ID: 1161772161

View in Genome Browser
Species Human (GRCh38)
Location 19:6236735-6236757
Sequence CCCAGGAGGCTGGTTTCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 496
Summary {0: 1, 1: 0, 2: 3, 3: 68, 4: 424}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161772161_1161772170 13 Left 1161772161 19:6236735-6236757 CCCCTGGAAACCAGCCTCCTGGG 0: 1
1: 0
2: 3
3: 68
4: 424
Right 1161772170 19:6236771-6236793 GCAGCTCCTTCATGCCCCTGAGG 0: 1
1: 0
2: 0
3: 32
4: 295
1161772161_1161772171 18 Left 1161772161 19:6236735-6236757 CCCCTGGAAACCAGCCTCCTGGG 0: 1
1: 0
2: 3
3: 68
4: 424
Right 1161772171 19:6236776-6236798 TCCTTCATGCCCCTGAGGCCTGG 0: 1
1: 0
2: 4
3: 18
4: 261
1161772161_1161772173 25 Left 1161772161 19:6236735-6236757 CCCCTGGAAACCAGCCTCCTGGG 0: 1
1: 0
2: 3
3: 68
4: 424
Right 1161772173 19:6236783-6236805 TGCCCCTGAGGCCTGGCAGCAGG 0: 1
1: 1
2: 4
3: 64
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161772161 Original CRISPR CCCAGGAGGCTGGTTTCCAG GGG (reversed) Intronic
900436310 1:2632905-2632927 CCCTGGAGACTGGGTCCCAGTGG + Exonic
900520694 1:3104237-3104259 CCCAGGAGGCGGCCTCCCAGAGG + Intronic
901215342 1:7551801-7551823 ACCAGCTGGCTGGTTCCCAGGGG + Intronic
901744852 1:11365584-11365606 CCCAGGAGGCTAAGTCCCAGGGG - Intergenic
902199514 1:14823108-14823130 CCCAGAAGGCTGCTCTACAGAGG - Intronic
903584471 1:24400837-24400859 CCCAGGAGGCTGGGTTGGGGTGG - Intronic
905803944 1:40862496-40862518 CCCAAGGGGCGGGGTTCCAGTGG - Intergenic
906128803 1:43443543-43443565 CCCAGCAGGATGGTTGACAGTGG + Intronic
906309332 1:44741952-44741974 CCCAGGAGGCTGGAGAGCAGTGG - Intronic
906731219 1:48082916-48082938 ACCAGGAGGCTCTGTTCCAGGGG - Intergenic
907283063 1:53363278-53363300 CCCAGGAGGCTGCTTTGCATGGG + Intergenic
907406791 1:54258670-54258692 CCCAGGCGACGGGTTTCCTGGGG + Intronic
907640039 1:56179477-56179499 CCCAGGACTGTGGTTTCCAAAGG - Intergenic
909429638 1:75572284-75572306 TCCAGGAGGCAGGTCTTCAGAGG + Intronic
909923220 1:81407260-81407282 TCCAGGAGGCTGGTTTTCATTGG - Intronic
910747822 1:90592114-90592136 CCAAGTAGGCTGGTGCCCAGGGG - Intergenic
913577894 1:120195867-120195889 CCCAGCAGGCTGGAGTGCAGTGG - Intergenic
913630275 1:120702462-120702484 CCCAGCAGGCTGGAGTGCAGTGG + Intergenic
914559809 1:148807290-148807312 CCCAGCAGGCTGGAGTGCAGTGG - Intergenic
914613024 1:149322933-149322955 CCCAGCAGGCTGGAGTGCAGTGG + Intergenic
914833710 1:151190065-151190087 CCCAGAAAGCCGGTTCCCAGCGG + Exonic
916095099 1:161342590-161342612 CCCAGGAGGCTGGTCTCATGAGG - Intronic
916120300 1:161523547-161523569 CCGAGGAGCCTCGTCTCCAGAGG - Intronic
916130064 1:161605200-161605222 CCGAGGAGCCTCGTCTCCAGAGG - Intronic
916164065 1:161949174-161949196 CACAGGAGGCTGATTTAAAGAGG - Intronic
916271937 1:162952666-162952688 CCCTGGAGGCTGGAGTGCAGTGG - Intergenic
916556057 1:165895373-165895395 CCCAGGAGGCTGGAGTGCAGCGG - Intronic
916719989 1:167477555-167477577 CCCAGGAGGCTGGAGTGCAGTGG + Intronic
918042229 1:180920338-180920360 CCCAGGACCCTGGCTTCGAGTGG - Intronic
918448586 1:184638381-184638403 CCCAGGATGGTGGTGTGCAGTGG + Intergenic
918450117 1:184649828-184649850 GCCAGGAGGCTGGTCTCTGGGGG - Intergenic
919213885 1:194525761-194525783 AGCAGGAAGATGGTTTCCAGGGG - Intergenic
920123506 1:203675983-203676005 CCCAGGAGGCTAAGTTCTAGGGG + Intronic
921190330 1:212702095-212702117 CCCTGGAGGCTGGAGTGCAGTGG - Intergenic
921716897 1:218426431-218426453 CCCAGTTGGCTGCTTTCCAATGG + Intronic
922686311 1:227641045-227641067 CCCGGGAGCCTGGTTAGCAGGGG - Intronic
922774189 1:228207406-228207428 GCCAGGATGCTGGTTTGAAGGGG + Intronic
924117752 1:240763979-240764001 GCCCAGAGGCCGGTTTCCAGCGG + Intergenic
924738677 1:246781597-246781619 CACAGGAGGAGGGATTCCAGAGG + Intergenic
1063136933 10:3225574-3225596 CCAAGGAGTCTGCTTTGCAGTGG - Intergenic
1063631255 10:7735497-7735519 CCCAGGAGGCGGGAGTGCAGTGG - Intronic
1064346084 10:14534003-14534025 CCCAGGAGGATGTTTTTCCGTGG + Intronic
1065583291 10:27192927-27192949 CCCAGCAGGCTGGAGTGCAGTGG - Intergenic
1065990949 10:31009886-31009908 CCCAGCAGGCTGGAGTGCAGTGG + Intronic
1068283835 10:54909895-54909917 CCCAGGGAGGTGGTCTCCAGGGG + Intronic
1069784129 10:70977215-70977237 CCCAGGAGGCCACTTACCAGAGG + Intergenic
1071451939 10:85803050-85803072 GCCAGAAGGGTGGTTACCAGAGG + Intronic
1071559366 10:86633058-86633080 CACAAGAGGCTGGGATCCAGGGG - Intergenic
1071728858 10:88227790-88227812 GCCAGGAGGCTGATATGCAGAGG + Intergenic
1072885152 10:99266229-99266251 GCCAGGAGGCTGGTTGCCTGAGG + Intergenic
1073267673 10:102237929-102237951 CACTGGAGGCTTGTATCCAGGGG + Intronic
1073295382 10:102435523-102435545 CCCAGCGGGCTGGTCTCAAGGGG + Intergenic
1073407036 10:103307310-103307332 CCCGTGTGGCTGGTTACCAGAGG - Intronic
1073812039 10:107163135-107163157 TCCAGGAGGCTGGATTCCAGGGG - Intronic
1074013423 10:109507725-109507747 CCCAGCAGGCTGGAGTGCAGTGG - Intergenic
1074753516 10:116608718-116608740 CCCAGCAGCCTGGCTTACAGAGG - Intronic
1075262918 10:120978484-120978506 CCCCGGAGCCTGTATTCCAGGGG - Intergenic
1076108008 10:127839780-127839802 CCCAGGCGGCTGGAGTGCAGAGG + Intergenic
1076151519 10:128165781-128165803 CCAAGGAGGCCAGGTTCCAGTGG - Intergenic
1077233840 11:1470548-1470570 CCCACCAGGCTGGGTGCCAGGGG - Intronic
1077466827 11:2737342-2737364 CCCAGGAAGCTGCTCTCCTGGGG + Intronic
1078290752 11:10007774-10007796 CCTAAGAGGGTGGTGTCCAGAGG - Intronic
1079099451 11:17531731-17531753 CCTAGTAGACTGGTTTCCTGGGG - Intronic
1079228068 11:18625598-18625620 CCCAGGCGGCTGGAGTACAGTGG + Intronic
1079674831 11:23213467-23213489 CTCAGGAGGCTGGAGTGCAGTGG - Intergenic
1079982203 11:27163078-27163100 CACAGAAGGCTGGATTACAGAGG + Intergenic
1081730943 11:45371419-45371441 CCCAGGAGATTCGTTTTCAGAGG + Intergenic
1083796389 11:65019195-65019217 CCCAGGAGGCTGGAGTGCAGTGG - Intronic
1084026763 11:66455504-66455526 CCCAGGAGGCTGGAGTGCAGTGG + Intronic
1084056572 11:66637942-66637964 CCTGGGAGGCTGGTTCCCAGAGG + Intronic
1084601692 11:70149573-70149595 CCCAGGAGGCGAGATTGCAGTGG + Intronic
1084912741 11:72404297-72404319 GCTAGGAGGCTGTTTTTCAGTGG + Intronic
1086360006 11:86048792-86048814 CCCAGGAGGCTGAAGTGCAGTGG - Intronic
1088199976 11:107321457-107321479 CCCAGGAGCCTGCTTTGCAGAGG - Intergenic
1088919696 11:114252023-114252045 GCTGGGAGGCTGGTCTCCAGGGG - Intergenic
1089465394 11:118681938-118681960 CCCAGCAGGCTGGAATACAGTGG + Intergenic
1089949238 11:122510012-122510034 TCCAAGCGGCTGGTCTCCAGGGG - Intergenic
1090267386 11:125361865-125361887 CCCTGCAGGCAGGTTTCCTGTGG + Intronic
1090563891 11:127965089-127965111 ACCTGGAGTCTGGTATCCAGGGG - Intergenic
1090785660 11:130045141-130045163 CCCAGGAGGCAGGAGTGCAGTGG + Intergenic
1091192851 11:133708753-133708775 CCCAGGAAACCAGTTTCCAGGGG - Intergenic
1091700144 12:2653790-2653812 CCCATGAGGCTGGAGTGCAGAGG - Intronic
1092170179 12:6369464-6369486 CAGAGGAGGCTGGGTTCCATAGG + Intronic
1092684565 12:11027613-11027635 CCCAGGCTGCTGGTCTCAAGTGG + Intronic
1093684932 12:22045195-22045217 CCCAGAAGGCTGGAGTGCAGTGG - Intergenic
1094024782 12:25951057-25951079 CTCAGGGGTCTTGTTTCCAGAGG - Intergenic
1095426094 12:42076078-42076100 CCCAGGAGGCTGGAGTGCAGTGG + Intergenic
1095466013 12:42488798-42488820 ACCAGTAGTATGGTTTCCAGGGG + Intronic
1096294579 12:50372859-50372881 CCCAGGAGACTGGAGTGCAGTGG - Intronic
1097277694 12:57824418-57824440 CCCAGGAGGCTGGGCTGCAGGGG - Intronic
1097671657 12:62546712-62546734 CCCAGGAGGCAGGAGTGCAGTGG - Intronic
1099287381 12:80731340-80731362 CCCAGCAGGCTGGAGTGCAGAGG - Intergenic
1101443994 12:104724275-104724297 CTCAGGAGGATGGCTACCAGGGG + Intronic
1101791684 12:107933496-107933518 CCCAGGGAGCTGGTCTTCAGTGG - Intergenic
1102276036 12:111582706-111582728 CCCAGCAGGCTGGAGTGCAGTGG + Intronic
1102570800 12:113825835-113825857 CCCAGGAGTCTGGTCTCAAACGG + Intronic
1103961248 12:124610430-124610452 CCCAGGATGCTGAGTTCCACAGG + Intergenic
1105039117 12:132947931-132947953 CCCAGGCTGTTGGTTTCCAAGGG - Intronic
1105280855 13:18961844-18961866 CCCAGGAGGCTGAGTCCCAAGGG + Intergenic
1105679566 13:22712650-22712672 CCCAGGTGCCTGGTGTCCAATGG - Intergenic
1106370670 13:29129745-29129767 CCCAGCATGCTGGTTCTCAGGGG + Intronic
1107018208 13:35725722-35725744 CCCAGGTGGCTGGTTACCTTAGG - Intergenic
1108131860 13:47310323-47310345 GCCAGGAGGCTGGTAGCCTGGGG + Intergenic
1110613377 13:77514013-77514035 CCCTGGAGTCTGGTGTCCAAGGG + Intergenic
1112306604 13:98280209-98280231 CCCAGGAGGCTGTTTTCTAGGGG - Intronic
1113240209 13:108328710-108328732 GCCAGGAGGCTGGTAGCCTGAGG + Intergenic
1113373968 13:109746580-109746602 GAGAGAAGGCTGGTTTCCAGGGG - Intergenic
1113651472 13:112036729-112036751 TCCCGGAAGCTGATTTCCAGGGG + Intergenic
1113905719 13:113818298-113818320 CCCAGGGGGCTGTGTTCCACGGG + Intergenic
1114336911 14:21699763-21699785 GCCAGGAGGCTGGTAGCCTGGGG + Intergenic
1114736974 14:25051588-25051610 CCCAGGAAGATGGTTTGGAGGGG + Intergenic
1114769759 14:25415460-25415482 CCCAGGAGAATGATTTCCTGAGG + Intergenic
1115682076 14:35751739-35751761 CCCAGGAGGCTGGAGTGCAATGG - Intronic
1116073083 14:40074142-40074164 CCTAGGAAGTTTGTTTCCAGTGG - Intergenic
1116941837 14:50798383-50798405 CCCAGGAGGAAGGCTTCCAGGGG + Intronic
1117570033 14:57038566-57038588 TCTAGGAGGATGCTTTCCAGGGG + Intergenic
1118318115 14:64737821-64737843 CCCAAGAGGCTGGTCACGAGGGG + Intronic
1118598194 14:67452281-67452303 CCCAGCAGGCTGGAGTGCAGTGG - Intronic
1118787577 14:69058832-69058854 CCCAGCAGGCTGGAGTACAGTGG - Intronic
1119105372 14:71918139-71918161 CCCAGCAGGCTGGAGTGCAGTGG - Intergenic
1119647108 14:76355901-76355923 CCCAGGTGTCTGGTGTGCAGAGG + Intronic
1119676386 14:76558455-76558477 CCCAGCAGGCTGGAATGCAGTGG - Intergenic
1120373517 14:83670051-83670073 AACAGATGGCTGGTTTCCAGGGG - Intergenic
1121224188 14:92309366-92309388 CCGAGGGGGCGGGCTTCCAGGGG - Intergenic
1121308317 14:92921339-92921361 AATAGGATGCTGGTTTCCAGGGG - Intergenic
1121410616 14:93746085-93746107 CCTAGGAGGTCGGTTTTCAGGGG + Intronic
1121967339 14:98322625-98322647 CCCAGGCAGCATGTTTCCAGAGG - Intergenic
1122112269 14:99510691-99510713 CACAGGAGGCTGTCCTCCAGGGG - Exonic
1123936819 15:25198081-25198103 TCCAGGAGGCTGGCTTCCTTGGG + Intergenic
1124671499 15:31645070-31645092 TCCAGGAGGCTGGAGTCCACAGG - Intronic
1124788807 15:32707330-32707352 CCCAGCAGGCTGGCGTGCAGTGG - Intergenic
1124804745 15:32870350-32870372 ACCAGGAAGCTGGAGTCCAGGGG + Intronic
1124868454 15:33517032-33517054 CCCAGGCTGCTGGTGTGCAGTGG + Intronic
1125298867 15:38233025-38233047 CCCAGCAGGCTGGAGTGCAGTGG - Intergenic
1125592574 15:40864062-40864084 CCCAGGAGGCTGGGAACCAAAGG + Intergenic
1125702464 15:41699539-41699561 CCCAGGCGGCTGGAGTGCAGTGG + Intronic
1126539694 15:49808242-49808264 CCCAGGAGAAGGGTTTCTAGAGG - Intergenic
1127798900 15:62460986-62461008 CCCAGCAGGCTGGAGTACAGTGG + Intronic
1127869589 15:63060174-63060196 CACAGGAGGCTGTTTTCATGGGG - Intronic
1129136502 15:73557107-73557129 CCCAGCAGGCTGGAGTGCAGTGG + Intronic
1129240000 15:74245449-74245471 GCAGGGAGGCTGGTTTCTAGCGG + Intronic
1129407129 15:75327369-75327391 CCCAGAATGGTGATTTCCAGAGG + Intergenic
1130060674 15:80567592-80567614 GCCAGGGGGCTGGTTTTCACAGG - Intronic
1130120920 15:81046879-81046901 CCCAGCAGGCTGGAGTGCAGTGG - Intronic
1131153229 15:90059814-90059836 ACCAAGAGGCTGGTTTCCTTAGG + Intronic
1131163900 15:90128580-90128602 CCCAGGAGAGAGGTGTCCAGGGG + Intergenic
1133359087 16:5159467-5159489 CTCAGGAGGCCAGTTTCCAAGGG - Intergenic
1133940163 16:10302529-10302551 CCCTGGAGGCTGGAGTACAGTGG + Intergenic
1134665984 16:16019177-16019199 CCCAGGAGGCGGGGTTGCAGTGG - Intronic
1135072003 16:19360388-19360410 CCCAGTACCCTGGCTTCCAGGGG - Intergenic
1135466260 16:22687880-22687902 CCCAGGAGGCTGGAGTGCAGTGG + Intergenic
1136372871 16:29847192-29847214 TCCAGGAGGCTGAGCTCCAGAGG + Exonic
1136991555 16:35154449-35154471 CCCAGGAGGCTGATCTGAAGGGG - Intergenic
1137791854 16:51181717-51181739 CCCAGATGGGTGGTTTGCAGAGG + Intergenic
1139193805 16:64895270-64895292 CCCAGGCGGCTGGAGTGCAGTGG + Intergenic
1139932575 16:70540430-70540452 CCCAGGATGCTGGAGTGCAGGGG + Intronic
1140044308 16:71430589-71430611 CCCAGTTGGTTGGATTCCAGTGG - Intergenic
1140644853 16:77018385-77018407 CCCAGCTTGCTGGTCTCCAGTGG + Intergenic
1141400615 16:83743931-83743953 ACCAGCATGCTGGATTCCAGGGG - Intronic
1141509847 16:84505074-84505096 CCCAGGAGGCTGCACTGCAGAGG - Intronic
1141917281 16:87108003-87108025 CCCAGGAGGCTGCCTTGCACAGG - Intronic
1142305070 16:89280231-89280253 TCCAGGAAGCTATTTTCCAGGGG + Exonic
1143475224 17:7198974-7198996 CCCAGCAGGCTGGAGTGCAGTGG - Intronic
1144525884 17:15989668-15989690 CCAGGCAGGCTGGATTCCAGTGG + Intronic
1145058144 17:19716479-19716501 CTCAGCAGGCTGGTTCCCAGAGG - Exonic
1146542951 17:33713190-33713212 ACCAGGAGGCTGGTTTCTGGGGG + Intronic
1146889707 17:36498450-36498472 TCCAGGAGCCTGGTCTGCAGCGG + Exonic
1147188174 17:38724129-38724151 CCCAGGTAGCTGGATTACAGGGG - Intronic
1147377903 17:40033670-40033692 CCCAAAAGCCTGATTTCCAGGGG + Intronic
1147500537 17:40959036-40959058 CCTAGGATGCTGATTTCCAATGG - Intronic
1147660211 17:42113297-42113319 CCCAGGTGGCTGTTTCCCTGAGG - Exonic
1147858763 17:43503621-43503643 CCCAGCAGGCTGGAGTGCAGTGG - Intronic
1147891803 17:43722663-43722685 CCCAGGGGACTGGTTCCCATCGG - Intergenic
1148066776 17:44876811-44876833 CCCAGCAGGCTGGAGTGCAGTGG - Intronic
1148121795 17:45217362-45217384 CCCAGGCGGCTGGAGTGCAGTGG - Intergenic
1148141783 17:45334143-45334165 TGCAGGAGGCTGGTGTCCAGAGG - Intergenic
1149130430 17:53294612-53294634 AGTAGGAGGATGGTTTCCAGAGG - Intergenic
1149221368 17:54418405-54418427 GCCAGGAGGCTGGTAGCCTGGGG + Intergenic
1149758133 17:59204986-59205008 CCCAGCAGGCTGGAGTGCAGTGG - Intronic
1149758283 17:59206324-59206346 CCCAGCAGGCTGGAGTGCAGTGG - Intronic
1149926133 17:60703872-60703894 CCCAGGCGGCTGGAGTGCAGCGG - Intronic
1150125546 17:62632345-62632367 GCCAAGAGGCTGGTGCCCAGCGG - Intronic
1150211605 17:63445133-63445155 GCCAGGAGGCTGGAGTGCAGAGG - Intronic
1151280617 17:73071505-73071527 CCCAACTGGCTGATTTCCAGGGG - Intronic
1151552031 17:74827849-74827871 GCCAAGAGGCTGGTCTCCAGTGG + Intronic
1151566473 17:74901280-74901302 CCCAGGCAGCTGCTTTCCTGTGG + Intergenic
1151592348 17:75053805-75053827 CCCATGAGACTGGTTTCAAGTGG - Intronic
1152219982 17:79058351-79058373 CCCAGGAAACTTGTTTCCACTGG - Intergenic
1152291604 17:79443025-79443047 CACAGGTGGATGTTTTCCAGGGG - Intronic
1152317905 17:79591440-79591462 CCAAGGAGTCTGGTGTCCATCGG - Intergenic
1152524188 17:80878134-80878156 CCCAGCATGCTCCTTTCCAGAGG - Intronic
1152761039 17:82107192-82107214 TCCAGGGGCCTGGTCTCCAGGGG - Intronic
1152814238 17:82398014-82398036 CCCAGGAGGCTGGTGTCTACGGG - Intronic
1152865126 17:82717677-82717699 CCCAGCAGGCTGGAGTGCAGTGG - Intronic
1155634402 18:27935436-27935458 ATCATGAGGGTGGTTTCCAGTGG - Intergenic
1155923239 18:31626719-31626741 CCCAGGAGGATGGTTTCGGGAGG - Intronic
1156362278 18:36393645-36393667 TCCAGGAGAATGGTTTCCTGGGG - Intronic
1156517571 18:37694049-37694071 CCCAGAAGGCTGGAGTGCAGTGG + Intergenic
1157283809 18:46363549-46363571 CACAGGAGGGAGGTTTGCAGGGG - Intronic
1157417886 18:47521188-47521210 CCCAGCAGGCTGGAGTGCAGTGG - Intergenic
1158689316 18:59645989-59646011 CCCAGGAGGCTGGACTGCAGTGG - Intronic
1159634833 18:70792270-70792292 CCCAGCAAGGTGGTTTACAGTGG - Intergenic
1160021506 18:75185257-75185279 CCCTGAGGGCTGGTTTCCAGGGG + Intergenic
1160112818 18:76049441-76049463 CCCAAATGGCTGATTTCCAGTGG + Intergenic
1161772161 19:6236735-6236757 CCCAGGAGGCTGGTTTCCAGGGG - Intronic
1163159981 19:15458548-15458570 CCCAGGAGGCTGGGGTGCAGTGG + Exonic
1163238845 19:16046438-16046460 CCCAGGCGGCTGGAGTACAGAGG - Intergenic
1163566444 19:18054621-18054643 CCCAGGAGGCTGGAGTGCAGTGG - Intergenic
1163672832 19:18638462-18638484 CCCAGGAGGTGTGTGTCCAGAGG + Intronic
1164018371 19:21273494-21273516 GCCAGGAGGCTGGTAGCCTGGGG - Intronic
1164810099 19:31148638-31148660 CCCAAGTGGCTGGTATACAGTGG + Intergenic
1165898623 19:39157679-39157701 CTCAGGAGGCTGGTGGCCAGGGG - Intronic
1166225817 19:41394555-41394577 CCCAGGAGGCTGGAGTGCAGTGG + Intronic
1166628620 19:44384955-44384977 CCCAGGTGGCTGGAGTGCAGTGG - Exonic
1167400649 19:49266139-49266161 CCCAGGAGGCTGGAGTGCAGTGG - Intergenic
1167810944 19:51829626-51829648 CCCAGGAGCCTGGTATCCTGTGG - Intergenic
925384981 2:3455517-3455539 AGCAGGAGGATGGTTACCAGAGG - Intronic
926111739 2:10188173-10188195 CCCAGGTGGCTGGGGTGCAGTGG + Intronic
927034470 2:19159342-19159364 ACCACCAGGGTGGTTTCCAGTGG + Intergenic
927683588 2:25155790-25155812 CCCTGGAGTCTGCTTTCCAAAGG + Exonic
928177792 2:29046791-29046813 CCCAGGAGGCAGAGTGCCAGGGG - Intronic
928262602 2:29781347-29781369 CCCAGAAGAGTGGTTTCCATTGG - Intronic
928633776 2:33221300-33221322 CCCAAGAGGCTTGTTTCCCAAGG + Intronic
928863501 2:35889383-35889405 CCAAGAATGATGGTTTCCAGAGG - Intergenic
929340700 2:40813376-40813398 CCCAAGAGGCAGATTCCCAGTGG + Intergenic
929679847 2:43981615-43981637 CCCAGCAGGCTGGAGTGCAGTGG - Intronic
930060915 2:47287759-47287781 CCTAGAATGCTGGTTGCCAGGGG + Intergenic
931272979 2:60718977-60718999 CCCAGGAGGCTGGAGTGCAATGG - Intergenic
932449664 2:71801613-71801635 CCCAGGAGAGTGGAATCCAGAGG + Intergenic
932574307 2:72954462-72954484 GCCAGGAGGCTTGTTTCCTGTGG - Intronic
933067869 2:77820580-77820602 CCCAGGAAACTGATTTCTAGAGG - Intergenic
933354502 2:81195977-81195999 TCCAGGAGGCTATTTTCCAGGGG + Intergenic
934775374 2:96933826-96933848 GCCAGGAGGCTGGTTCCTAAAGG + Intronic
935758027 2:106292602-106292624 CCAAGGAGGCTCGGCTCCAGTGG - Intergenic
935901727 2:107799895-107799917 TCCTGAAGGCTGGTTTCCTGTGG + Intergenic
936083767 2:109452887-109452909 CCCAGGAGGCTGGTCCCGGGAGG + Intronic
936090002 2:109495354-109495376 GCCAGGAGGCAGGCATCCAGTGG - Intronic
936911357 2:117597143-117597165 GCCAGGAGGCTGGTAGCCTGGGG - Intergenic
936986258 2:118313720-118313742 GCCTGGAGGCTGGGTTCCAAGGG + Intergenic
937330899 2:121028694-121028716 CCCAGGAGGGGAGTTTCTAGTGG + Intergenic
937524015 2:122745296-122745318 TCCAGAAGGCTGATTTCCATAGG + Intergenic
938544983 2:132320183-132320205 CCCAGGTGGCTGGAGTACAGTGG + Intergenic
938812891 2:134870010-134870032 CCCAGGCAGCTGGGTGCCAGGGG + Intronic
940796849 2:158089389-158089411 ACCAGGAGGCTGGTAGCCTGGGG - Intronic
941220512 2:162773446-162773468 CCGAGGAGGCTGGAGTGCAGCGG - Intronic
942586975 2:177491307-177491329 CCCAGCAGGCTGGAGTGCAGTGG + Intronic
943956050 2:194191395-194191417 CCCAGGAGGCTGGAATGCAGTGG - Intergenic
944121193 2:196242730-196242752 CCCAGCAGGCTGGAGTGCAGTGG + Intronic
945052337 2:205836096-205836118 CCCAGCAGTTTGGTTTCCAGTGG - Intergenic
946154291 2:217797016-217797038 CCCAGGAGGCTGGAGTGCAGTGG - Intergenic
946158477 2:217822010-217822032 TCCAGGAAGCTGTGTTCCAGGGG - Intronic
946183056 2:217960451-217960473 TCTAGGAGGCTGGCTCCCAGGGG + Intronic
946283009 2:218679986-218680008 GCCAGGAGGCTTGATTCCTGAGG - Exonic
946394356 2:219435668-219435690 CCCAGGAGGCTTTTCTCCACAGG - Intronic
947029083 2:225772259-225772281 CGCAGGAAGCTGGTTTTCTGTGG + Intergenic
947342253 2:229152291-229152313 TCCAGGAGTCTGCTTGCCAGGGG + Intronic
1168798642 20:629387-629409 CCCAGGAGGCTGGAGTGCAGTGG + Intergenic
1169324355 20:4663263-4663285 CCCATGGGGCTGATTTACAGAGG - Intergenic
1170136272 20:13076863-13076885 CCCAGGAGGCAGGTTCCCGGAGG + Intronic
1170141066 20:13125278-13125300 TCCAGAATGCTGGTTTTCAGTGG - Intronic
1171157249 20:22887391-22887413 CCCACGAAGCTGGTTTCCATAGG - Intergenic
1171723899 20:28596723-28596745 CCCAGCAGGCTGGAGTGCAGTGG - Intergenic
1171859456 20:30383205-30383227 CCCAGCAGGCTGGAGTGCAGTGG + Intronic
1172102318 20:32492663-32492685 CACAGGTGCCTGGTGTCCAGTGG - Intronic
1172184087 20:33020606-33020628 CCCAGGACGGGGGTTTCTAGAGG - Intronic
1172996205 20:39072208-39072230 CCCAGGAGTCAGGCTTCCCGGGG - Intergenic
1173153209 20:40585462-40585484 CCAAGCAGACTGGGTTCCAGTGG - Intergenic
1173329397 20:42061988-42062010 CCCAGGGGGCTGGCTAACAGAGG + Intergenic
1173897581 20:46562610-46562632 CCTAGGAGGCTGCTTTCTATTGG - Intronic
1174067841 20:47878578-47878600 CCCAGGAGGCGGGCTTCACGAGG - Intergenic
1174562416 20:51440807-51440829 TCCAGGAGGCTGGTCTCTAAGGG + Intronic
1175232502 20:57482704-57482726 CACAGGAGGCTGGCTGCCAGTGG - Intergenic
1175276866 20:57777468-57777490 CCCAGCAGGCTGGAGTGCAGTGG + Intergenic
1175405182 20:58721498-58721520 AGTAGGAGGCTGGTTGCCAGGGG + Intergenic
1175553804 20:59833581-59833603 CCCTGGAGGCTAGTGTCCACTGG - Intronic
1175572484 20:60034554-60034576 CTTAGGAGACTGCTTTCCAGAGG + Intergenic
1175814155 20:61874871-61874893 CGCGGGAGGCTTGTTTCCAGAGG + Intronic
1175924938 20:62466976-62466998 CCTGGGAGGCGGGTGTCCAGGGG - Intronic
1176026571 20:62988900-62988922 CCCAGGAGGTTGCTGTCGAGGGG - Intergenic
1177055242 21:16293533-16293555 CCTATAAGGCTGGTTTGCAGAGG + Intergenic
1177193630 21:17879587-17879609 CCCAGGAGGCTGGAGTGCAGTGG - Intergenic
1177559347 21:22730111-22730133 CCCAGGAAGCTGCTTCCCCGTGG + Intergenic
1179158258 21:38870078-38870100 AGCAGAAGGCTGGTTACCAGAGG - Intergenic
1179496246 21:41772884-41772906 CCCAGAAGGATGGTGGCCAGCGG - Intergenic
1180136930 21:45868003-45868025 CACAGGAGGCTGGCAGCCAGGGG + Intronic
1180297455 22:10955413-10955435 CCCAGCAGGCTGGAGTGCAGTGG - Intergenic
1180410979 22:12608386-12608408 CCCAGCAGGCTGGAGTGCAGTGG + Intergenic
1180899652 22:19361127-19361149 CCTTGGAGATTGGTTTCCAGTGG - Intronic
1180903330 22:19390557-19390579 CCCAGCAGGCTGGAGTGCAGTGG - Intronic
1181032447 22:20155033-20155055 CCAAGGAGGATGGTGCCCAGGGG - Intergenic
1181784970 22:25220493-25220515 CCCAGAGGGCTGGTTTCTTGCGG + Intronic
1183246674 22:36699204-36699226 CCCAGCAGGCTGGTGTCCTTAGG - Intronic
1183897013 22:40977562-40977584 CCCAGGAGGCTGAAGTGCAGTGG + Intergenic
1184178088 22:42801179-42801201 CTCAGGAGGCAGGTGTCAAGAGG + Intronic
1184211375 22:43037527-43037549 CCCAGCAGGCTGGAGTGCAGTGG - Intergenic
1184346868 22:43918918-43918940 GACAGGATGGTGGTTTCCAGGGG + Intergenic
1184631551 22:45784600-45784622 GACAGGAGGCTGGCTTCCTGTGG + Intronic
1184766825 22:46576691-46576713 CCCGGGACGCGGGTTTCCACCGG + Intronic
1184783868 22:46662449-46662471 CCGTGGAGGCTGCTTTCCAGAGG + Intronic
1185325679 22:50224876-50224898 GCCAGGAGGCTGGAGTGCAGCGG - Intronic
949902184 3:8824930-8824952 CCCAAGAAGCTGGATTACAGAGG - Intronic
950391021 3:12697000-12697022 CCCAGGCTGCTGGAGTCCAGTGG + Intergenic
950660672 3:14465026-14465048 CCCAGGACGGTGGTTTACAGTGG - Intronic
951864465 3:27292459-27292481 CCCAAGACACTGGTTTCAAGGGG + Intronic
952203316 3:31152787-31152809 ACCAGGAGGCTGGAGTGCAGTGG - Intergenic
952223456 3:31349251-31349273 CCCAGGAGGCTGGAGTGCAGTGG - Intergenic
952865672 3:37853721-37853743 GGTAGGAGGCTGGGTTCCAGGGG + Intergenic
952886988 3:38018065-38018087 CCCATGACTCTGGTTCCCAGAGG - Intronic
952965496 3:38618525-38618547 TCCCGGTGGCGGGTTTCCAGCGG + Intronic
953213741 3:40898535-40898557 CCCAGGAGGCTGGTTCCATGTGG + Intergenic
953381107 3:42473500-42473522 CCCAGGAGCCTAGTTCCCAAGGG - Intergenic
954027870 3:47797341-47797363 CCCAGGAGTCTTGTTTCTACCGG - Intergenic
954609354 3:51936150-51936172 CCCAGGATGCAGGTTCCCTGAGG + Intronic
955032448 3:55233987-55234009 CTCAGGAGGCTGGTTTTCAGAGG + Intergenic
956399645 3:68863201-68863223 CCTAGGAGGCTGGAGTGCAGTGG - Intronic
956701444 3:71962739-71962761 CCCAGGAGGCACCTTTCCTGTGG + Intergenic
957219631 3:77365103-77365125 CCCAGCAGGCTGGAGTGCAGTGG - Intronic
957402778 3:79737954-79737976 ACTAACAGGCTGGTTTCCAGCGG - Intronic
959383022 3:105665341-105665363 CCCAGCAGGCTGGAGTGCAGTGG - Intronic
959487253 3:106941218-106941240 CTCAGAATGATGGTTTCCAGCGG - Intergenic
959871153 3:111329992-111330014 CCTAGGAGGCTGACTTCTAGAGG - Intronic
960621675 3:119642996-119643018 CCCAGGCTGCTGTTATCCAGAGG + Intronic
961182352 3:124886960-124886982 CCCAGGAGGCAGGCGTACAGCGG + Exonic
961835540 3:129655480-129655502 GCCAGAAGGTTGGTTTCCATTGG - Intronic
962028352 3:131572559-131572581 CCAAGGAGGCTTGCTTCCTGGGG + Intronic
962348933 3:134642743-134642765 GGAGGGAGGCTGGTTTCCAGGGG + Intronic
963008679 3:140749759-140749781 GCCAGGAGCCTGGCTCCCAGGGG - Intergenic
964030703 3:152135883-152135905 CCCAGGCGGCTGGAGTGCAGTGG + Intergenic
964476031 3:157098433-157098455 TGGAGGAGGCAGGTTTCCAGTGG + Intergenic
964606224 3:158562899-158562921 TCCTGGAGGCTGTTTCCCAGGGG + Intergenic
965358396 3:167707198-167707220 CCCAGGAGGATGATTTTAAGAGG - Intronic
966412497 3:179657818-179657840 CCCAAGAGTCTGGTTGTCAGGGG + Intronic
968190833 3:196665944-196665966 CCCAGGAGGCTGGCCTCAATGGG + Intronic
968603261 4:1520330-1520352 GCCACGGGGATGGTTTCCAGGGG + Intergenic
968682859 4:1933427-1933449 CCCAGGCGGCTGGAGTGCAGTGG + Intronic
969315792 4:6380779-6380801 CCCAGGGGCATGGATTCCAGGGG - Intronic
969387090 4:6859887-6859909 CCAGGGAGGCTGGTTTCAGGGGG - Intronic
969583952 4:8081302-8081324 CCCACGAGGCTGGTGGCCACGGG - Intronic
969607964 4:8211719-8211741 CCCAGGAGCCTGGATTCTAGTGG + Intronic
969662773 4:8539860-8539882 CCCATGAGGCTGGGTTCTTGGGG + Intergenic
971040563 4:22747396-22747418 CCAAGGAGGTTGGTTGTCAGAGG + Intergenic
972097365 4:35364676-35364698 GCCAGGAGGCTGGTAGCCTGGGG - Intergenic
972535903 4:39999682-39999704 CCCAGGCGGCTGGAGTGCAGTGG - Intergenic
974667294 4:64980526-64980548 CCCAGGCAGCTGGGTTGCAGTGG + Intergenic
975666965 4:76741788-76741810 CCCAGGAGGATGGCTCCCTGGGG - Exonic
976723272 4:88191167-88191189 CCCAGGAGGCTGGAGTGCACTGG + Intronic
977114883 4:93011485-93011507 GCATGGGGGCTGGTTTCCAGGGG - Intronic
977294970 4:95200132-95200154 CCCTGGAGCCTGCTTCCCAGTGG + Intronic
977550245 4:98434658-98434680 CCCAGGAGGCTAGAGTGCAGTGG + Intronic
982817545 4:159905198-159905220 CCCAGGATGCTCTTTCCCAGTGG + Intergenic
983007620 4:162503929-162503951 CCCAGCAGGCTGGAGTACAGTGG - Intergenic
984789119 4:183598024-183598046 CCCAGGAGGCTGGAGTGCAGTGG - Intergenic
984873881 4:184350413-184350435 CTCAGGAGGCTGCTTTGAAGGGG + Intergenic
985270860 4:188193557-188193579 CCCAGCAGGCTGGAGTGCAGTGG - Intergenic
985490578 5:176126-176148 GCCAGGAGGCTGGGGGCCAGAGG - Intronic
985649779 5:1102083-1102105 CCCAGGAGGCTGTTCCCCAAGGG - Intronic
987222898 5:15808650-15808672 CCCAAGTGGCTAGTTTCCAGTGG + Intronic
988546935 5:32166730-32166752 CCCAGGAGGCGGAGTTGCAGTGG + Intronic
988677621 5:33449493-33449515 CCCAGGAGGCTAGAGTGCAGTGG + Intronic
988993421 5:36692914-36692936 CTCATGATGCCGGTTTCCAGGGG - Intergenic
990332103 5:54738420-54738442 CCCAGCAGCCTGGTTTTAAGAGG - Intergenic
990380466 5:55217803-55217825 CCCAGGCGGCTGGTGTGCAGTGG + Intergenic
990626498 5:57618581-57618603 CCCAGGTGGCTGGGTTCCAAAGG - Intergenic
990864221 5:60362817-60362839 CCCAGGGGGCTGGAGTGCAGTGG - Intronic
991044716 5:62210791-62210813 GCCAGGAGGCTGGAGTGCAGTGG - Intergenic
991485206 5:67128339-67128361 CCCAGCTGGCTGGCTTACAGTGG + Intronic
996080764 5:119255778-119255800 GCCAGGAGGCTGGTAGCCTGGGG + Intergenic
996566720 5:124887391-124887413 CCCAGTAGGATTGTTTCCAAAGG - Intergenic
998224432 5:140315563-140315585 CCCAGGACTCTGCTTCCCAGGGG + Intergenic
999105822 5:149070099-149070121 CCCAGGAGGCTGGCCTCTATGGG - Intergenic
999318767 5:150600630-150600652 GGCAGGGGGCTGGATTCCAGGGG + Intergenic
999644103 5:153701016-153701038 AGCTGGAGGCTGGTTTCCATGGG + Intronic
1001500912 5:172233071-172233093 CCCAGCAGGCTGGAGTGCAGTGG - Intronic
1001545292 5:172567346-172567368 CCATGGAGGTTGGCTTCCAGGGG - Intergenic
1001551404 5:172604688-172604710 TCCAGAAGCCTTGTTTCCAGAGG + Intergenic
1001848560 5:174942739-174942761 CCCAGGAGGGGGGGTTGCAGTGG - Intergenic
1002163797 5:177332516-177332538 CCCAGGAGTCTGGTTTTAACTGG - Intronic
1002384623 5:178857151-178857173 CCCAGGCGGCTGGAGTGCAGTGG + Intergenic
1002403718 5:179011933-179011955 TCCAGGAGGATGGTTACCACTGG + Intergenic
1002644459 5:180646335-180646357 GCAAGGAGGCTGGTGTCCAGGGG - Intronic
1003633072 6:7806120-7806142 CCCAGGAGGCTGGCACCAAGTGG - Intronic
1003824810 6:9941742-9941764 CGTATGAGGCTGGGTTCCAGAGG + Intronic
1005856094 6:29864191-29864213 CCCGGGAGGCTGGGTCCCCGCGG + Intergenic
1005915593 6:30348075-30348097 CCCAGGAGGCAGAGTTGCAGTGG + Intergenic
1005955419 6:30660049-30660071 CCCCGGACGCAGGTTTCCTGTGG - Exonic
1006169552 6:32085298-32085320 CCTGGGAGCCTGGTTTGCAGTGG - Intronic
1006914768 6:37587173-37587195 CTCAGGTGGCCGGTGTCCAGAGG + Intergenic
1007541781 6:42653122-42653144 CCCAGGAAGCTGGAGTGCAGTGG + Intronic
1008389898 6:50938179-50938201 CCAAGTATACTGGTTTCCAGAGG + Intergenic
1009544598 6:65007063-65007085 TCCAGGATGCTGGATTCTAGTGG - Intronic
1011593777 6:88996876-88996898 CCCACCAGGCTGGAGTCCAGTGG + Intergenic
1013196406 6:107848454-107848476 CCCCGGAGTCCGGATTCCAGCGG - Intergenic
1014175050 6:118323020-118323042 CCCAGGCGGCTGGAGTGCAGTGG - Intergenic
1015237362 6:130986623-130986645 CCCAGGAGGCTGGAGTGCAGTGG + Intronic
1017694615 6:157001928-157001950 CCCACGCTGCTCGTTTCCAGAGG + Intronic
1018111915 6:160544580-160544602 CTCAGGATGCTGGTCTTCAGTGG + Intronic
1018131345 6:160734935-160734957 CTCAGGATGCTGGTCTTCAGTGG - Intronic
1018790286 6:167143152-167143174 GCCAGGGGGCTGGTTCTCAGAGG - Intergenic
1019580085 7:1757656-1757678 CCCAGGATCCTGGCTCCCAGAGG - Intergenic
1020357538 7:7293490-7293512 CGCAGGAGGGTGGTTGGCAGAGG - Intergenic
1020672730 7:11138078-11138100 CCCAGCAGGCTGGAGTGCAGTGG + Intronic
1021507416 7:21401194-21401216 CCCAGCAGGCTGGACTGCAGTGG + Intergenic
1021968405 7:25944826-25944848 CCAAGGAGGGTGGCCTCCAGGGG - Intergenic
1022650582 7:32270518-32270540 AAAAGGAGGTTGGTTTCCAGTGG + Intronic
1023182991 7:37504472-37504494 CCCAGGAGGTTGGAGTGCAGTGG - Intergenic
1023300553 7:38766330-38766352 CCCAGGATCCTGGGTTGCAGAGG - Intronic
1023396404 7:39755689-39755711 CCCAGCAGGCTGGAGTGCAGTGG - Intergenic
1026031909 7:66801556-66801578 ACCAGAAGGATGGTTACCAGAGG - Intronic
1026052684 7:66960351-66960373 CCCAGGAGGCTGGAATGCAGTGG + Intergenic
1026819211 7:73535537-73535559 CCCAGCAGGCTGGAGTACAGTGG - Intergenic
1027058610 7:75067588-75067610 CCCAGAAGGCTGGAGTGCAGTGG - Intronic
1032082403 7:128866226-128866248 CCCATGAGCCTGGCTTCCTGAGG - Intronic
1032463643 7:132129825-132129847 CCCACTGGGCTGGTGTCCAGAGG - Exonic
1032502114 7:132407582-132407604 CAAAGTAGGTTGGTTTCCAGGGG - Intronic
1032593575 7:133216160-133216182 CCCAGGCGGCTGGAGTGCAGTGG + Intergenic
1034536313 7:151727989-151728011 CCCAGCAGCCTGCTTTCCAGAGG + Intronic
1035314250 7:157988363-157988385 CTCCTGAGGCTGGTTTGCAGTGG + Intronic
1035323851 7:158052475-158052497 CCCAGGAGGCTGGGTGCCTTTGG - Intronic
1036955130 8:13179750-13179772 CCCAGGAAGCTAATTACCAGAGG + Intronic
1036979363 8:13451531-13451553 TGTAGGAGGCTGGTTACCAGAGG - Intronic
1037012671 8:13863174-13863196 ACTAGGATGCTGGTTGCCAGGGG - Intergenic
1037655551 8:20881006-20881028 CCCATTAGGCTAATTTCCAGTGG - Intergenic
1038176248 8:25184428-25184450 CCCCGGAGGCTGGGTCCCGGGGG - Intergenic
1038422810 8:27444230-27444252 GCCAGGAGGTTGGTTTGCGGAGG - Exonic
1038496469 8:28006918-28006940 CCAGGGAGGATGGTTTCCAAAGG - Intergenic
1039472440 8:37821780-37821802 CCCCGGGGGCTGGTATGCAGGGG + Intronic
1039923992 8:41912467-41912489 CCCTGGAGAGTGGTTACCAGGGG - Intergenic
1040028816 8:42805749-42805771 CCCAGGAGACTGGAGTGCAGTGG + Intergenic
1040097558 8:43460909-43460931 CAAAGGAGGATGTTTTCCAGGGG + Intergenic
1040925266 8:52674726-52674748 CCCAGGCGGCTGGAGTGCAGTGG - Intronic
1041097993 8:54368358-54368380 ACCAGGTACCTGGTTTCCAGTGG + Intergenic
1043074991 8:75687296-75687318 CCCAGCAGGCTGGAATGCAGTGG + Intergenic
1043416868 8:80060040-80060062 CCCAGGTGGCTGGAGTGCAGTGG - Intronic
1043927673 8:86056251-86056273 CCCAGGAGGCTAGAGTGCAGTGG - Intronic
1045342416 8:101266604-101266626 CACAGGAGGCTGGTCTGCAGAGG - Intergenic
1045373574 8:101549493-101549515 GCCTGGAGGCTGGTGTCCAGGGG + Intronic
1046456059 8:114463436-114463458 CTCAGGAGGCTGGAGTGCAGTGG + Intergenic
1046669521 8:117042601-117042623 CTCAGCAGGCTGTTTCCCAGAGG - Intronic
1046975119 8:120266380-120266402 CCCAGGATACTGGTCACCAGTGG - Intronic
1048120928 8:131581015-131581037 TCAAGGAAGCTGGTTTGCAGAGG + Intergenic
1048952730 8:139509617-139509639 ACCAGGAGGTTGGTCCCCAGGGG - Intergenic
1049229039 8:141472697-141472719 TCCTGGAGGCGGGTGTCCAGGGG + Intergenic
1049253259 8:141600634-141600656 CCCATGAGGGTGGCTGCCAGTGG + Intergenic
1049277296 8:141726230-141726252 TCCAAGAGGGTGGTTTGCAGAGG - Intergenic
1049567532 8:143348829-143348851 CCCAGGAGCCTGGTGCCCTGAGG + Intronic
1049611089 8:143555653-143555675 CCCAGGGCGCTGGCTTCCAGGGG + Intronic
1050578130 9:7020993-7021015 ACTAGGAGGATGGTTACCAGAGG - Intronic
1051334425 9:16053609-16053631 CTCAGGAGGCAGGTTGACAGCGG - Intronic
1053237380 9:36468200-36468222 CCCAGCAGGCTGGAGTACAGTGG - Intronic
1053725701 9:40998314-40998336 CCCAGCAGGCTGGAGTGCAGTGG + Intergenic
1054340235 9:63853553-63853575 CCCAGCAGGCTGGAGTGCAGTGG - Intergenic
1054778902 9:69148412-69148434 CCCAGGAGGCTGGAGTACAGTGG + Intronic
1054867391 9:70016509-70016531 ACCAGGGGGCTGTTTTCCTGTGG - Intergenic
1054873098 9:70067260-70067282 CAGGGGAGGCTGCTTTCCAGTGG + Intronic
1054976553 9:71153364-71153386 CCCAGGAGGCTAGGTTGCAGTGG - Intronic
1055126045 9:72719107-72719129 ACCAGGAGGCTGGTAACCTGGGG - Intronic
1055922810 9:81479375-81479397 ACCAGGTTGGTGGTTTCCAGAGG + Intergenic
1056661297 9:88545617-88545639 CCCAGGAGGCTGGGTCTCAGTGG - Intronic
1057077797 9:92147990-92148012 CCCAGGAGGCTGCTTCTAAGAGG + Intergenic
1057108901 9:92448307-92448329 CCCAGGAGGCTGGTGTGCGGTGG + Intronic
1057197022 9:93120984-93121006 CCCGGGAGCCAGGTTTCCACTGG + Intergenic
1057230526 9:93318861-93318883 CCAAGCAGTCTGCTTTCCAGTGG - Intronic
1057494878 9:95553138-95553160 GCCAGGAGGGTGGCGTCCAGGGG + Intergenic
1058167793 9:101639819-101639841 CCTGTGAGGCTGGTTTCCTGGGG - Intronic
1059521699 9:114948588-114948610 CCCAGGAGGCTGGAGTGCAGTGG - Intergenic
1060524936 9:124315199-124315221 CCCAGGAAGCGGGTTTCCCTGGG - Intronic
1061010135 9:127949876-127949898 CCCCGGGGGCAGGTTTCCAGTGG - Intronic
1061080654 9:128367887-128367909 CCCGGGAGGCTGGAGTGCAGTGG - Intergenic
1062038489 9:134393263-134393285 ACCAGGAGGCTGGGTCACAGAGG + Intronic
1062151668 9:135022495-135022517 CCCTGGAGACTGGTTGGCAGTGG + Intergenic
1062252091 9:135603358-135603380 CCCAGGGGGAGGGTGTCCAGAGG - Intergenic
1062406300 9:136398271-136398293 CCCAGGAGGCTAGGTACAAGGGG + Intronic
1062577740 9:137216438-137216460 CCCAGGAGGATGGCTGTCAGAGG - Exonic
1202804479 9_KI270720v1_random:38359-38381 CCCAGCAGGCTGGAGTGCAGTGG - Intergenic
1203449113 Un_GL000219v1:93645-93667 CCCAGCAGGCTGGAGTGCAGTGG - Intergenic
1185456304 X:312558-312580 CCCAGGAGACGGGTTTCCTGTGG - Intronic
1186281550 X:7998687-7998709 CCCAGTATGATGGTTTCAAGAGG + Intergenic
1186400858 X:9258177-9258199 AACAGGAGGCTGGTTTCCCATGG - Intergenic
1187542600 X:20212456-20212478 CCCAGGAGGCTGGAGTGCAGTGG - Intronic
1187984334 X:24794014-24794036 CCCAGGCGGCTGGAGTGCAGTGG + Intronic
1188822005 X:34786945-34786967 CCCAGGACACTTGTTTTCAGGGG - Intergenic
1189668276 X:43380853-43380875 GCCAGGAGGCTGGTAGCCTGGGG + Intergenic
1190014673 X:46816662-46816684 CCCAGCAGGCTGGAGTGCAGTGG - Intergenic
1190899986 X:54662366-54662388 CCCAGTAGGCTGGAGTGCAGTGG + Intergenic
1192713865 X:73618685-73618707 GCCAGGAGGCTGGTAGCCTGGGG - Intronic
1193139772 X:78015808-78015830 TCCAGGAGGCAAATTTCCAGTGG + Exonic
1193541306 X:82775665-82775687 GCCAGGAGGCTGGTAGCCTGGGG - Intergenic
1194915215 X:99698605-99698627 CCCAGGAGGCTGGCATCTGGAGG + Intergenic
1197739584 X:129879606-129879628 CCCAGGAGGCTGGAGTGCAAGGG + Intergenic
1198004146 X:132474872-132474894 GCCAAGAAGCTGGTTTCCAGTGG - Intronic
1198075983 X:133193355-133193377 CCCAGAAGGCTGGAGTGCAGTGG - Intergenic
1198102591 X:133435132-133435154 CCCAGCAGGCTGGAGTGCAGTGG + Intergenic
1198457888 X:136835529-136835551 CCCAGGAGGCTGGAGTGCAGTGG - Intergenic
1199291509 X:146110077-146110099 CCCAGGAGGCTGGAGTGCAGTGG + Intergenic
1199744823 X:150765926-150765948 CCAAGCAGGCTGGTAACCAGTGG - Intergenic
1200158703 X:153993087-153993109 ACCTGAAGGGTGGTTTCCAGGGG - Intergenic