ID: 1161780551

View in Genome Browser
Species Human (GRCh38)
Location 19:6289008-6289030
Sequence CCTTCTCAGGAGAAGCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161780545_1161780551 18 Left 1161780545 19:6288967-6288989 CCTTTGCCAACATTGTAGGATTG No data
Right 1161780551 19:6289008-6289030 CCTTCTCAGGAGAAGCTGCAAGG No data
1161780546_1161780551 12 Left 1161780546 19:6288973-6288995 CCAACATTGTAGGATTGATTCAG No data
Right 1161780551 19:6289008-6289030 CCTTCTCAGGAGAAGCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161780551 Original CRISPR CCTTCTCAGGAGAAGCTGCA AGG Intergenic
No off target data available for this crispr