ID: 1161799890

View in Genome Browser
Species Human (GRCh38)
Location 19:6411777-6411799
Sequence GGCCCCAGTGTAGCACTCGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 42}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161799890_1161799893 -9 Left 1161799890 19:6411777-6411799 CCGACGAGTGCTACACTGGGGCC 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1161799893 19:6411791-6411813 ACTGGGGCCAGGTGGAGCACCGG 0: 1
1: 0
2: 4
3: 30
4: 376
1161799890_1161799898 10 Left 1161799890 19:6411777-6411799 CCGACGAGTGCTACACTGGGGCC 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1161799898 19:6411810-6411832 CCGGGCAGACGACTCGGAGCTGG 0: 1
1: 0
2: 0
3: 2
4: 60
1161799890_1161799899 28 Left 1161799890 19:6411777-6411799 CCGACGAGTGCTACACTGGGGCC 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1161799899 19:6411828-6411850 GCTGGCCATCCACCAGCGCTTGG 0: 1
1: 0
2: 0
3: 5
4: 121
1161799890_1161799894 -8 Left 1161799890 19:6411777-6411799 CCGACGAGTGCTACACTGGGGCC 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1161799894 19:6411792-6411814 CTGGGGCCAGGTGGAGCACCGGG 0: 1
1: 0
2: 5
3: 37
4: 400
1161799890_1161799896 4 Left 1161799890 19:6411777-6411799 CCGACGAGTGCTACACTGGGGCC 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1161799896 19:6411804-6411826 GGAGCACCGGGCAGACGACTCGG 0: 1
1: 0
2: 0
3: 5
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161799890 Original CRISPR GGCCCCAGTGTAGCACTCGT CGG (reversed) Intergenic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900751160 1:4398649-4398671 GGCTCCAGTGTCCTACTCGTGGG + Intergenic
901909942 1:12448531-12448553 GGACCCAGTGTAGGACTTTTTGG - Intronic
903327245 1:22576506-22576528 GGCACCTGTGAAGCTCTCGTCGG - Exonic
912996543 1:114537191-114537213 GGCCCCACTGCAGCACTTGAAGG - Intergenic
915030507 1:152876949-152876971 GGCCAAAGGGTAGCACTCTTGGG - Intergenic
920191973 1:204199433-204199455 GGCCCCAGGGTCACACTCCTTGG + Intronic
920358742 1:205396829-205396851 GCCCCCAGTGTATCCCTCTTGGG - Intronic
922971733 1:229747512-229747534 AGCCTCAGTTCAGCACTCGTGGG + Intergenic
1062881903 10:986015-986037 GGGCCCAATGGAGCACTCATAGG + Intergenic
1065920235 10:30386842-30386864 GGCCCCAGTGGGGCACACGTGGG - Intergenic
1067064707 10:43097230-43097252 GGCCCCAGAGGAGCACCTGTGGG + Intronic
1105857767 13:24387432-24387454 GGCCCCAGAGTAGCCCTCCACGG + Intergenic
1118738333 14:68718690-68718712 TGCCCCAGTGTAGGATTCTTTGG - Intronic
1128983451 15:72202480-72202502 GGCCCCACTGCAGCACTTGAAGG + Intronic
1130510014 15:84581724-84581746 GGCCCCAGTGGGGCACACATGGG - Intergenic
1143450282 17:7032243-7032265 CACCCCAGTGTAGCACTCTGTGG - Intergenic
1144843581 17:18203934-18203956 AGCCCCAGTGAAGCCCTAGTGGG - Intronic
1148697587 17:49570451-49570473 GTCCCCAGTGAAGCACTGGCGGG - Intergenic
1148922103 17:51046692-51046714 GGCCCCCGTGTAGGCCTCCTTGG - Intronic
1160424041 18:78768111-78768133 GGACCCAGTGCAGCCCTCCTCGG - Intergenic
1161799890 19:6411777-6411799 GGCCCCAGTGTAGCACTCGTCGG - Intergenic
929175212 2:38968963-38968985 GGCCCCAGTGTAGCACAGGAAGG + Intronic
933297721 2:80509372-80509394 GGCCTCAGTGTACCTCTCTTAGG - Intronic
941921212 2:170852802-170852824 GGCCCCAGTGTAGCTTTGGAGGG - Intronic
948529395 2:238594660-238594682 GGGCCCAGAGTAGCACTTGTGGG - Intergenic
1175387673 20:58607766-58607788 GGCCTGAGTGTAGCACGCATCGG - Intergenic
961412329 3:126731380-126731402 GGCCCCAGTGGAGCACAGGGTGG + Intronic
962826009 3:139101553-139101575 GGCCCCTGGGTAGCACTCCCAGG - Intronic
980893554 4:138839694-138839716 GGCCTAAGTGTAGCACTTTTAGG - Intergenic
985678524 5:1244387-1244409 GGTCCCAGAGGAGCACTCGGCGG - Intronic
992591042 5:78295688-78295710 GGCCCCAGAGTAGCTCTCTCCGG + Intergenic
1000023517 5:157339226-157339248 GGACCCATTGTAGCAGTAGTTGG - Exonic
1003035724 6:2638923-2638945 GACCCCAGTGTGGCCCTCTTGGG + Intergenic
1003422809 6:5973676-5973698 GGCCCCACTGCAGCACTTGAAGG - Intergenic
1013138192 6:107303282-107303304 GTCCCCAGTGTAGCAGTGTTAGG - Intronic
1019612942 7:1946053-1946075 GGCCCCAGTGTACAACCCGCTGG - Intronic
1022449878 7:30504759-30504781 GGCCCCAGTGTTGCGCTCTCTGG - Exonic
1022985708 7:35651309-35651331 GGCCCCAGTGTGGCATACGCTGG - Intronic
1041393221 8:57366359-57366381 GGCCACAGTGTGGCTCTCTTGGG + Intergenic
1047632718 8:126725801-126725823 GGCACCAGTGTAACAGTGGTGGG + Intergenic
1051182915 9:14429746-14429768 GGCCCCATGGTAGCAGTGGTGGG - Intergenic
1061160960 9:128893485-128893507 GGCCCCAGTGAGGCAGTAGTGGG + Intronic
1187486079 X:19705610-19705632 GTCCCCAGTGTGGCACTGGGAGG - Intronic
1198778217 X:140204606-140204628 TTCCCCAGTGTAGCACTGTTAGG + Intergenic
1199331491 X:146565833-146565855 GGCCCCAGGGGAGCACTGGGAGG - Intergenic