ID: 1161801909

View in Genome Browser
Species Human (GRCh38)
Location 19:6421076-6421098
Sequence TTGTCTGAAGGGCTGTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 295}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161801909_1161801919 -7 Left 1161801909 19:6421076-6421098 CCCTCCCACAGCCCTTCAGACAA 0: 1
1: 0
2: 0
3: 33
4: 295
Right 1161801919 19:6421092-6421114 CAGACAAGGGGTACGAGGAACGG 0: 1
1: 0
2: 0
3: 14
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161801909 Original CRISPR TTGTCTGAAGGGCTGTGGGA GGG (reversed) Intronic
900363306 1:2300259-2300281 TGGCCTGAAGGGCTTTGGGATGG + Intronic
900483590 1:2910945-2910967 TTGTCTGGAGGCCTGAGGGGTGG + Intergenic
901888189 1:12239085-12239107 TTGCCTGTAGGACTCTGGGAAGG + Intronic
902225131 1:14991951-14991973 TTCTCTGATGGACTGTGGGGTGG + Intronic
902472450 1:16658266-16658288 TTGTCTCATGGGCTGAGCGAGGG + Intergenic
902486354 1:16749180-16749202 TTGTCTCATGGGCTGAGCGAGGG - Intronic
903758647 1:25682587-25682609 GTGGCTGAAGGTCTGTGGTATGG + Intronic
904260553 1:29285213-29285235 TTGGCTGAAGGTCTGCAGGAGGG - Intronic
904477923 1:30776607-30776629 TGGTCTGCAGGGCTGTGTGTAGG - Intergenic
905406431 1:37735508-37735530 TGGTCTAACGGGCTGTGGGCGGG + Intronic
906076711 1:43057255-43057277 ATGTCTGGAGGGAGGTGGGAGGG + Intergenic
906513864 1:46426718-46426740 ATGTCCGTGGGGCTGTGGGATGG + Intergenic
907353699 1:53854532-53854554 TTGGCTGCAGGGCTGAGGCAAGG - Intronic
907851604 1:58260247-58260269 TTGTGTAAAGGGCTTTGCGAAGG - Intronic
908028094 1:59971897-59971919 TTTTCTGAAGGGCTTTGGTTTGG + Intergenic
909121073 1:71604441-71604463 TTTGCTGCAGGACTGTGGGAGGG - Intronic
913132082 1:115849380-115849402 TCGACTGAAGAGCTCTGGGAAGG - Intergenic
913219918 1:116651039-116651061 CTGTCTGAAGGGTTGTGGGCTGG - Intronic
915167212 1:153954826-153954848 GTGTCTGAAAGGTAGTGGGATGG - Intronic
916354221 1:163885967-163885989 TGGTCTGGATGGCTGTGGGCAGG + Intergenic
917121066 1:171645260-171645282 TTGTTGGGAGGGCTGTGGAAAGG - Intronic
917854198 1:179088108-179088130 TAGTCAGGAGGGCTGGGGGAGGG + Intronic
920543236 1:206794884-206794906 TTGGCAAAAGTGCTGTGGGATGG + Intergenic
921592618 1:217022158-217022180 TTGGCTGAATGGCTTTGGCAGGG - Intronic
922067357 1:222157194-222157216 TTGTGTGAAGGGGGGTGGGTGGG - Intergenic
922566317 1:226604060-226604082 TGGGGTGAAGGGCTGTGGGCTGG - Exonic
923553272 1:234980878-234980900 TTGGCTGAGCGGCTGTGGGTAGG - Intergenic
1063134158 10:3201853-3201875 CTTTCTGAGGGGCTGGGGGAGGG + Intergenic
1064110995 10:12538818-12538840 TTATCTGAAGTGGTGGGGGAGGG + Intronic
1065755246 10:28924906-28924928 TTCTCTGAAGCACTGTGGGCAGG - Intergenic
1065813862 10:29467244-29467266 ATGACTGAAGGGCTCTGGAAAGG + Intronic
1066124646 10:32328739-32328761 ATTTCTGAATGGCGGTGGGATGG + Intronic
1066182637 10:32978433-32978455 TTGGGTGGAGGGCTGGGGGAGGG - Intronic
1067349690 10:45464823-45464845 TTGTGTGAAGAGCTGTGGCAGGG - Intronic
1067968948 10:50947080-50947102 TTGTCTGTTGCGCTGTGGAAGGG + Intergenic
1072158440 10:92744757-92744779 TTGTCTGGATGGCTGTGGTTTGG + Intergenic
1072486830 10:95863852-95863874 CTATCTGAAGGGCTGAGGAATGG + Intronic
1073337507 10:102720857-102720879 TTGTCTGAAGAGCTGGAAGATGG - Intronic
1073403720 10:103278472-103278494 TTGTTTGAAGGGCTGGGGCAGGG - Intronic
1073988208 10:109233264-109233286 TTGACTGAAGGGCTGTGTGCTGG + Intergenic
1074300853 10:112232288-112232310 TTGTGTGAAGGGCTGGAGGTAGG + Intergenic
1077376373 11:2206745-2206767 TTGCCTGATGGGTTGAGGGAGGG - Intergenic
1078430088 11:11281769-11281791 CTGCCTGAAGGGATGTGGGAAGG + Intronic
1080695673 11:34601085-34601107 TTGTCTTCAGGGCTGAGGCATGG - Intergenic
1083203799 11:61135362-61135384 TTGTCTGGAGGGCTCAGGGAGGG - Intronic
1083618295 11:64036816-64036838 TTGTCTTGAGAGCTGGGGGATGG - Intronic
1083999866 11:66290148-66290170 GTGGCTGAAGGTCTGTGAGAGGG - Intergenic
1085128778 11:74019936-74019958 ATGTCTGAAGTGCTGTGGTCTGG + Intronic
1089133639 11:116232108-116232130 CTGCTTGAAGGGCTGGGGGAAGG - Intergenic
1091057493 11:132432507-132432529 CTGGCTGAATGGCTTTGGGAAGG - Intronic
1092172272 12:6381405-6381427 TTGCTTGCAGGTCTGTGGGATGG - Intronic
1092280955 12:7097231-7097253 TTCTCTGAAGTGCTGTGGTAGGG + Intronic
1092300933 12:7249512-7249534 TTGTTTGAAGGGCTACTGGAGGG + Intergenic
1096244629 12:49977328-49977350 GGGTGTGAGGGGCTGTGGGAGGG + Intronic
1096847776 12:54417554-54417576 TTGTCTGGAGGACTTGGGGATGG - Intronic
1099165945 12:79307602-79307624 TGGTCGGAAGGGCTGGGGGTGGG + Intronic
1099176006 12:79422970-79422992 TTGTCTGAAGGGTAGTGGATTGG - Intronic
1099640069 12:85275459-85275481 ATGTCTGCAGAGCTGTGGGAAGG + Intergenic
1099749267 12:86750961-86750983 TTGTTTAAAGTGCTGTGAGAGGG + Intronic
1099868090 12:88309729-88309751 TTGTCTCTAGGACCGTGGGAAGG - Intergenic
1100343201 12:93701342-93701364 TAGTCTCCAGGGCTGTGGGCTGG + Intronic
1101316357 12:103632576-103632598 ATGTCGAGAGGGCTGTGGGAAGG + Intronic
1101330949 12:103757558-103757580 CTGTCTGAAGTGATGGGGGAAGG + Intronic
1101497817 12:105272407-105272429 TAGTCTGATTGGTTGTGGGAAGG + Intronic
1102852815 12:116266255-116266277 TTGTCTCCAGGGCTGAGTGAAGG + Intronic
1103027838 12:117588069-117588091 TTTTATGAGGGGCTGTGGGTGGG - Intronic
1104707987 12:130962215-130962237 TTGTCTGAAGTGCAGTGGTGTGG + Intronic
1106116411 13:26821438-26821460 ATGTCTGAAGGGCTGTATCAAGG + Intergenic
1107075125 13:36315421-36315443 TTCTCTCAAGGTCTGTGGCATGG + Intronic
1107370328 13:39738384-39738406 TTGTTTCAATGGTTGTGGGAAGG - Intronic
1107494538 13:40913107-40913129 TTGACTGAAGAGCTTTAGGAAGG - Intergenic
1109741856 13:66563956-66563978 CTGTCGAAAGGGCTGTGGTAAGG - Intronic
1110284976 13:73739283-73739305 TTGTCTTAAAGGGTGTGGAAAGG + Intronic
1112430809 13:99348708-99348730 TTGTCTGAAGGGATGACGGTAGG + Intronic
1115746383 14:36442099-36442121 TTGCCTCCAGGGCTGGGGGAGGG + Intergenic
1117261009 14:54033409-54033431 GTGGCAGAAGGGCTGGGGGAGGG - Intergenic
1117447278 14:55816271-55816293 ATGTTGGGAGGGCTGTGGGAAGG - Intergenic
1117566956 14:57002938-57002960 TTGGCTGAGGAGCTTTGGGAAGG + Intergenic
1118516440 14:66533532-66533554 TTGACTGAATGGCTGTAGGAGGG + Intronic
1118978672 14:70699002-70699024 TTTTGTGAAGAGCTGTGGGTGGG - Intergenic
1119777186 14:77256642-77256664 TGGTCTGAGGGGCTTTGCGAGGG + Exonic
1119883084 14:78116936-78116958 TTGGCTGAAGGTGGGTGGGAAGG + Intergenic
1121516968 14:94558951-94558973 TTGTCTTAAGGTCTCTGGGAGGG - Intergenic
1122246372 14:100406032-100406054 TGGTTAGCAGGGCTGTGGGAAGG + Intronic
1122619811 14:103049291-103049313 TTGGCTGAAGGAGGGTGGGATGG + Intronic
1122674013 14:103395095-103395117 TTTCCTGAAGGGATGTGTGATGG + Intronic
1202834231 14_GL000009v2_random:65833-65855 CTGGCTGTAGGGCCGTGGGAGGG + Intergenic
1202835504 14_GL000009v2_random:75089-75111 TTGTCAGTAGGGTGGTGGGAGGG + Intergenic
1124216890 15:27815059-27815081 CTTCCTGGAGGGCTGTGGGAAGG + Intronic
1125887244 15:43238135-43238157 GTGGCTGAAGGGCGGTGGGGAGG - Intronic
1126575219 15:50189751-50189773 TTTTCTCAGAGGCTGTGGGAAGG - Intronic
1127884644 15:63189019-63189041 GTGACTGAGGGGCTGCGGGAGGG + Intergenic
1129000209 15:72327029-72327051 TTCACTGAAGGGTTGGGGGAAGG - Intronic
1129386463 15:75198835-75198857 CAGTCTGATGGGTTGTGGGAGGG + Intronic
1130191421 15:81739799-81739821 TTGTGAGAAGGCCTATGGGAAGG - Intergenic
1130753692 15:86740441-86740463 TAGTCTGAAGATCTGAGGGAAGG + Intronic
1131070492 15:89462680-89462702 CAGTCTGATTGGCTGTGGGAGGG - Intergenic
1131080306 15:89529047-89529069 TTTACTGAAAGGCTGTGGCAGGG + Intergenic
1131363749 15:91819372-91819394 TTTTTTGAAGGGCTATGTGATGG + Intergenic
1131366634 15:91847033-91847055 GTGTGTGAACGGCTGGGGGAGGG + Intergenic
1131425825 15:92344710-92344732 TTATCTGCAGGGCTTTGGGCTGG + Intergenic
1132035649 15:98481607-98481629 CTGTCTGAAGGGCTGCGTTAAGG - Intronic
1132243332 15:100276664-100276686 TTTTCTGTGGGGCTGTGGGATGG - Intronic
1132627591 16:899091-899113 TTGTCCCAGGGGCTGTGTGACGG + Intronic
1133353316 16:5117364-5117386 TTGCCACCAGGGCTGTGGGAGGG - Intergenic
1133636386 16:7669978-7670000 TTGTTTCAAGGGCTGTGGTGAGG - Intronic
1138067376 16:53956321-53956343 TTGTTTTTAGGGCTGTGGGGAGG + Intronic
1138113452 16:54342247-54342269 TAGGCAGAGGGGCTGTGGGATGG - Intergenic
1138342127 16:56296892-56296914 TTGTAGGAAGAGTTGTGGGATGG - Intronic
1138448175 16:57077708-57077730 TTCCCTGAGAGGCTGTGGGAGGG - Exonic
1140120564 16:72079856-72079878 TTGACAGAAAGGCTGTGGGCTGG - Intronic
1141592591 16:85078487-85078509 CTGGCTGAGGGGCTGTGGGCTGG - Intronic
1142006380 16:87691308-87691330 GGGAATGAAGGGCTGTGGGACGG + Intronic
1143162749 17:4881952-4881974 TTCTCTGAATGGCTGTTGGGAGG - Intronic
1145104487 17:20103801-20103823 TTCACTGAAAGGCTGTTGGATGG + Intronic
1146667730 17:34716041-34716063 TGGTCTGAAGGGAAGTGGGTGGG - Intergenic
1147450702 17:40502171-40502193 GTGTCTGGAGGGCTTTGAGAAGG + Intergenic
1148756496 17:49975799-49975821 TGGCCTGAGGGGCTGGGGGAGGG + Intergenic
1148781197 17:50123129-50123151 TTCTTTGTAGGGCTGTGGGGAGG - Intronic
1149990229 17:61379071-61379093 TGGACTGAGGGGCTGGGGGAGGG + Intronic
1150615682 17:66769069-66769091 TAGACTGACGGGCTGTGGAAGGG + Intronic
1154303559 18:13215280-13215302 GTGTCTGGAAGGGTGTGGGAGGG + Intergenic
1154434513 18:14333664-14333686 TTGTCAGTAGGGTGGTGGGAGGG + Intergenic
1156962177 18:43045670-43045692 TTATCAGAAGGGCATTGGGAGGG + Intronic
1157692034 18:49691592-49691614 TTGGCTGGAGGGGTGTGGGATGG + Intergenic
1160578217 18:79869086-79869108 GTGTCTGCAGGGCTGTGTGTAGG - Intronic
1160772468 19:839155-839177 TGGTCCCAAGGGCTGAGGGAGGG + Intergenic
1161241853 19:3227311-3227333 TTGGCTGAAGGGAGGTGGAATGG + Intronic
1161801909 19:6421076-6421098 TTGTCTGAAGGGCTGTGGGAGGG - Intronic
1162500834 19:11052734-11052756 CTGTCTGCAGGGCTGGGGGAGGG - Intronic
1163725873 19:18922765-18922787 TCCTTTGAAGGGCGGTGGGAGGG - Intronic
1165495371 19:36149678-36149700 TGGTATGAAGGGCTGAGGGGTGG - Intronic
1166258785 19:41623942-41623964 GGGGCTGCAGGGCTGTGGGAAGG - Intronic
1167635154 19:50649934-50649956 GGGCCTGATGGGCTGTGGGAGGG - Intronic
1168353014 19:55687270-55687292 TTGTGTGGAGGGCTGTGGCTGGG + Intronic
1168544857 19:57241691-57241713 ATGTCTGAAGGGCTGAGCCAGGG - Intronic
1168709689 19:58491887-58491909 TTTTCGGAAGGGCGGTTGGAAGG - Intronic
1202637127 1_KI270706v1_random:52260-52282 TTGTCAGTAGGGTGGTGGGAAGG - Intergenic
1202638448 1_KI270706v1_random:61859-61881 CTGGCTGTAGGGCGGTGGGAGGG - Intergenic
1202704845 1_KI270713v1_random:15088-15110 TTGTCTCATGGGCTGAGCGAGGG + Intergenic
925172392 2:1758265-1758287 TTGTCTGCAGGGCTGTCGTATGG + Intergenic
925724744 2:6861997-6862019 TTGTGAGATGGGCTCTGGGAAGG - Intronic
927459729 2:23287548-23287570 TTGGCTGGAGGGCTGTGGAGGGG + Intergenic
928914694 2:36458331-36458353 TTGCTGAAAGGGCTGTGGGAGGG + Intronic
929090789 2:38215323-38215345 TTGGGTGGGGGGCTGTGGGATGG - Intergenic
929994796 2:46818514-46818536 CTCCCTGTAGGGCTGTGGGAGGG + Intronic
930884086 2:56304538-56304560 TTGTGAGAAGAACTGTGGGACGG + Intronic
931254191 2:60555619-60555641 TTGCCGGCAGGGCTGCGGGATGG - Intergenic
931322596 2:61185719-61185741 TTGATTGAAGGGATGTGGGATGG + Intronic
931354649 2:61525199-61525221 TTGTTTCATGGGCGGTGGGAGGG - Intronic
932338551 2:70944588-70944610 AGGTCTGAAGGGCTGGAGGATGG - Intronic
932623897 2:73283774-73283796 GTTTCTGAGGGGCTGGGGGAGGG - Intronic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933059150 2:77713857-77713879 GTCTCTGAAGGGCTGTGTCATGG + Intergenic
933688203 2:85159684-85159706 TTGACCCAAGGCCTGTGGGAAGG + Intronic
936889651 2:117354479-117354501 TTGTCAGAAGGGCTTGGGGGAGG - Intergenic
937487579 2:122331820-122331842 TTGCCCGAAGGGGTGAGGGATGG + Intergenic
937922986 2:127145567-127145589 ATGTCTGAGGGGCTGAGAGATGG + Intergenic
938249460 2:129802800-129802822 TTGCCTGGAGGCCTGGGGGAGGG + Intergenic
938761103 2:134426738-134426760 TTGTGTGAAGGGCTGTGTCTGGG + Intronic
939951713 2:148483292-148483314 TTGTTTGAAGTGCTGTTGGATGG - Exonic
942385956 2:175443116-175443138 TTCTGAAAAGGGCTGTGGGAGGG - Intergenic
942855572 2:180542719-180542741 TTATCTGAAGGCCAGTGGGCTGG - Intergenic
945198952 2:207262650-207262672 TTGTAGAAAGGGCTCTGGGAAGG + Intergenic
946378279 2:219327459-219327481 TCCTCTGAAGGGCAATGGGAAGG + Exonic
946775358 2:223134078-223134100 TTGTCTGAAGTGCTTTTTGAAGG - Intronic
946967724 2:225055638-225055660 AGGTCAGAAGGGCAGTGGGATGG - Intergenic
947023423 2:225709766-225709788 TTGTTTGAAGGGATGAGGGAAGG - Intergenic
947658981 2:231852629-231852651 TTGTCTGAAAGTCTGTGGTGTGG + Intergenic
947874223 2:233457849-233457871 TTGTGTTAAGAACTGTGGGAAGG + Intronic
947948944 2:234131059-234131081 GTGTGTGGAGGGCAGTGGGAGGG + Intergenic
948658899 2:239494637-239494659 TTGTATGAAGGGTGGTGGGTGGG - Intergenic
948704324 2:239779675-239779697 GTGTCTGAGGGGTTGTGTGAGGG - Intronic
948768063 2:240233552-240233574 TTGTGGGCAGGGCTGTGGGGAGG - Intergenic
1170389770 20:15859420-15859442 CTGTAAGAAGAGCTGTGGGATGG + Intronic
1170530052 20:17281986-17282008 TTGTGTGAATGGCACTGGGAAGG - Intronic
1171095472 20:22328652-22328674 CTGTATGAAGGGCTATGGCAAGG - Intergenic
1171883284 20:30633283-30633305 TTGTCAGTAGGGTGGTGGGAGGG - Intergenic
1171885029 20:30645921-30645943 CTGTCTGTAGGGTGGTGGGAGGG - Intergenic
1173182226 20:40814107-40814129 CAGGCTGAAGGGCTGGGGGAAGG - Intergenic
1174520977 20:51130424-51130446 TTGTCTGTGGGGCTCTGGGCAGG + Intergenic
1178343104 21:31802555-31802577 TTGTCTGAAATGCTGTCGGGAGG - Intergenic
1178418806 21:32426773-32426795 TTGTCTGAAGGGGTGATGGAGGG - Intronic
1180363518 22:11920029-11920051 CTGGCTGTAGGGCGGTGGGAGGG + Intergenic
1180821212 22:18829070-18829092 CTGTCTGAAGGGTTGTGGGCTGG - Intergenic
1181191766 22:21146975-21146997 CTGTCTGAAGGGTTGTGGGCTGG + Intergenic
1181207430 22:21263535-21263557 CTGTCTGAAGGGTGGTGGGCTGG - Intergenic
1181907394 22:26210165-26210187 TGGCCTGAAGGGCAGGGGGAGGG - Intronic
1182306874 22:29375898-29375920 ATGTCTGAAGGGCCGTGGTGAGG - Intronic
1182396825 22:30042105-30042127 TTCACTGAAGGCCTGAGGGATGG + Intergenic
1182557954 22:31139235-31139257 TTGTGTGCAGGGTTGGGGGAGGG - Intronic
1183406887 22:37634595-37634617 CTGTCTGGAGGGCTGTGCCAGGG - Intergenic
1184686545 22:46098934-46098956 CTGTCTCAAGGGCCCTGGGAGGG + Intronic
1184692503 22:46123658-46123680 GTGTGGGAACGGCTGTGGGAGGG + Intergenic
1184769671 22:46589865-46589887 CTCTCTGAGGGGCTGAGGGAGGG - Intronic
1185052935 22:48563197-48563219 TTGTCTGCAGGGCTCTTGGAGGG - Intronic
1203219488 22_KI270731v1_random:31881-31903 CTGTCTGAAGGGTTGTGGGCTGG + Intergenic
1203271337 22_KI270734v1_random:54946-54968 CTGTCTGAAGGGTTGTGGGCTGG - Intergenic
949845876 3:8370227-8370249 TTTTCTGAAGGTCTCTGGGTTGG - Intergenic
950417034 3:12874686-12874708 TTTTGTGAAGGGGTGTGGGGCGG + Intergenic
951364044 3:21758762-21758784 CTTTCTGAAGGGCTTTGTGAAGG - Intronic
953718144 3:45333355-45333377 ATGTAGGAAGGGCTCTGGGAAGG + Intergenic
954692914 3:52405234-52405256 TTGTTGGGAGGGCTGTGGGATGG + Exonic
955801639 3:62693053-62693075 TTGTAAGCAGGGCTCTGGGATGG - Intronic
955952174 3:64253379-64253401 GTGTCTGAACAGCTGTGTGATGG - Intronic
958143471 3:89593106-89593128 TATTCTGAAAGGCTGAGGGAAGG + Intergenic
960163919 3:114380495-114380517 TTTTCTGAAGGGGGATGGGAGGG + Intronic
960550789 3:118973945-118973967 TTGTCAGAGGGGCCGGGGGAAGG + Intronic
960649619 3:119932384-119932406 TTGCTTGAGAGGCTGTGGGAAGG + Intronic
961456789 3:127028452-127028474 TGGTCTGGAGGGCAGTGGAATGG + Intronic
965457005 3:168913727-168913749 TTGTCTAAAGGGTCCTGGGATGG - Intergenic
966916828 3:184588985-184589007 GTGACTGATGGGATGTGGGAGGG + Intronic
967824833 3:193869759-193869781 GTGTCTGCAGGGCTGGGGGCGGG - Intergenic
968274373 3:197428795-197428817 TTGTCTGGAGGGCAGGGGAATGG + Intergenic
968897621 4:3413944-3413966 TTGACTGAATGGGTGTTGGAGGG + Intronic
969188459 4:5497573-5497595 TTGCATGAAGGGTTGGGGGAAGG + Intronic
969241297 4:5899982-5900004 TGGTCGGAAGGGCTCTGGGCTGG - Intronic
969696527 4:8738175-8738197 TTGCCTGCAGGCCTGTGGCAAGG - Intergenic
970538686 4:17055853-17055875 TTGTCAGAGGGCCTGTGGGAGGG - Intergenic
971044571 4:22791125-22791147 TTGCCTGAAGGGCTGAGCAATGG - Intergenic
972691075 4:41398864-41398886 TTGTATTTAGGGATGTGGGAGGG - Intronic
973283180 4:48382887-48382909 TTGTCTGTAAATCTGTGGGATGG - Exonic
973393678 4:49576805-49576827 TTGTCAGTAGGGTGGTGGGAGGG + Intergenic
974254061 4:59426828-59426850 GAGACTGAGGGGCTGTGGGAAGG - Intergenic
975118820 4:70706256-70706278 TTGCCTGAAGCGATGAGGGAAGG + Intronic
977861348 4:101964364-101964386 GTTTCTGTGGGGCTGTGGGATGG - Intronic
978396390 4:108285084-108285106 CAGTCTGATTGGCTGTGGGAAGG + Intergenic
980411801 4:132429784-132429806 TTCTCTGCAGTGCTCTGGGATGG + Intergenic
984761822 4:183368952-183368974 TTGTCTGAAAGGCTTGGGGGTGG - Intergenic
984887507 4:184463663-184463685 TTTTTTGATGGGCTGTGGTACGG + Intronic
985419171 4:189765999-189766021 TTGCCTCAAGAGCTGTGAGACGG + Intergenic
1202764443 4_GL000008v2_random:138117-138139 TTGTCAGTAGGGTGGTGGGAGGG - Intergenic
1202765785 4_GL000008v2_random:147717-147739 CTGGCTGTAGGGCCGTGGGAGGG - Intergenic
985767837 5:1789590-1789612 CTGTCTGACTGGTTGTGGGAGGG - Intergenic
986604889 5:9512436-9512458 TTGTCTAAAGTGATGTGGGTAGG + Intronic
987826546 5:23036916-23036938 TTTTCAGAAGGGTTGTGGGAGGG + Intergenic
988306272 5:29498554-29498576 TGCTGTGAAGGGCTGTGTGAAGG - Intergenic
988616607 5:32781115-32781137 TTTTCTGAGGGGGAGTGGGAGGG + Intronic
989149247 5:38282483-38282505 CTGTGGGGAGGGCTGTGGGAAGG + Intronic
990879317 5:60521726-60521748 TAGTGTGAAGGGGTGAGGGAGGG - Intronic
991359902 5:65808531-65808553 GTGTTTGAAGGACTGTGTGAAGG + Intronic
996812919 5:127540099-127540121 TTGGCTGAAGGTTTGTTGGATGG + Intronic
996875511 5:128236252-128236274 TTTTCTGAAGGGCTTACGGAGGG + Intergenic
997844662 5:137275827-137275849 TTGCCTGAACGGCAGAGGGAAGG - Intronic
998460653 5:142307676-142307698 CTGTCTGGAGAGCTGTAGGAGGG + Intergenic
998947641 5:147357762-147357784 TTGACTGAACGGATGTGGCAAGG + Intronic
999575604 5:152973178-152973200 TTTTCAGATGGGCTGTGGGAGGG - Intergenic
1000662876 5:163957675-163957697 TTGTCTGAAGTTCTGTGTGCTGG + Intergenic
1001013062 5:168115902-168115924 ATGTCTGTAGAGGTGTGGGAAGG + Intronic
1002857155 6:1048129-1048151 GTGTTTGAAGGACGGTGGGAGGG - Intergenic
1002922244 6:1580975-1580997 TTGTCAGAATGGCTGAAGGAGGG + Intergenic
1003093321 6:3122423-3122445 CTGTCTGATAAGCTGTGGGAAGG + Intronic
1003154867 6:3583911-3583933 TGGGATGAAGGGCAGTGGGAGGG - Intergenic
1006388162 6:33743618-33743640 ATGACTCAAGGGCTGTAGGATGG + Intronic
1006862275 6:37180276-37180298 TTGGCTGAGGGGATCTGGGAAGG + Intergenic
1007225620 6:40311740-40311762 TTGTGGCAAGGGCTGTGGGAGGG - Intergenic
1007259911 6:40556209-40556231 GTGTAGGAGGGGCTGTGGGAGGG - Intronic
1007292746 6:40799592-40799614 TTCTCTGAAGGGAAGAGGGAGGG - Intergenic
1008058095 6:46966311-46966333 GGGTGTGAAGGGCTGGGGGATGG - Intergenic
1011002479 6:82606620-82606642 TTGTTTGAGGGGAAGTGGGATGG + Intergenic
1012905145 6:105055771-105055793 CTGTCTGAAGGGTGGAGGGAAGG - Intronic
1013298621 6:108781958-108781980 CTCTGTGAAGGGCTGGGGGAGGG + Intergenic
1015161640 6:130158929-130158951 ATGTCTGATTGGTTGTGGGAAGG + Intronic
1015525221 6:134169310-134169332 TTGTGTGATGGGATGAGGGAAGG + Exonic
1015734032 6:136378209-136378231 CTGTCTGATGGGCATTGGGATGG + Intronic
1017282006 6:152636197-152636219 TTTTAGGAAGGGCTGGGGGAGGG - Intronic
1017545859 6:155450230-155450252 TTGTCTCCAGGGATGTGTGAGGG + Intronic
1017967448 6:159278551-159278573 TTGTCTGATGAGCTGTGGCAGGG - Intergenic
1020078631 7:5274821-5274843 TTGTCAAAAGGGCTGGGTGAAGG - Intronic
1021139847 7:17010822-17010844 TTGCCTTAAGGGCTGTGGAATGG + Intergenic
1021939493 7:25665645-25665667 GAGTCTGAAGTGCTGTGAGATGG + Intergenic
1022601865 7:31768405-31768427 TTGGATCAAGGTCTGTGGGACGG + Intronic
1023444966 7:40221984-40222006 ATGTCTGGAGGGCTGTGGTTTGG + Intronic
1023670392 7:42570308-42570330 TTGTCTTAAGGGCAGTGAGGGGG + Intergenic
1023852454 7:44158002-44158024 TATTCTGAAGGGAGGTGGGAGGG + Intronic
1024838023 7:53547435-53547457 ATGTCTGCAGGGTTGTGGGGGGG + Intergenic
1024899677 7:54304570-54304592 TTGTTTCAAGGGATTTGGGAGGG + Intergenic
1025147334 7:56516151-56516173 TTGTAAGAAGAACTGTGGGATGG + Intergenic
1025247849 7:57330934-57330956 TTGGCCGAAGGGCTGGGGCATGG - Intergenic
1025639672 7:63354470-63354492 ATGTCTGAAGGGGTGTGGCCAGG - Intergenic
1025643027 7:63393622-63393644 ATGTCTGAAGGGGTGTGGCCAGG + Intergenic
1026319040 7:69252959-69252981 TTGTAAGAAGAACTGTGGGATGG - Intergenic
1026546284 7:71325591-71325613 TTGTATGAAGGAAGGTGGGAAGG + Intronic
1027990584 7:85355273-85355295 TTGGCTGAAGGACTCTCGGATGG - Intergenic
1029269826 7:99370479-99370501 ACGACTGAAGGCCTGTGGGACGG + Intronic
1029291449 7:99504984-99505006 CTGTTTGAATGGCTTTGGGATGG + Exonic
1029487939 7:100854489-100854511 TTGGCTGAAGGGTTTGGGGAGGG + Intronic
1030020517 7:105270805-105270827 ATATCTGAAAGGCTGTGGCAAGG + Intronic
1034113762 7:148563821-148563843 TTGCCTGAAGGGGAGAGGGAGGG + Intergenic
1035883211 8:3265791-3265813 TAGTCTGAAGGACTGTGTGGAGG - Intronic
1036662634 8:10717756-10717778 CTGTCTGAGTGGCTGTGGGGTGG - Intergenic
1036732783 8:11280985-11281007 CAGTCTGAATGGTTGTGGGAGGG + Intergenic
1037484726 8:19336499-19336521 TTGGTTGGAGGGGTGTGGGAAGG - Intronic
1037585771 8:20275034-20275056 GTCTCTGAAGGGCAGTGGGTGGG + Intronic
1038403857 8:27307413-27307435 TTGTTTGGTGGGGTGTGGGAAGG - Intronic
1039059736 8:33564179-33564201 GTTTCTGAAGGGGTGAGGGAAGG + Intronic
1040898518 8:52392889-52392911 TGGTCTGATTGGTTGTGGGAGGG + Intronic
1041200157 8:55446006-55446028 CTGTCTGAAGGGCTGATTGATGG + Intronic
1043540066 8:81251837-81251859 GTGGCTGTTGGGCTGTGGGAAGG + Intergenic
1046132649 8:109985979-109986001 TCATCTGGAGGGTTGTGGGAAGG - Intergenic
1046744764 8:117864851-117864873 GTGGCACAAGGGCTGTGGGATGG + Intronic
1047676627 8:127209546-127209568 GTGGTTGAGGGGCTGTGGGAGGG + Intergenic
1048610341 8:136015330-136015352 TTCTCAGAAGGGCTGAGAGAGGG + Intergenic
1048679458 8:136823713-136823735 ATGTCTGATGGTCTGTAGGAGGG + Intergenic
1049320521 8:141993815-141993837 TTGGGGGAAGGGCTGGGGGAGGG - Intergenic
1049582629 8:143419835-143419857 TTCTGGGAAGGGCTGTGGAAGGG + Intronic
1050285634 9:4099023-4099045 TTGTCTTGAGGGCAGTGGGAAGG - Intronic
1050318072 9:4423448-4423470 TTTTCTAAAGGTCTGGGGGAGGG - Intergenic
1050631220 9:7560793-7560815 CTGTTCCAAGGGCTGTGGGAAGG + Intergenic
1052380069 9:27760498-27760520 TGGTCTTAAGGGCTTTGGAATGG + Intergenic
1053133693 9:35635866-35635888 TTGTCAGAGGGGGTGTGGAATGG + Intronic
1055357731 9:75454648-75454670 GAGTGGGAAGGGCTGTGGGAGGG + Intergenic
1056774580 9:89501600-89501622 TCCTCTGAGGGACTGTGGGAAGG + Intergenic
1057334951 9:94148308-94148330 ATCTCTGAAGGGTTGTGAGAGGG + Intergenic
1057676153 9:97137615-97137637 TTGGCTGTAGGGTGGTGGGAGGG - Intergenic
1058367273 9:104223678-104223700 TTGTTTGAAGGCATGTGGTATGG + Intergenic
1058560333 9:106221761-106221783 TTGGCAGAAGGGGAGTGGGAGGG - Intergenic
1060215816 9:121737718-121737740 CTGTTTGAAGTCCTGTGGGAGGG + Intronic
1061963064 9:133998135-133998157 ATGGCTGGAGGGATGTGGGATGG - Intergenic
1062610947 9:137373195-137373217 TGGTCTGCAGGGCTGGGGCACGG + Intronic
1187092414 X:16110690-16110712 TTGTCTGAAGAACTCTAGGAAGG + Intergenic
1189716202 X:43869184-43869206 TAGTTTGATGGGGTGTGGGAAGG + Intronic
1189846875 X:45146475-45146497 TTGCCTGCAGGGCTGTGGTTTGG + Intergenic
1190597893 X:52065260-52065282 TTCACTGAAGGGGTGTGGGCAGG + Intronic
1190610931 X:52188813-52188835 TTCACTGAAGGGGTGTGGGCAGG - Intronic
1191044608 X:56122130-56122152 TTGTGGTATGGGCTGTGGGAGGG + Intergenic
1192436458 X:71146269-71146291 CTGGCTGAAGGGGTGGGGGAGGG - Intronic
1196198804 X:112862585-112862607 TGGTCTGAAGGTCAGTGGGAGGG + Intergenic
1199558992 X:149142682-149142704 TTGTCTGAAAGGCTGGAGGGTGG - Intergenic