ID: 1161780551 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:6289008-6289030 |
Sequence | CCTTCTCAGGAGAAGCTGCA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1161780545_1161780551 | 18 | Left | 1161780545 | 19:6288967-6288989 | CCTTTGCCAACATTGTAGGATTG | No data | ||
Right | 1161780551 | 19:6289008-6289030 | CCTTCTCAGGAGAAGCTGCAAGG | No data | ||||
1161780546_1161780551 | 12 | Left | 1161780546 | 19:6288973-6288995 | CCAACATTGTAGGATTGATTCAG | No data | ||
Right | 1161780551 | 19:6289008-6289030 | CCTTCTCAGGAGAAGCTGCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1161780551 | Original CRISPR | CCTTCTCAGGAGAAGCTGCA AGG | Intergenic | ||
No off target data available for this crispr |