ID: 1161776697

View in Genome Browser
Species Human (GRCh38)
Location 19:6266906-6266928
Sequence GAGTCCGTTGTGATTAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161776693_1161776697 10 Left 1161776693 19:6266873-6266895 CCCAGGGTAGTGGCTAAAGGGGT 0: 1
1: 0
2: 0
3: 14
4: 162
Right 1161776697 19:6266906-6266928 GAGTCCGTTGTGATTAGAGAAGG No data
1161776694_1161776697 9 Left 1161776694 19:6266874-6266896 CCAGGGTAGTGGCTAAAGGGGTG 0: 1
1: 0
2: 0
3: 11
4: 136
Right 1161776697 19:6266906-6266928 GAGTCCGTTGTGATTAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161776697 Original CRISPR GAGTCCGTTGTGATTAGAGA AGG Intronic
No off target data available for this crispr