ID: 1161773348

View in Genome Browser
Species Human (GRCh38)
Location 19:6243242-6243264
Sequence CACCCCGGGAAGGCTCGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 1, 2: 1, 3: 14, 4: 162}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161773332_1161773348 10 Left 1161773332 19:6243209-6243231 CCGAGCAGGGCCATGCATGTCAG 0: 1
1: 0
2: 1
3: 10
4: 177
Right 1161773348 19:6243242-6243264 CACCCCGGGAAGGCTCGGGGAGG 0: 1
1: 1
2: 1
3: 14
4: 162
1161773325_1161773348 28 Left 1161773325 19:6243191-6243213 CCGAGAGCCAGTCCCAGCCCGAG 0: 1
1: 0
2: 3
3: 33
4: 446
Right 1161773348 19:6243242-6243264 CACCCCGGGAAGGCTCGGGGAGG 0: 1
1: 1
2: 1
3: 14
4: 162
1161773330_1161773348 15 Left 1161773330 19:6243204-6243226 CCAGCCCGAGCAGGGCCATGCAT 0: 1
1: 0
2: 1
3: 12
4: 185
Right 1161773348 19:6243242-6243264 CACCCCGGGAAGGCTCGGGGAGG 0: 1
1: 1
2: 1
3: 14
4: 162
1161773328_1161773348 21 Left 1161773328 19:6243198-6243220 CCAGTCCCAGCCCGAGCAGGGCC 0: 1
1: 0
2: 1
3: 42
4: 312
Right 1161773348 19:6243242-6243264 CACCCCGGGAAGGCTCGGGGAGG 0: 1
1: 1
2: 1
3: 14
4: 162
1161773337_1161773348 0 Left 1161773337 19:6243219-6243241 CCATGCATGTCAGTGGGGGCCCC 0: 1
1: 0
2: 0
3: 20
4: 161
Right 1161773348 19:6243242-6243264 CACCCCGGGAAGGCTCGGGGAGG 0: 1
1: 1
2: 1
3: 14
4: 162
1161773323_1161773348 30 Left 1161773323 19:6243189-6243211 CCCCGAGAGCCAGTCCCAGCCCG 0: 1
1: 0
2: 4
3: 11
4: 160
Right 1161773348 19:6243242-6243264 CACCCCGGGAAGGCTCGGGGAGG 0: 1
1: 1
2: 1
3: 14
4: 162
1161773324_1161773348 29 Left 1161773324 19:6243190-6243212 CCCGAGAGCCAGTCCCAGCCCGA 0: 1
1: 0
2: 0
3: 20
4: 236
Right 1161773348 19:6243242-6243264 CACCCCGGGAAGGCTCGGGGAGG 0: 1
1: 1
2: 1
3: 14
4: 162
1161773329_1161773348 16 Left 1161773329 19:6243203-6243225 CCCAGCCCGAGCAGGGCCATGCA 0: 1
1: 0
2: 0
3: 10
4: 158
Right 1161773348 19:6243242-6243264 CACCCCGGGAAGGCTCGGGGAGG 0: 1
1: 1
2: 1
3: 14
4: 162
1161773331_1161773348 11 Left 1161773331 19:6243208-6243230 CCCGAGCAGGGCCATGCATGTCA 0: 1
1: 0
2: 0
3: 11
4: 214
Right 1161773348 19:6243242-6243264 CACCCCGGGAAGGCTCGGGGAGG 0: 1
1: 1
2: 1
3: 14
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161773348 Original CRISPR CACCCCGGGAAGGCTCGGGG AGG Intronic
900314763 1:2051166-2051188 GCCCCCGGCAGGGCTCGGGGCGG + Intronic
901022250 1:6261273-6261295 CAGCCCAGGGAGGCTCGGGCCGG - Intergenic
901086853 1:6615599-6615621 CACCTCGGGAAGGATGGGGGTGG + Intronic
912428856 1:109618004-109618026 GACCCCGGGAAGGCTGGGTTGGG + Exonic
912793270 1:112674398-112674420 CGTCCCTGGAAGGCTGGGGGAGG + Intronic
915974937 1:160379202-160379224 CTCCACGGGAAGGCTCCTGGGGG - Intergenic
922933876 1:229409496-229409518 CACCCAGGGACGGCTCAGAGAGG - Intergenic
1064347030 10:14541543-14541565 GGCCCCGGGAAGACTCGGGGAGG - Intronic
1065866770 10:29921244-29921266 CACCCTGGGGAGGCTGTGGGTGG + Intergenic
1066221129 10:33336553-33336575 GACCCCTGGGAGGCGCGGGGTGG + Intergenic
1070257952 10:74826795-74826817 CCCCCTGGGAACGCGCGGGGTGG - Intronic
1070777164 10:79116430-79116452 CACCCAGGCAAGGCCTGGGGAGG + Intronic
1070783493 10:79150379-79150401 CACCACGGGGAGGCCCAGGGAGG - Intronic
1073466437 10:103697010-103697032 CACCCGGGGATGGGGCGGGGTGG - Intronic
1073901683 10:108229655-108229677 GAACCCGGGAAGGCTCTGGAAGG - Intergenic
1074761454 10:116670054-116670076 GACCGCGGGAAGGGTGGGGGAGG - Intronic
1075824648 10:125344941-125344963 CCCCAGGGGAAGGCTTGGGGAGG - Intergenic
1077061966 11:621452-621474 CACCCTGGGGAGGGTCAGGGAGG + Exonic
1077407004 11:2387138-2387160 CAGCCAGGGAGGGCTGGGGGTGG + Intronic
1077514235 11:2992128-2992150 CATCTCTGGAAGCCTCGGGGCGG - Intronic
1079773646 11:24496827-24496849 CTCCCCAGGATGGCGCGGGGCGG - Intergenic
1081636940 11:44727487-44727509 GACTCCGGGCAGGCACGGGGTGG - Intronic
1081648243 11:44804937-44804959 CACCTGGGGAGGGCTTGGGGAGG + Intronic
1083861523 11:65422675-65422697 CTCTCCGGGCAGGGTCGGGGAGG + Intergenic
1084050887 11:66599194-66599216 CTCTCCTGGAAGGCACGGGGCGG + Exonic
1084888122 11:72223832-72223854 CTCCCCGGGGCGGCGCGGGGCGG + Intronic
1087104193 11:94394121-94394143 CACCACGGCAAGGCTGGGAGAGG + Intronic
1090199904 11:124846469-124846491 CACCCCGGGGAGGCTGGGCTCGG - Intergenic
1090660681 11:128879849-128879871 CAGCCGGGGAAGGCTCGGCGTGG - Intergenic
1090974691 11:131671280-131671302 CGCCCCAGGGAGGCTAGGGGTGG - Intronic
1091769267 12:3140749-3140771 CCCACAGGGAAGGCTCAGGGAGG + Intronic
1101963736 12:109268044-109268066 CACCCCAGCAAACCTCGGGGTGG - Exonic
1103297838 12:119903387-119903409 CAGCCCGGGAAGGCTGAGGCAGG + Intergenic
1103568184 12:121827550-121827572 CCACCCGGGCAGGCTCGGAGCGG + Exonic
1104744886 12:131204403-131204425 CTCGCCGGGAAGGCTTGGGTGGG + Intergenic
1110442090 13:75537578-75537600 GACCTGGGGAAGGCTCAGGGTGG + Intronic
1118617033 14:67580983-67581005 CACCCCGGAAAGTCTGAGGGTGG + Exonic
1119202904 14:72771625-72771647 CAGCCTGGGTAGGATCGGGGTGG - Intronic
1119474683 14:74920253-74920275 CACCCTGGGAAGGGACAGGGTGG + Intronic
1122750309 14:103928264-103928286 CACCCTGGGCTCGCTCGGGGCGG + Intronic
1122852837 14:104546204-104546226 CACCCTGGGATGGCCTGGGGAGG + Intronic
1122887960 14:104718935-104718957 CACCCCAAGAAGGCTCCAGGAGG - Exonic
1122972826 14:105159259-105159281 CACCCGGGGACGGCCCGAGGAGG + Intronic
1128470022 15:67944096-67944118 CGTCCCGGGAAGGCTGGGGGTGG - Intergenic
1128834618 15:70799202-70799224 CATCCAGAGAAGGCTTGGGGAGG - Intergenic
1129052819 15:72796918-72796940 CACCCCGGGGAGGCGCCGGCGGG - Intergenic
1132537885 16:492380-492402 CTCCCGGGGAGGGCTCTGGGCGG - Intronic
1132680144 16:1136903-1136925 CACTCCGGGAAGGCCCAGGCGGG + Intergenic
1132807803 16:1783087-1783109 CGCCCCGGGAAGGGACGCGGCGG - Intronic
1132875744 16:2136087-2136109 CGCCCCGGGAACGCGTGGGGCGG - Intergenic
1132941343 16:2509962-2509984 GACCCCGGCAAGGGTAGGGGAGG - Intronic
1134519242 16:14911266-14911288 CGCCCCGGGAAAGCGTGGGGCGG + Intronic
1134554682 16:15154960-15154982 CGCCCCGGGAACGCGTGGGGCGG - Intergenic
1134706912 16:16309921-16309943 CGCCCCGGGAAAGCGTGGGGCGG + Intergenic
1134960628 16:18402203-18402225 CGCCCCGGGAAAGCGTGGGGCGG - Intergenic
1135532681 16:23267971-23267993 CACATGGGGAAGCCTCGGGGTGG + Intergenic
1137555244 16:49466226-49466248 CACCCCTGGATGTCTCGGGGAGG + Intergenic
1139489530 16:67279110-67279132 CACCGCGGGACGGGGCGGGGCGG - Exonic
1141498324 16:84425817-84425839 CACCCTGGCAAGGCAAGGGGCGG - Intronic
1141534589 16:84670299-84670321 CACCCAGTGCAGGCTCGGGGTGG - Intergenic
1141602501 16:85135053-85135075 CAGCCCTGAAAGGCTGGGGGTGG - Intergenic
1141638622 16:85328815-85328837 CACCGCGGGAGGCCCCGGGGCGG - Intergenic
1143446420 17:7012771-7012793 CTCCCCGGCAAGGATCGGAGAGG + Intronic
1146581137 17:34039957-34039979 CCCCCTGGGCAGGCCCGGGGCGG + Intronic
1146685972 17:34841872-34841894 CACCCCAGGAAGGGACGAGGAGG - Intergenic
1147264282 17:39225550-39225572 CACCGCGGGCAGGCTGCGGGTGG + Exonic
1148158412 17:45436451-45436473 CCCCCAGGGAAGGGTGGGGGTGG + Exonic
1149614666 17:57988045-57988067 CCCCCCGGGGGGGCACGGGGGGG - Intronic
1149657476 17:58318031-58318053 CACCCCTGGGAGGCCCAGGGAGG - Intronic
1150108628 17:62479189-62479211 CCCCCTGGGCAGGCCCGGGGCGG - Exonic
1150168470 17:62966588-62966610 CACCCCGGAACGGCGCGGCGGGG - Intergenic
1150287613 17:63962830-63962852 TACCCAGGGAATGCTGGGGGAGG - Intronic
1151928081 17:77213384-77213406 CACCCGGGGAAGGCTGCTGGCGG - Exonic
1152633054 17:81419374-81419396 CATTCCGGGAAAGCGCGGGGAGG - Intronic
1153509075 18:5832920-5832942 CACCCTGGGAAAGCACTGGGTGG + Intergenic
1160823972 19:1071026-1071048 AAGCCCGGGAAGTGTCGGGGTGG - Intronic
1161773348 19:6243242-6243264 CACCCCGGGAAGGCTCGGGGAGG + Intronic
1163747901 19:19058970-19058992 CACCCCCAGAATGCTTGGGGTGG - Intronic
1164591729 19:29511201-29511223 CACGCCAGGCAGGCTTGGGGTGG - Intergenic
1164784667 19:30920534-30920556 CTCCCCGGGAAGGTGGGGGGTGG + Intergenic
1165156739 19:33793268-33793290 CACCCCAGGAAGCCTGGGGGTGG + Intergenic
1165392822 19:35548169-35548191 CACCCTGAGAAGGCTCAGGCTGG - Intergenic
1165882536 19:39053864-39053886 CACCCCGGGAGGGTTCTGGGCGG - Intergenic
1166888212 19:45973865-45973887 CACCCCGAGCAGGGTCTGGGGGG - Intergenic
1166978637 19:46620020-46620042 CACCCCGGCAGGGCCCAGGGTGG + Intergenic
1167037828 19:47004401-47004423 CGCCACGGGAGGGCTGGGGGAGG - Exonic
1168652078 19:58097886-58097908 CACCCCGTGTAGGCTCGTGGAGG - Intronic
926871110 2:17418279-17418301 CAGCCTGGGAAGGATGGGGGAGG + Intergenic
927694577 2:25231192-25231214 CACTCCAGGAGGGCTGGGGGAGG - Exonic
927812157 2:26186218-26186240 CACCCCGGGGAGGCACTGGAGGG - Exonic
931348723 2:61470502-61470524 CGCCCCGGGAAGGTGCGCGGTGG - Intronic
934566939 2:95346472-95346494 CTTCCCGGGCAGGCGCGGGGGGG + Intronic
937221279 2:120344484-120344506 CGCCCCGGGAGGGCCGGGGGCGG + Intergenic
937379975 2:121367698-121367720 GGCCCCGGGAAGGCGCGCGGAGG + Exonic
938127833 2:128687133-128687155 CAGCCAGGGGAGGCTTGGGGGGG + Intergenic
947841396 2:233209993-233210015 CACCCAGGGAACGCACTGGGAGG + Intergenic
948575693 2:238948031-238948053 CTCCCTTGGAAGGCTTGGGGAGG - Intergenic
948981299 2:241496257-241496279 CACTCTGGGAAGGCGCGGCGTGG - Intronic
1172118239 20:32583983-32584005 CACCCGGGGCTGGCCCGGGGAGG - Intronic
1172964673 20:38826069-38826091 CACATCGGGTAGGCTGGGGGTGG - Intronic
1173358075 20:42314009-42314031 CAGCCTGGGCAGGCTCTGGGTGG - Intronic
1173662898 20:44746227-44746249 CGCCCCGGGACGGCTGGGGCTGG - Intronic
1174576798 20:51542736-51542758 CAGCCCGGGGAGGCGGGGGGGGG + Intronic
1175699509 20:61126810-61126832 CACCACGGGTAGACTTGGGGAGG - Intergenic
1181045512 22:20212321-20212343 CACCCAGGGAAGCCTGGGGCCGG - Intergenic
1181062919 22:20290585-20290607 TAGCCAGGGAAGGGTCGGGGCGG - Intergenic
1181976216 22:26732179-26732201 AACTCAGGGAAGGCTCAGGGAGG + Intergenic
1182107658 22:27700795-27700817 CACCCCGGTGGGCCTCGGGGTGG + Intergenic
1182413293 22:30204970-30204992 CACCCCGGGCCGGCTCCAGGAGG - Intergenic
1182518084 22:30870240-30870262 CACCCTGGGAAGGCTGGGCCAGG + Intronic
1182648075 22:31826612-31826634 CACCCCGGGAGGGCATGGGAAGG - Intronic
1184678002 22:46053928-46053950 CACCCCGGGTGGGCGCAGGGTGG + Exonic
1184680790 22:46071340-46071362 CACCCCGGGACGGCGCGCGCGGG - Intronic
951946125 3:28138445-28138467 CTCCCCTGGCAGGCTTGGGGAGG + Intergenic
954205716 3:49057495-49057517 CACCCCGGGAAGGGGAGCGGCGG - Exonic
956294518 3:67697193-67697215 CAGCCCTGGAAGGCCCTGGGTGG - Intergenic
956761198 3:72446885-72446907 CGCCCCGGGAAGGGCCGCGGCGG + Exonic
959575415 3:107927971-107927993 AAGCCCGGGTCGGCTCGGGGCGG + Intergenic
964720360 3:159763797-159763819 ACCCGCCGGAAGGCTCGGGGTGG - Intronic
965521215 3:169669383-169669405 CGCCCCGGGGAGGCGCGGGTTGG + Intergenic
968025914 3:195442612-195442634 CCCCTCGGGAGGGCTCGGTGGGG + Intronic
969927336 4:10597250-10597272 CACCCCAGGAAGGCTTGGCCAGG + Intronic
978619387 4:110623179-110623201 CACCCGGAGAAGGGTCTGGGAGG - Intronic
979045171 4:115853355-115853377 CATCCCTGAAAGGGTCGGGGAGG + Intergenic
984708128 4:182862732-182862754 CACCCAGGGAAGGCTGGGGGTGG - Intergenic
985851957 5:2395181-2395203 CACCCCAGGAAGACGCGCGGGGG - Intergenic
986144279 5:5062792-5062814 CACCCTGGGAAGGCTTAGGAGGG - Intergenic
986151292 5:5132835-5132857 CACCCCGAGAAGGCTCATCGGGG - Intergenic
999790723 5:154937645-154937667 AACCCCAGGAAGGCTCCCGGGGG + Intronic
1001481604 5:172092736-172092758 CACCCCGGGATTTATCGGGGAGG + Intronic
1001666148 5:173435169-173435191 CACCTGGGGAAGGCATGGGGAGG + Intergenic
1003114357 6:3273462-3273484 GATCCCGGGAAAGCTCGGGGTGG + Intronic
1006388706 6:33746454-33746476 CACCCCTGGAAGGGGAGGGGTGG + Intronic
1007788720 6:44297136-44297158 CACCCCAGGTAGGATGGGGGAGG - Intronic
1012939875 6:105404335-105404357 CAGCCAGGGAAGGCACGAGGTGG - Intergenic
1014246794 6:119078463-119078485 CACCCCTGGAAGGGACGGGGCGG + Exonic
1015315071 6:131808091-131808113 CTCCCCGGGAGGGCCCGGCGGGG + Exonic
1018026928 6:159814028-159814050 CACCCCGGGAAGGGGCAGGTAGG - Intronic
1018645916 6:165948466-165948488 CCCACCGGGAAGGCTCTGGGAGG + Intronic
1018971716 6:168534472-168534494 CACCCAGGGAAGGGCCAGGGCGG - Intronic
1019288044 7:233532-233554 CTCCCCCGGGAGGCTCAGGGAGG + Intronic
1020106150 7:5423252-5423274 CGCCCCGGGAGGGGTGGGGGTGG - Intronic
1026458830 7:70595911-70595933 CATCCCGGCAAGGCACGGGGCGG - Intronic
1026844683 7:73691964-73691986 CACCCCAGGAAAACTAGGGGTGG - Intronic
1029382898 7:100225081-100225103 CCTCCCAGGAAGGCTCTGGGTGG + Intronic
1032037647 7:128531705-128531727 CCCCCTGGGCAGGCCCGGGGCGG - Intergenic
1033597943 7:142869997-142870019 CAACCTGGGAGGGATCGGGGTGG - Intronic
1033656823 7:143380820-143380842 CACCCCAGGCGGACTCGGGGTGG + Intergenic
1034263324 7:149770405-149770427 AACCCTGGAAAGGCTCAGGGAGG - Intronic
1035689856 8:1553084-1553106 CTCCCCGGGAAGGCTCCTGGCGG + Intronic
1035724697 8:1817305-1817327 CACCCAGGGATGGGTCGGGTCGG - Intergenic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1037883644 8:22585265-22585287 CTCCCTGGGCAGGCTGGGGGTGG + Intronic
1038425624 8:27462192-27462214 GACCCCAGGCAGGCTGGGGGTGG + Intronic
1039893120 8:41697661-41697683 CACCCCGGACAGGCTCAGGCAGG - Intronic
1040471447 8:47738293-47738315 CGCCCCGGGAAGGCTCGGGGCGG - Exonic
1044888806 8:96810034-96810056 GCCCCAGGGAAGGCTGGGGGAGG - Intronic
1045063705 8:98427766-98427788 CTCCCAGGAAAGGCTGGGGGTGG - Intronic
1049591594 8:143465295-143465317 CTCCCCAGGAAGGCAGGGGGTGG - Intronic
1049615866 8:143575633-143575655 CACCCAGGGAAGGCTGTTGGGGG + Exonic
1049645730 8:143734857-143734879 CACCCAGGGGCAGCTCGGGGTGG - Intergenic
1049668120 8:143857484-143857506 CAGCCAGGGAAAGCCCGGGGAGG + Exonic
1050306888 9:4313755-4313777 CTCCCAGGGAAGGCTGCGGGAGG - Intronic
1052699877 9:31924695-31924717 CAGCCAGAGAAGGCTCAGGGAGG - Intergenic
1057336501 9:94159800-94159822 CACCCCGGGAATGCTCCCTGGGG + Intergenic
1058803448 9:108567083-108567105 CATCCCGGGAAGACCAGGGGAGG + Intergenic
1060152832 9:121299743-121299765 CCCCCAGGGAGGGCGCGGGGCGG - Intronic
1060496811 9:124125433-124125455 CCCCCTGGCAAGGCTGGGGGCGG - Intergenic
1061484653 9:130914217-130914239 CCCCTCGGGAGGGCTGGGGGAGG - Intronic
1061945036 9:133903820-133903842 GACCCGGAGAGGGCTCGGGGAGG + Intronic
1062037142 9:134387393-134387415 GACCACGGGGAGCCTCGGGGAGG + Intronic
1062252452 9:135605109-135605131 CACCCCCGAAAGGCACGGGAAGG - Intergenic
1185615730 X:1420643-1420665 CACCTCAGGAAGGTTCTGGGCGG + Intronic
1187067402 X:15854568-15854590 CGGGCCGGGCAGGCTCGGGGTGG + Intronic
1188450448 X:30302984-30303006 ACACCTGGGAAGGCTCGGGGAGG + Intergenic
1195636150 X:107118360-107118382 CACCTGAGAAAGGCTCGGGGCGG - Intronic
1195702641 X:107716551-107716573 CATCCTGGGAAGGGGCGGGGGGG - Intronic
1200077675 X:153559670-153559692 CTGCCCGGGAAGGTTGGGGGTGG - Intronic
1200134356 X:153867706-153867728 CCCCCCAGGAAGGCTCCAGGAGG + Intronic