ID: 1161784406

View in Genome Browser
Species Human (GRCh38)
Location 19:6314571-6314593
Sequence GTCGCGGCTCAGACATATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 28
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 26}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161784406_1161784412 28 Left 1161784406 19:6314571-6314593 CCCTGATATGTCTGAGCCGCGAC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1161784412 19:6314622-6314644 AATATGGGTGGAAATGTAAATGG 0: 1
1: 0
2: 4
3: 42
4: 489
1161784406_1161784411 16 Left 1161784406 19:6314571-6314593 CCCTGATATGTCTGAGCCGCGAC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1161784411 19:6314610-6314632 AAATACTTATATAATATGGGTGG 0: 1
1: 0
2: 2
3: 32
4: 477
1161784406_1161784410 13 Left 1161784406 19:6314571-6314593 CCCTGATATGTCTGAGCCGCGAC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1161784410 19:6314607-6314629 GACAAATACTTATATAATATGGG 0: 1
1: 0
2: 2
3: 34
4: 416
1161784406_1161784409 12 Left 1161784406 19:6314571-6314593 CCCTGATATGTCTGAGCCGCGAC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1161784409 19:6314606-6314628 TGACAAATACTTATATAATATGG 0: 1
1: 0
2: 1
3: 29
4: 406
1161784406_1161784413 29 Left 1161784406 19:6314571-6314593 CCCTGATATGTCTGAGCCGCGAC 0: 1
1: 0
2: 0
3: 1
4: 26
Right 1161784413 19:6314623-6314645 ATATGGGTGGAAATGTAAATGGG 0: 1
1: 2
2: 10
3: 164
4: 989

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161784406 Original CRISPR GTCGCGGCTCAGACATATCA GGG (reversed) Intronic
900884209 1:5403910-5403932 GCAGCAGCTCAGACACATCAGGG + Intergenic
1067967164 10:50925607-50925629 TTCAGGGCTCAAACATATCATGG + Intergenic
1077893622 11:6437549-6437571 GTAGCGGCCCAGCCATCTCAGGG + Exonic
1079115991 11:17640919-17640941 CTCGCGGCTCAGACACACCGGGG - Exonic
1101116205 12:101533887-101533909 GTCGTGGCCCAGACATAGAAGGG - Intergenic
1103730959 12:123027517-123027539 CTCGAGGCTCAGAGATATCAAGG - Intronic
1113183354 13:107657629-107657651 GTCACTGTTCAGCCATATCAAGG - Intronic
1125264838 15:37867050-37867072 GCCAGGGCTCACACATATCAAGG - Intergenic
1125543076 15:40483113-40483135 GTCTCTGCTGAGACATATGAGGG + Intergenic
1137557977 16:49484629-49484651 GTCCCGGCTCAGGCAGGTCAAGG + Intergenic
1156746007 18:40392116-40392138 GTAGAGGATCAGACATCTCAAGG + Intergenic
1161784406 19:6314571-6314593 GTCGCGGCTCAGACATATCAGGG - Intronic
937201753 2:120208617-120208639 GTCAGGGCTCAGACAAATCCTGG - Intergenic
1173330529 20:42072578-42072600 GTTGAGGCTCAGAAACATCAAGG - Intergenic
1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG + Intronic
976526401 4:86096184-86096206 GTCTAGGTTCATACATATCAAGG + Intronic
992358185 5:76007474-76007496 GTTGGGGCTCTGGCATATCATGG + Intergenic
1001267944 5:170288693-170288715 GCCGAGGCTCAGGGATATCAAGG + Intronic
1001415801 5:171544224-171544246 GTCTCAGCTCAGACATCACAGGG + Intergenic
1002698149 5:181103916-181103938 GTGGCGGCACAGACATCTCTCGG + Intergenic
1002709081 5:181183334-181183356 GTGGCGGCACAGACATCTCTCGG - Intergenic
1018719942 6:166564920-166564942 ATGACGGCTCAGACATATAAGGG - Intronic
1021549206 7:21851862-21851884 GTTTCTGCTCAGACATATAAAGG - Intronic
1044576016 8:93769445-93769467 GTCGCGGCTCAGACCTGGCCAGG + Intronic
1056950911 9:91040010-91040032 GTCCCTGCTCAGAAATAGCAGGG + Intergenic
1058472893 9:105299254-105299276 GTAGCTGCACAGACATACCATGG + Exonic
1061300673 9:129703186-129703208 GTGGAGGCTGAGACATAGCAGGG + Intronic
1197817885 X:130517206-130517228 GGGGCGGCTGAGGCATATCATGG + Intergenic