ID: 1161801969

View in Genome Browser
Species Human (GRCh38)
Location 19:6421366-6421388
Sequence CACTTGGCACTGCCTGCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 323}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161801961_1161801969 11 Left 1161801961 19:6421332-6421354 CCCAAAGCAAAGACTGGCTTAGC 0: 1
1: 0
2: 0
3: 9
4: 152
Right 1161801969 19:6421366-6421388 CACTTGGCACTGCCTGCCCCGGG 0: 1
1: 0
2: 0
3: 38
4: 323
1161801962_1161801969 10 Left 1161801962 19:6421333-6421355 CCAAAGCAAAGACTGGCTTAGCT 0: 1
1: 0
2: 0
3: 8
4: 114
Right 1161801969 19:6421366-6421388 CACTTGGCACTGCCTGCCCCGGG 0: 1
1: 0
2: 0
3: 38
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161801969 Original CRISPR CACTTGGCACTGCCTGCCCC GGG Intronic
900105168 1:978058-978080 CCCCAGGAACTGCCTGCCCCGGG + Intronic
900129050 1:1079976-1079998 CACCTGGCACTGCCAGGCCTGGG + Intergenic
900271664 1:1793210-1793232 CTCAAGGCACTGCCTGCCCCGGG + Intronic
900870086 1:5296115-5296137 CTCCTGGCAATGTCTGCCCCAGG + Intergenic
901084671 1:6603114-6603136 CACTTGTCACTCGCTGTCCCCGG - Intronic
901425345 1:9179115-9179137 CAGGTGCCACTGCCTGCCCCAGG + Intergenic
901497189 1:9628974-9628996 CCCCTCGCCCTGCCTGCCCCAGG - Intergenic
904283038 1:29434654-29434676 CAATTGACACTGTCTGCCCTGGG - Intergenic
905255053 1:36675309-36675331 CTCTGGGCAGAGCCTGCCCCAGG - Intergenic
905972888 1:42154614-42154636 GTCATGGCAGTGCCTGCCCCTGG + Intronic
906200641 1:43958030-43958052 CCCTTGGTACTGCATGCCCTAGG + Exonic
911727561 1:101258065-101258087 CATTTGGTACTGCTTGCCCTGGG + Intergenic
912489904 1:110056881-110056903 CACTTGGCACAGTCAGCCTCAGG + Intronic
913470186 1:119179166-119179188 CAGCTGGCCCCGCCTGCCCCGGG + Intergenic
915587855 1:156853994-156854016 GACGTGGCACTGCCTGCACTTGG - Exonic
915916666 1:159944689-159944711 CACTTGGCAGTGCCAGGCCCTGG - Intronic
917725181 1:177821174-177821196 CACTTGGCTCTGCCTGCTGTGGG - Intergenic
918942987 1:191026256-191026278 CAGCTGGCACTGCCGGCCTCAGG - Intergenic
919504084 1:198375697-198375719 CACTGTGCTCTGCCTGCACCAGG + Intergenic
922541924 1:226426554-226426576 CAGCTGGCCCTGCCAGCCCCGGG - Intergenic
922695871 1:227730783-227730805 CACTGGGCCCTGGCTGCCCTGGG + Intronic
922721677 1:227903079-227903101 CACTAGGCACTGCAAACCCCAGG + Intergenic
923853078 1:237818196-237818218 CATTTGCCACCCCCTGCCCCAGG + Intronic
924567335 1:245209839-245209861 CCCTGGGCACTGCCCGACCCAGG + Intronic
924953640 1:248907395-248907417 CACTGTGTCCTGCCTGCCCCTGG - Intronic
1062845296 10:698742-698764 CACTTAGCTATGGCTGCCCCAGG - Intergenic
1062971843 10:1654371-1654393 CCCATGGCACTGGCTACCCCAGG + Intronic
1063075244 10:2710236-2710258 CAGTTGCCACTGCCTTCCACAGG + Intergenic
1063222258 10:3979989-3980011 CACCTCCCACTGCCTGCCTCTGG + Intergenic
1064245189 10:13662414-13662436 CACTTATCACTGCCTGCCTGAGG + Intronic
1067781037 10:49207712-49207734 CACTACTCAATGCCTGCCCCTGG + Intergenic
1068630318 10:59291095-59291117 CACTTAGCTCTACTTGCCCCAGG + Intronic
1069416218 10:68203146-68203168 CCCCTGCCACTGCCTTCCCCAGG - Intronic
1069868875 10:71521225-71521247 CATGGGGCACTGCCAGCCCCAGG + Intronic
1070776502 10:79112936-79112958 CACTTGGCAGGGCCTCCTCCTGG + Intronic
1070883715 10:79871759-79871781 CAGTTGCCACTGCCTTCGCCAGG + Intergenic
1071650273 10:87388069-87388091 CAGTTGCCACTGCCTTCGCCAGG + Intergenic
1072541785 10:96403755-96403777 CACTGTCCCCTGCCTGCCCCTGG + Intronic
1073109436 10:101052344-101052366 CACTGGGCACTGCCTGTGACGGG - Intergenic
1074045813 10:109838158-109838180 CACTTGCCACTGCCTCTACCGGG - Intergenic
1075333356 10:121591331-121591353 CACCTGGCACAGCCAGCCCACGG + Intronic
1075528090 10:123202795-123202817 CACTGGGCTATGCCTGCCCTGGG - Intergenic
1076724936 10:132408869-132408891 CTCTTGGCACTGCCGGCCACAGG - Intronic
1076833785 10:133009834-133009856 CACCACGCACCGCCTGCCCCAGG - Intergenic
1076917332 10:133430830-133430852 CAGCTGGCTCTGCCTGCACCTGG - Intergenic
1076937429 10:133575589-133575611 CAGCTGGCTCTGCCTGCACCTGG - Intergenic
1077356575 11:2121587-2121609 CACTTGGCTATGCCTGCTCCTGG - Intergenic
1077438148 11:2554574-2554596 CACTGGGCACTGCCTCCCCAGGG + Intronic
1077544614 11:3164062-3164084 CTCTTGGGTCTGCCTGCACCAGG - Intronic
1078462077 11:11521840-11521862 CATTTGGCTCTGGCTGCCCTGGG - Intronic
1078938338 11:15972810-15972832 CAGTTGGCACTGACAGCCTCCGG + Exonic
1081127583 11:39340603-39340625 CCCTTGGCAATGACTACCCCTGG - Intergenic
1081763389 11:45592594-45592616 CTCTTTGCCCTGGCTGCCCCAGG + Intergenic
1081793043 11:45802588-45802610 CACGCAGCACTGACTGCCCCTGG + Intergenic
1083292991 11:61700071-61700093 GACTTGGCAGTGCCTGGGCCTGG + Intronic
1083402641 11:62434551-62434573 CACGTGGGCCTGCATGCCCCAGG + Intronic
1084326377 11:68402723-68402745 CAATTAGCAATGCCTGCCCCAGG - Intronic
1087407328 11:97745880-97745902 CAGCTGGCCCTGCCGGCCCCGGG - Intergenic
1088420133 11:109636183-109636205 CACTTGGGCCTGCCTGACACTGG + Intergenic
1089299343 11:117489233-117489255 CAGTCCCCACTGCCTGCCCCAGG - Intronic
1090203273 11:124870739-124870761 TACTTGGGACTGCCTGCAGCAGG + Intronic
1090361136 11:126173498-126173520 CCCTCGGCACCGCCTGCCCGTGG - Intergenic
1090550070 11:127809494-127809516 CTCTTGTCTCTGCCTTCCCCAGG - Intergenic
1092143688 12:6200650-6200672 CAGCTGGCACTGCCCGCACCGGG + Intronic
1092218968 12:6700310-6700332 CTCTCGGCACTCCCTGCCTCGGG - Exonic
1092936800 12:13371779-13371801 CACAAGGCTCTGCCTGCACCAGG - Exonic
1095673877 12:44893172-44893194 CACTTGCCTCTTCCTGCCTCTGG + Intronic
1095944581 12:47746673-47746695 CTCCTGGCACGGCCTGGCCCAGG + Intronic
1096531146 12:52243638-52243660 CACTTGGCGTTGCCTCCCCCTGG + Intronic
1096995565 12:55835880-55835902 CACAGGGCAGTGCCTGCCTCAGG + Intronic
1101671984 12:106884122-106884144 CACTTGACAGTGCCCTCCCCAGG + Intronic
1102149284 12:110677644-110677666 CACTTCTCCCTTCCTGCCCCAGG + Intronic
1102389328 12:112536885-112536907 CACTTGGCATTTCTTGCGCCTGG - Intergenic
1102426650 12:112849031-112849053 CAGTTGGCAATGGCTTCCCCTGG - Intronic
1104198741 12:126567137-126567159 CACTTGGAGCAGCCGGCCCCAGG + Intergenic
1104358714 12:128112141-128112163 CCCAGGGCAGTGCCTGCCCCAGG + Intergenic
1105792940 13:23820670-23820692 CACCTGGCTCTGCCTCTCCCAGG + Intronic
1105837588 13:24224367-24224389 CAGCTGGCACTTCCTGCCCCGGG - Exonic
1106046446 13:26146364-26146386 CACTTGGCCCTGGCTGCCATGGG + Intronic
1106253075 13:27998020-27998042 GACTACGCCCTGCCTGCCCCTGG - Intergenic
1108146488 13:47482940-47482962 CACTTGTCAGTGTGTGCCCCAGG - Intergenic
1108282754 13:48876076-48876098 CTCTTTCCACTGCTTGCCCCTGG + Intergenic
1109884367 13:68524041-68524063 CAGCTGGCGCTGCCGGCCCCAGG + Intergenic
1110132408 13:72023444-72023466 CCCTTGGCAATGACTACCCCTGG + Intergenic
1112228076 13:97560175-97560197 CACTTGGCGGTGCCTCTCCCTGG - Intergenic
1112308307 13:98295324-98295346 CTCGTGGCATTGCCTGCCCAGGG - Intronic
1114482874 14:23046307-23046329 CACTTGGCACTACGAGCCCCAGG + Intergenic
1114614347 14:24060287-24060309 CACTGTGCCCTGCATGCCCCGGG - Intronic
1118878691 14:69808069-69808091 CCCTTGGAAGTGCCTGCCACTGG + Intergenic
1119300332 14:73566595-73566617 CAGCTGGCCCTGCCAGCCCCGGG - Intergenic
1119426055 14:74535385-74535407 CACTGGCCTCTGCCAGCCCCAGG + Intronic
1119437493 14:74606929-74606951 CACTTAGTACTGCCTGTCTCAGG + Intronic
1119519894 14:75277829-75277851 CACCTCGCACTCCCTACCCCTGG + Intergenic
1120079103 14:80195460-80195482 CCCTTGCCACTCCCAGCCCCTGG - Intergenic
1120214687 14:81668973-81668995 CAGCTGGCACTGCCGGCCCCGGG - Intergenic
1120439125 14:84513171-84513193 CAGTTGGCCCTGCCGGCCCCAGG - Intergenic
1121119163 14:91365087-91365109 CACTTGTCACTGCTGGCTCCAGG + Intronic
1121447252 14:93987067-93987089 CACAGGGCACTGCCAGCCCCGGG + Intergenic
1122684194 14:103491879-103491901 CACTTTCCACGGCCAGCCCCGGG + Exonic
1122694115 14:103544553-103544575 CAGTTGGCCCTCCCAGCCCCTGG + Intergenic
1124061600 15:26298324-26298346 CAGCTGGCACCGCCGGCCCCGGG - Intergenic
1124186010 15:27530173-27530195 CAATTGGAACAGCTTGCCCCAGG - Intronic
1124344163 15:28910354-28910376 CACTTTTCATTTCCTGCCCCTGG - Intronic
1125771358 15:42168491-42168513 CACTTTCCACTCCCTGCCTCTGG - Intronic
1127849972 15:62903637-62903659 CCCTGGGCTCTGGCTGCCCCTGG + Intergenic
1127910627 15:63413222-63413244 TACTTAGCACTGCCTGCCAATGG + Intergenic
1128512411 15:68321503-68321525 CACCTGGCTCTCCCTGGCCCAGG - Exonic
1128669991 15:69567620-69567642 CAGCTGGCCCTGCCGGCCCCAGG - Intergenic
1129156011 15:73718506-73718528 CCTTTGGCACTGCCAGCTCCAGG + Intergenic
1132495712 16:262347-262369 CATGTGGCACTGCGTGCCCCTGG + Intronic
1132551630 16:556086-556108 AACTTGCCACTGCCCACCCCGGG - Intergenic
1132726050 16:1338814-1338836 CACATGGCCCTTCCTGCCCCTGG + Intronic
1133784589 16:8964107-8964129 CCCTCGGCGCTCCCTGCCCCCGG + Intronic
1134314479 16:13105799-13105821 AACTTGGCTCTGCCTGGCCGGGG + Intronic
1135280838 16:21152696-21152718 CAGCTGGCCCTGCCGGCCCCGGG + Intronic
1135723043 16:24833277-24833299 CACCTGCCACTCCCTGCACCAGG - Intergenic
1136911042 16:34144586-34144608 CACTGTCTACTGCCTGCCCCTGG + Intergenic
1137431385 16:48420622-48420644 CACCTGGCACTCACTGCACCTGG - Intronic
1137692390 16:50438047-50438069 CACTCGGCAGTGCCTGCCAGGGG - Intergenic
1139671327 16:68493856-68493878 CACCTGGTACTGCCTGAACCTGG + Intergenic
1140729408 16:77842630-77842652 CACTTATCACTACCTACCCCTGG - Intronic
1141839523 16:86565900-86565922 AACTCGGCTCTGCCTGGCCCGGG + Intergenic
1141938915 16:87261388-87261410 CACTGGGCAATGCCTGGCTCTGG - Intronic
1142193403 16:88728236-88728258 GCCGTGGCACTGCCGGCCCCCGG + Intronic
1142336831 16:89494781-89494803 CACTTAGCACTTACTGACCCAGG + Intronic
1142596656 17:1033021-1033043 CACTTGGCACTGTGTAACCCTGG - Intronic
1142607160 17:1088206-1088228 CACTTGGACCTGGCTGTCCCCGG - Intronic
1144761474 17:17709858-17709880 CTCTTGGAACTGCCTCCTCCTGG - Intronic
1145250108 17:21292827-21292849 CTCTTGGCTCTTCCTGTCCCTGG + Intronic
1146279504 17:31536104-31536126 CACCTGGCCCTGCTGGCCCCTGG - Exonic
1147980293 17:44269885-44269907 CACTTGGCACTCACTGCCACAGG - Intergenic
1148052691 17:44776927-44776949 AACCTGGCACTGCCGGTCCCGGG - Exonic
1150323894 17:64240326-64240348 CACTTGTCACTGCCCACCCACGG + Intronic
1150951073 17:69802527-69802549 CACGTGCCACTGCATTCCCCGGG + Intergenic
1151479665 17:74362526-74362548 CACCTGGCTCAGCTTGCCCCTGG - Intergenic
1151680509 17:75620400-75620422 CACTTGGCAGAGGCTGCCCGGGG + Intergenic
1152245276 17:79182190-79182212 CACTGGGCCCTGCAGGCCCCAGG + Intronic
1152586836 17:81193008-81193030 CTCGTGGCCTTGCCTGCCCCCGG - Intronic
1153496546 18:5705166-5705188 CCCCTGTCACTGCCTGCCCAAGG - Intergenic
1153591937 18:6683342-6683364 CACCTTCCACTGCCTGCCCAGGG - Intergenic
1153941894 18:9985860-9985882 CAACAGGCCCTGCCTGCCCCAGG - Intergenic
1154338251 18:13482727-13482749 AACTTGTCACTACCTCCCCCAGG - Intronic
1155308031 18:24498338-24498360 CACTGTTAACTGCCTGCCCCTGG + Intergenic
1157227715 18:45882393-45882415 CACTTGGCACTTACTGCCTGGGG - Exonic
1157242641 18:46025419-46025441 ACCTTGGCAGTGGCTGCCCCTGG - Intronic
1157446216 18:47748573-47748595 CACATGGCACTGCATGGCCAGGG + Intergenic
1157488328 18:48105267-48105289 CACTTAGCTCTGCCTTCCCATGG - Intronic
1158228852 18:55230996-55231018 CAGATGGCACTGTCTGCCACAGG + Intronic
1160024451 18:75206918-75206940 GCCTAGGCACTGCCTGCCCTGGG - Intronic
1160543585 18:79638507-79638529 CCCTGGGCACGGCCAGCCCCGGG - Intergenic
1161390827 19:4019404-4019426 GACTGGGCCCTGTCTGCCCCAGG + Intronic
1161508490 19:4657357-4657379 CCCTTGGCACTCGCTGTCCCTGG - Intronic
1161608201 19:5226278-5226300 CACCAGGCACAGCCTGCCTCAGG + Intronic
1161801969 19:6421366-6421388 CACTTGGCACTGCCTGCCCCGGG + Intronic
1162026095 19:7895002-7895024 AGCTTGGCAGTCCCTGCCCCTGG + Intronic
1162792114 19:13068534-13068556 CACTTGGCTCAGCCTGGCTCTGG + Intronic
1162964527 19:14149613-14149635 TACCTCTCACTGCCTGCCCCAGG - Exonic
1163387894 19:17011402-17011424 CACTTGGGACTACCTGGCCAGGG - Intronic
1163531311 19:17850630-17850652 TGCTTGGCACTTCCTGCCGCAGG - Intergenic
1163826098 19:19525784-19525806 CACAGGGCACTGCCTGTCCCTGG + Intronic
1164559264 19:29277396-29277418 CTCTAGGAACTGCCTGTCCCTGG + Intergenic
1164721862 19:30438443-30438465 CACTCAGCACTGCGTGACCCAGG - Intronic
1165942801 19:39423634-39423656 CACCTGGCTCTGCCTGCTCCTGG - Exonic
1167421626 19:49407338-49407360 CACCAGCCACTTCCTGCCCCTGG + Intronic
1168686611 19:58352925-58352947 CACTTGGCCCTGTCAGCTCCAGG + Exonic
925118446 2:1399208-1399230 CACGTGGCTCTGCCTCCCTCGGG - Intronic
925554911 2:5120465-5120487 CACTCAGGAGTGCCTGCCCCTGG - Intergenic
925591245 2:5512248-5512270 CACTTGGCAGTGCTTGTCCCTGG + Intergenic
925635418 2:5937401-5937423 TACCTGGCCCTGCCTGTCCCTGG - Intergenic
926292782 2:11543991-11544013 CACTTGGCTCTGGGTGCTCCTGG - Intronic
926751571 2:16202533-16202555 CACTTGCCCCTGCTTGCCCAGGG + Intergenic
927868365 2:26607638-26607660 CACCTGGCACTGCCAGGACCCGG + Intronic
928964847 2:36966396-36966418 CCCTTGGCACCGCCGGCGCCCGG + Exonic
929050339 2:37831169-37831191 CAGTTGGCTCTGCCTGGCCGTGG - Intergenic
929052231 2:37847685-37847707 CAGTTAGCTCTGCCTTCCCCTGG + Intergenic
929546363 2:42857400-42857422 CACATGCCACTGTTTGCCCCTGG - Intergenic
929758428 2:44786953-44786975 CACTTGCCACTGCCTCTGCCTGG - Intergenic
930988717 2:57624014-57624036 CCCTTAGCACTCACTGCCCCTGG + Intergenic
931998546 2:67862461-67862483 TATTTGTCACTGGCTGCCCCAGG + Intergenic
932288142 2:70553864-70553886 GACTAGGCAGGGCCTGCCCCCGG + Exonic
933349579 2:81136710-81136732 CACATGGACCTGCCTGACCCAGG + Intergenic
935090476 2:99890851-99890873 CACTGGGGCCTGCCTTCCCCAGG + Intronic
935673585 2:105575821-105575843 CATATGGCCCTGCCTGCCTCTGG - Intergenic
935719435 2:105967120-105967142 ACCTTGGCCCTGCCTGCCCCAGG - Intergenic
936138703 2:109919618-109919640 CACATGCCACTGCTTGCCCATGG - Intergenic
936205993 2:110451867-110451889 CACATGCCACTGCTTGCCCATGG + Exonic
936924937 2:117726922-117726944 CTCTGGGCATTCCCTGCCCCTGG + Intergenic
937711862 2:124987671-124987693 CAGCTGGCCCTGCCGGCCCCGGG - Intergenic
938143819 2:128817775-128817797 CACTTGGCATTTCCTTCTCCTGG + Intergenic
938770725 2:134498742-134498764 CAGCTGGCTCTGCCTGTCCCTGG - Intronic
939520410 2:143223277-143223299 CACTTGGCATTTCTTGCCCTAGG + Intronic
942070032 2:172308110-172308132 CACTTGGCACTGCAGGTCCCAGG - Intergenic
943654173 2:190489835-190489857 CATCTGGCACTGCCAGCCACTGG - Exonic
945872841 2:215245990-215246012 CAGCTGGCCCTGCCAGCCCCGGG - Intergenic
946425596 2:219594093-219594115 CACTTTGCACAGCCTACTCCAGG + Intergenic
948177410 2:235954942-235954964 CACATGGCACTGCCTCCCCTTGG + Intronic
948230583 2:236346288-236346310 CACCTGGCGCTGCCTCCTCCTGG + Intronic
948802097 2:240437560-240437582 CACTGGGCTCTGTCTGTCCCAGG + Intronic
1168789654 20:567675-567697 CTCTCAGCACTGCCAGCCCCTGG - Intergenic
1170868940 20:20187098-20187120 GCCATGGCACTGCCTGCCCAAGG + Intronic
1171906384 20:30902867-30902889 CACTGTCTACTGCCTGCCCCTGG + Intergenic
1172112173 20:32553376-32553398 CACCAGGCACTTCCTGCCGCAGG + Intronic
1173555615 20:43963385-43963407 CCTTGGGCACTGCCTGCCGCAGG - Intronic
1174444435 20:50581049-50581071 CACTTGTCACCCCCTCCCCCAGG - Intronic
1174919392 20:54685481-54685503 CACTTCACACTGCCTGGCTCTGG + Intergenic
1176373556 21:6076524-6076546 CACTTGGTTCTGTCTGCCCCAGG + Intergenic
1178610055 21:34072878-34072900 CCCTTGGCACTGCGTGACCTTGG - Intergenic
1179054314 21:37916861-37916883 CTCTGGGCACTGCCTCCCACCGG + Intergenic
1179302895 21:40128404-40128426 CACATGGCACAACCTGCCCATGG - Intronic
1179465104 21:41566781-41566803 CACTTGGCACAGCCCACGCCTGG - Intergenic
1179508850 21:41859045-41859067 CAGGTGGCACAGCCTCCCCCAGG + Exonic
1179644596 21:42767703-42767725 CCCGTGGCCCTGCCTGCACCGGG - Intronic
1179749921 21:43461719-43461741 CACTTGGTTCTGTCTGCCCCAGG - Intergenic
1180339802 22:11608982-11609004 CACTGTCTACTGCCTGCCCCTGG + Intergenic
1180567707 22:16689257-16689279 CAATTTGCGCTGCCTGCCTCTGG - Intergenic
1180921540 22:19524058-19524080 CACTTTGCACTGCATGTGCCCGG + Exonic
1181560621 22:23697563-23697585 ACCTTGGAACTGCCTGCCCTTGG - Intronic
1182078329 22:27510609-27510631 CACCTCTCACTGGCTGCCCCAGG + Intergenic
1182437673 22:30341088-30341110 CCCTTGGCACTGTCCCCCCCCGG - Intronic
1183984244 22:41560872-41560894 CACCTGGCAGTGCCTGACTCAGG + Exonic
1184087853 22:42276106-42276128 CATGTGGCACTGCCTTCCCGTGG - Intronic
1184161880 22:42701849-42701871 CCCTTGGCTCTGCTTGCCTCAGG - Intronic
1184189338 22:42884607-42884629 CCCTTGGCTCACCCTGCCCCTGG + Intronic
1184444196 22:44537765-44537787 CCCCTGGCATTGCCTGCTCCAGG + Intergenic
1184582772 22:45428701-45428723 CACTTAGCACTAACTCCCCCCGG - Intronic
1184654590 22:45934709-45934731 CACCTGGCTATGCCTGCCCCAGG + Intronic
1184682651 22:46080319-46080341 CATCTGGCACTGGCTGCCCGGGG - Intronic
1184879294 22:47294895-47294917 CTCTGGGCACTGCCTACCCTGGG - Intergenic
1184923791 22:47623774-47623796 CACCTGCCACTGCCTGGCCTTGG - Intergenic
1184953243 22:47861123-47861145 CACTGGGCCCTGCCTCCCCAGGG + Intergenic
1185146052 22:49137273-49137295 CACGTGGGACTGCAGGCCCCAGG - Intergenic
950446327 3:13040927-13040949 CATTTGTCCCTGCCTGGCCCAGG + Intronic
951186637 3:19721443-19721465 AACTAGGCACTGCCTCTCCCTGG + Intergenic
951536234 3:23743566-23743588 CACATGTCGCTGTCTGCCCCGGG + Intergenic
951746148 3:25979981-25980003 CAGTTCCCACTGCCAGCCCCAGG - Intergenic
956258959 3:67316029-67316051 CATTTGACAGTGCCTGTCCCTGG - Intergenic
958468097 3:94483279-94483301 CTCCTGGCACTCCCTGCCCTGGG - Intergenic
958810765 3:98858185-98858207 CAGCTGGCCCTGCCAGCCCCAGG - Intronic
960056820 3:113281958-113281980 CTCTGGGCACTCCCTGCACCAGG - Intronic
960696364 3:120400670-120400692 CCCTTGGCTCTGCCTCCTCCTGG + Intronic
961445002 3:126976304-126976326 GACTTGGCACTGCCTCCTCCTGG - Intergenic
961452256 3:127007665-127007687 GTCTTGGCACTGACTGCTCCTGG - Intronic
962305026 3:134278422-134278444 GACGTGGCACTGCATGCACCAGG + Intergenic
962493391 3:135915755-135915777 CACCTGGAACTGCCTACCTCTGG + Intergenic
963163774 3:142180182-142180204 CCCTTGGTCTTGCCTGCCCCTGG + Intronic
964623042 3:158734212-158734234 CACTTGGCTCTGCCTCCTTCAGG - Intronic
965652347 3:170947322-170947344 CGGCTGGCACTGCCGGCCCCGGG + Intergenic
966816731 3:183895962-183895984 CACTTGGCAACCCCAGCCCCAGG - Intergenic
967919618 3:194604601-194604623 CACAGGGCACTGGCTGCCCTGGG - Intronic
968503023 4:959943-959965 AGCTGGGCACTGCCTGCCCCTGG + Exonic
968520281 4:1031977-1031999 CTCTTGGCCCTGCCTTCCTCAGG - Intergenic
968620528 4:1601704-1601726 CCCCTGGCACCCCCTGCCCCTGG + Intergenic
969707100 4:8817972-8817994 CACATTACAGTGCCTGCCCCAGG + Intergenic
969736289 4:8993112-8993134 CAGCTGGCCCTGCCGGCCCCGGG - Intergenic
972722878 4:41718210-41718232 CCCTTAGCAATGACTGCCCCTGG - Intergenic
974188003 4:58465221-58465243 CAGCTGGCACTGCCGGCCCCAGG + Intergenic
978736999 4:112094707-112094729 GACTTGGCCCTGCCTTCCTCTGG - Intergenic
979987674 4:127335179-127335201 CAATTGGAACTGCCTAGCCCAGG + Intergenic
981585761 4:146300504-146300526 GAGGTGGCACTGCCTGCCCTGGG + Intronic
982382081 4:154760110-154760132 GATATGGCAGTGCCTGCCCCTGG + Intergenic
983553069 4:169036096-169036118 CAGCTGGCCCTGCCGGCCCCGGG - Intergenic
984776125 4:183482953-183482975 GGCTTGGCCCTGCCGGCCCCGGG - Intergenic
985796632 5:1966844-1966866 CACTTCGCCCTGCCTTTCCCTGG - Intergenic
986006371 5:3672265-3672287 CACTTGGCCCCACCAGCCCCGGG - Intergenic
986123349 5:4863563-4863585 TACTTGGCAATGCCAGCCCTGGG + Intergenic
986888820 5:12275018-12275040 CCCATGACACTGCCTACCCCAGG + Intergenic
987090838 5:14506817-14506839 CACCTGGCACTGCCGGCAGCCGG + Intronic
988734691 5:34008219-34008241 CATTTGGCACTGGCGGTCCCGGG - Intronic
992365214 5:76083634-76083656 AACTTTGCCCCGCCTGCCCCCGG + Intronic
995747580 5:115419784-115419806 GACTTGGAACTGCCTACCTCTGG - Intergenic
995927984 5:117398856-117398878 CACTTGGCAATGCGTGCACAAGG - Intergenic
997237513 5:132282039-132282061 CACTGGGGACTGCCTCCACCTGG - Intronic
997539324 5:134648726-134648748 CACGTGGCACTTCCGGCTCCGGG - Intronic
997616079 5:135247176-135247198 CACTTGGCGCTGGCAGCCACGGG - Intronic
997713843 5:136028157-136028179 TACTTGGCACTGCTAGCCCTGGG - Intergenic
999081522 5:148848643-148848665 CACTTAGCAGAGTCTGCCCCTGG + Intergenic
999941933 5:156552368-156552390 CAGTTGGCAGTGCCTGACCTAGG + Intronic
1000948143 5:167447643-167447665 CACATGGAACTGCTTCCCCCTGG + Intronic
1002570399 5:180136601-180136623 CACGAGGCCCTGCCTGCCCCGGG - Intronic
1002665744 5:180823334-180823356 CATTTGACCCTGCCTGCCCCTGG + Intergenic
1002851058 6:996714-996736 CAGGTGGCACTGCCTGGCACAGG + Intergenic
1003186141 6:3832488-3832510 CTCTTCTCACTGCCTGTCCCTGG + Intergenic
1004486839 6:16074040-16074062 CTCTTGTCACTGCCACCCCCAGG + Intergenic
1006367433 6:33623733-33623755 AGCTTGGCCCTTCCTGCCCCAGG + Intronic
1007718759 6:43872822-43872844 CACTGGGCACTGGCAGACCCTGG - Intergenic
1008559896 6:52713505-52713527 CACAAGGCCCTGCCTGCCCATGG - Intergenic
1017771850 6:157650152-157650174 CACTGTGCACTGCCTGCCCATGG - Intronic
1017942925 6:159068918-159068940 TACTCGGCACAGCCTGCCCTGGG - Intergenic
1018911308 6:168101981-168102003 CGCTCCGCACTGCCCGCCCCGGG - Intergenic
1019310281 7:357116-357138 CCCTCGGCACTGCTTGGCCCAGG - Intergenic
1019601933 7:1889180-1889202 CGCTTGCCTCTGCCAGCCCCGGG - Intronic
1019621945 7:1996687-1996709 GACTTGGCACAGGGTGCCCCTGG + Intronic
1019630983 7:2049667-2049689 CACTGGGCACTGCCTGGCGTGGG + Intronic
1019930582 7:4220283-4220305 CAATTGACATTGTCTGCCCCTGG - Intronic
1020017952 7:4842460-4842482 CACTAGGCACTGCCTTCTCGAGG - Intronic
1020300828 7:6794244-6794266 CACGTGGCACTGTCCTCCCCAGG + Intronic
1021804690 7:24343399-24343421 CTCATGGCCCTGCCTGCCTCAGG + Intergenic
1021805380 7:24349587-24349609 CTCTTGGCCCTGCCTGCCTCAGG - Intergenic
1023187819 7:37549842-37549864 CCCTGGGCACAGCCTTCCCCAGG - Intergenic
1023877403 7:44294439-44294461 CACTGGGCAGTGCTTGCCCAGGG + Intronic
1023880946 7:44321075-44321097 CACCAGGCACTCCCTGCCTCGGG - Intronic
1023909642 7:44544260-44544282 CACCTGGCAGAGGCTGCCCCAGG + Intergenic
1026202934 7:68231131-68231153 CAGCTGGCCCTGCCGGCCCCGGG + Intergenic
1028023724 7:85809265-85809287 CACTAGGCAGTGCCTGACTCGGG - Intergenic
1029275373 7:99400811-99400833 CACTTGGCCCACCCTGCCCTGGG - Intronic
1032093127 7:128921994-128922016 CCCATGCCACAGCCTGCCCCTGG + Intergenic
1032094549 7:128931408-128931430 TCCCTGGCTCTGCCTGCCCCAGG + Intergenic
1032173593 7:129606247-129606269 AACTTGGCACTGCCTGGGTCAGG + Intergenic
1034267693 7:149789208-149789230 CTCCGGCCACTGCCTGCCCCTGG + Intergenic
1034699006 7:153080672-153080694 CATGTGGCACTGCCTTCCCCTGG - Intergenic
1034944520 7:155253351-155253373 GGCTGGGCATTGCCTGCCCCTGG - Intergenic
1034996047 7:155577878-155577900 CACCTGGCTCTACCTGCTCCCGG + Intergenic
1034996059 7:155577929-155577951 CACCTGGCTCTACCTGCTCCCGG + Intergenic
1035182221 7:157097702-157097724 CACCTGCCACCGCCTGTCCCTGG - Intergenic
1035279993 7:157772503-157772525 CTCTTTCCACTTCCTGCCCCAGG - Intronic
1036284569 8:7432596-7432618 GTCTTGTCACTCCCTGCCCCTGG + Intergenic
1036336906 8:7878934-7878956 GTCTTGTCACTCCCTGCCCCTGG - Intergenic
1036469571 8:9040421-9040443 CACTTGGCACTGCTGCCCCAAGG - Intronic
1037625808 8:20605804-20605826 CACTTGGCTCTGGCTGCCAGCGG - Intergenic
1037665223 8:20963193-20963215 TCCTGGGCACTGCCAGCCCCTGG + Intergenic
1038239862 8:25798465-25798487 CAGGTGGCACTGCCAACCCCTGG + Intergenic
1038425953 8:27463914-27463936 CACTGTGCACTGGGTGCCCCCGG - Exonic
1038870689 8:31489966-31489988 CACCTGGCCCTGCCAGCCCTGGG + Intergenic
1044862161 8:96534070-96534092 CAGTGGGCACCGCCGGCCCCGGG - Intronic
1048117811 8:131545042-131545064 AACTTGCCACTGCCTACCTCAGG - Intergenic
1048575132 8:135684176-135684198 CACTTGGATCTGCCTGACTCGGG + Intergenic
1049407440 8:142457967-142457989 CCCTCGGCACTGACTGCCCAGGG - Intronic
1049571295 8:143371445-143371467 CCCTGGGGACTGCCTGGCCCAGG + Intronic
1049944520 9:581033-581055 CACTTGGAGCGGCCGGCCCCTGG - Intronic
1050647975 9:7742586-7742608 CACCTTGCACTTCCTGCCTCCGG - Intergenic
1051314206 9:15810664-15810686 CAGCCGGCACTGCCGGCCCCAGG - Intronic
1051727269 9:20101231-20101253 GCCTTGGCTCTGCCTGCCCAGGG - Intergenic
1051784622 9:20728967-20728989 CACAGGGCACCACCTGCCCCTGG + Intronic
1053137061 9:35657914-35657936 CACGTGGCACTCTCTGCCCGAGG + Intergenic
1053174235 9:35910643-35910665 CACTTGGCACTGGCTGGGCATGG - Intergenic
1053510876 9:38686888-38686910 CACTTGCCTCTTCCTCCCCCAGG + Intergenic
1056574637 9:87845942-87845964 CAGTTGCCACTGCCTTCGCCAGG - Intergenic
1056792330 9:89633802-89633824 CACCTGGCACTGACTGGCCAAGG - Intergenic
1057029619 9:91765484-91765506 AACTTGGCACTGCCTGTCAAGGG - Intronic
1057520008 9:95752542-95752564 CGCCTGGCAGTCCCTGCCCCGGG - Intergenic
1059399517 9:114060167-114060189 TGCTTGGCGCTGCCTGCCACAGG + Exonic
1059749714 9:117236512-117236534 CACATGTCACTGCCAGCCCCTGG - Intronic
1061808100 9:133147668-133147690 CAGTGGGCACTGCCTCCCCCTGG + Intronic
1061896737 9:133652224-133652246 CCCTCGGCTCTGCCTGCCCCAGG + Exonic
1062170163 9:135130456-135130478 CACTTTGCACTGCCTGGCAGAGG - Intergenic
1062281622 9:135754469-135754491 CACCTCCCACTGCCTGCCCGGGG - Intronic
1062516990 9:136941793-136941815 CCGTGGGCACTGCCTGCTCCGGG + Intronic
1062652590 9:137585875-137585897 CAGTTCGCACTGCCTGCACCAGG + Intronic
1203460439 Un_GL000220v1:31247-31269 CAGCTGGCCCTGCCAGCCCCAGG - Intergenic
1186846938 X:13540318-13540340 CACATGCCACTGCCTGGCTCGGG - Intergenic
1189201259 X:39197536-39197558 CACTAGCCACTGTCTGACCCTGG + Intergenic
1189896852 X:45665039-45665061 CAGCTGGCCCTGCCTGCCCCAGG - Intergenic
1190298600 X:49043077-49043099 CAGTCGGCACTCCCAGCCCCAGG + Intronic
1191105072 X:56767591-56767613 CAGTTGGACCTGCCTGCCCAGGG + Intergenic
1192189778 X:68983741-68983763 CAGGGGGCACTGCCTGGCCCTGG - Intergenic
1192571453 X:72209554-72209576 GACTTGGGACTGCCTGGCCTGGG - Intronic
1195654801 X:107324108-107324130 CACCTGGGACTGCCTCCCCAGGG + Intergenic
1199996381 X:153029120-153029142 CTCTGGCCACTGCTTGCCCCTGG - Intergenic
1200034803 X:153320329-153320351 CTCTGGCCACTGCTTGCCCCTGG + Intergenic
1200168958 X:154058157-154058179 CAACTGGCAGTGCCTGCCACAGG - Intronic
1200831051 Y:7689256-7689278 CAGTAGGCACAGCCTGGCCCTGG - Intergenic
1201063816 Y:10070350-10070372 CAGTGGGCACAGCCTGGCCCTGG + Intergenic