic
1044646250 8:94446621-94446643 GTGGGAAATAGGAGACAGGAGGG - Intronic
1044734037 8:95259347-95259369 GTGAGAAAGTGGAGGCAGGAAGG + Intronic
1047691179 8:127356268-127356290 GTGTAAGAGCTGAGGCAGGAAGG + Intergenic
1047930751 8:129726369-129726391 ATGGAAGAGGGGAGGCAGGAGGG + Intergenic
1048767250 8:137858520-137858542 GTGGAAAAGAGAAGCCTGGTAGG - Intergenic
1048973536 8:139658319-139658341 CTGGAAAAGCTGAGCAGGGAAGG + Intronic
1049431467 8:142567215-142567237 GAGGACAAGCGGGGCCAGGGAGG - Intergenic
1049586518 8:143434954-143434976 GTGGAGGAGCCGTGCCAGGAGGG - Intergenic
1049755653 8:144310271-144310293 GTGGGACAGCGGTTCCAGGAAGG - Intronic
1052245101 9:26324792-26324814 GTGGTAAAGGGGAGCCGGCAGGG + Intergenic
1053208365 9:36207024-36207046 GAGGAAAGTCGGAGACAGGAAGG + Intronic
1055098623 9:72440274-72440296 ATAGAAAAGTGGAACCAGGACGG - Intergenic
1056486483 9:87063208-87063230 CTGGAAAAGAGGAGACAGAAAGG + Intergenic
1056591398 9:87968547-87968569 CTGGAAGAGAGGACCCAGGAAGG - Intronic
1056701759 9:88917120-88917142 GTGGAAAAGAGGGACGAGGAAGG - Intergenic
1056993430 9:91431878-91431900 GAGGCAAAGGGGATCCAGGAAGG - Intergenic
1057875568 9:98751608-98751630 GTGGAACAGCAGAGCCACAAGGG + Intronic
1061431307 9:130533016-130533038 GAGGAAGACAGGAGCCAGGAGGG + Intergenic
1061499584 9:130994162-130994184 GTGGAAAAGGGGAGCCAAGAAGG - Intergenic
1061610157 9:131740403-131740425 GTGGAAAATCTGACCCAGGAGGG - Intergenic
1061682107 9:132247972-132247994 GAGGTAAAGTGGAGTCAGGAAGG + Intergenic
1062632933 9:137474458-137474480 GTGGAAAATCTGAGCAAGCAAGG + Intronic
1186109057 X:6236751-6236773 GTGGAAAAGCATGACCAGGAAGG - Intergenic
1186927547 X:14351889-14351911 GTGGAAATGCAGAAGCAGGAGGG + Intergenic
1189426831 X:40909411-40909433 GTGGAAAAGTGGGGGCTGGAGGG + Intergenic
1190533937 X:51407736-51407758 GTGGAAAAGCAGGGCCTGGCTGG - Exonic
1191680529 X:63835606-63835628 GTGGAAGAGTGGAGGCAGGTAGG - Intergenic
1194584687 X:95717895-95717917 GGGGAAAAGGGCAGGCAGGAGGG + Intergenic
1195285137 X:103376597-103376619 GGGGAAAAGCGGAGCAGGTAAGG + Exonic
1196085857 X:111681624-111681646 GTGGAAAACCCGAGCTCGGAGGG - Intronic
1196298273 X:114024413-114024435 CAGGAAAAAGGGAGCCAGGAAGG + Intergenic
1197011638 X:121571026-121571048 GTGGAAAAGGGAAGGCAGCATGG + Intergenic
1198122290 X:133606148-133606170 GTGAAGAAGCCGACCCAGGATGG + Intronic
1199732703 X:150652222-150652244 GTGGAAAAACAGAGCCAGCATGG + Intronic
1199985733 X:152948814-152948836 AGGGCAAAGAGGAGCCAGGAAGG + Intronic
1200142011 X:153907093-153907115 TTAGAAAGGCGGAGACAGGAAGG - Exonic
1200214920 X:154363914-154363936 GTGGGACAGGGGAGTCAGGATGG + Intronic