ID: 1161802140

View in Genome Browser
Species Human (GRCh38)
Location 19:6422187-6422209
Sequence CGGAACAAGAAGAATTAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 225}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161802131_1161802140 14 Left 1161802131 19:6422150-6422172 CCCTCCTCTCTGCCACCTGATAC 0: 1
1: 0
2: 6
3: 33
4: 335
Right 1161802140 19:6422187-6422209 CGGAACAAGAAGAATTAACAAGG 0: 1
1: 0
2: 0
3: 23
4: 225
1161802136_1161802140 2 Left 1161802136 19:6422162-6422184 CCACCTGATACCTCAGGATGGCA 0: 1
1: 0
2: 1
3: 11
4: 184
Right 1161802140 19:6422187-6422209 CGGAACAAGAAGAATTAACAAGG 0: 1
1: 0
2: 0
3: 23
4: 225
1161802139_1161802140 -8 Left 1161802139 19:6422172-6422194 CCTCAGGATGGCAGACGGAACAA 0: 1
1: 0
2: 0
3: 8
4: 128
Right 1161802140 19:6422187-6422209 CGGAACAAGAAGAATTAACAAGG 0: 1
1: 0
2: 0
3: 23
4: 225
1161802133_1161802140 10 Left 1161802133 19:6422154-6422176 CCTCTCTGCCACCTGATACCTCA 0: 1
1: 0
2: 1
3: 38
4: 240
Right 1161802140 19:6422187-6422209 CGGAACAAGAAGAATTAACAAGG 0: 1
1: 0
2: 0
3: 23
4: 225
1161802137_1161802140 -1 Left 1161802137 19:6422165-6422187 CCTGATACCTCAGGATGGCAGAC 0: 1
1: 0
2: 0
3: 13
4: 292
Right 1161802140 19:6422187-6422209 CGGAACAAGAAGAATTAACAAGG 0: 1
1: 0
2: 0
3: 23
4: 225
1161802132_1161802140 13 Left 1161802132 19:6422151-6422173 CCTCCTCTCTGCCACCTGATACC 0: 1
1: 0
2: 4
3: 31
4: 322
Right 1161802140 19:6422187-6422209 CGGAACAAGAAGAATTAACAAGG 0: 1
1: 0
2: 0
3: 23
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161802140 Original CRISPR CGGAACAAGAAGAATTAACA AGG Intronic
901385077 1:8902817-8902839 TGGAACAAGAAGAATTGTCTTGG - Intergenic
908366975 1:63434668-63434690 TGGAAAAAGAAGAATTATCTTGG - Intronic
908698705 1:66874131-66874153 CGGAACAAGAAAAATTATTAGGG + Intronic
909498886 1:76311104-76311126 CAGAAGAAGAAGAAATAACAAGG - Intronic
911731860 1:101299765-101299787 AGGATGAAAAAGAATTAACAGGG + Intergenic
912242490 1:107926298-107926320 CAAAACAAAAAGAATCAACAAGG + Intronic
912248490 1:107987022-107987044 CAGAAAAAAAAAAATTAACACGG + Intergenic
914345680 1:146796577-146796599 CGCAAAAAGAAAAATTAACATGG + Intergenic
914886762 1:151591618-151591640 TGGAAGAAGAAGAATTATCTTGG - Intergenic
915841067 1:159213459-159213481 CTGAATGAGAAGAAGTAACAGGG + Intergenic
917225844 1:172781535-172781557 AGGAAAAAGAAGAATGAAGAAGG - Intergenic
917265268 1:173214519-173214541 TGGAAGAAGAAGAATTATCTTGG + Intergenic
917690201 1:177460882-177460904 CTGAACAACAAGAAAGAACAGGG - Intergenic
918939156 1:190968210-190968232 CTGAACAAGAAATATTACCATGG - Intergenic
919512808 1:198487792-198487814 CGGAACACGATGAATGCACAAGG - Intergenic
920224050 1:204425079-204425101 AGGAACAAGAAGAATCCAGAGGG + Intronic
921645808 1:217616357-217616379 GGGAATAAGAAGAATTTAGATGG - Intronic
922094615 1:222432359-222432381 AGGAACAGGCAGAATTATCAGGG - Intergenic
924085262 1:240444727-240444749 CGGAAAAAGAAATGTTAACAAGG - Intronic
1063355998 10:5398815-5398837 TGGAAGAAGAAGAATTATCTTGG - Intronic
1063584745 10:7342044-7342066 CGGACCAAGTAGATTTAAGAAGG - Intronic
1064965717 10:21013368-21013390 GAGAACAAGAAGCATTACCATGG + Intronic
1065061533 10:21907085-21907107 AGGAAGAAGAAACATTAACAGGG - Intronic
1065674985 10:28164724-28164746 TGGAAGAAGAAGAATTATCTTGG - Intronic
1066228888 10:33412539-33412561 AGGAAAAAGGAGAACTAACAAGG + Intergenic
1067727879 10:48785772-48785794 CTGAAAAAGAAGAATTAATTTGG - Intronic
1067947553 10:50699598-50699620 GGGAACAAATGGAATTAACAAGG - Intergenic
1068925531 10:62532501-62532523 CGGAACAAGGAAAATCATCAGGG + Intronic
1068968842 10:62941321-62941343 TGGAAGAAGAAGAATTATCTTGG - Intergenic
1070882870 10:79864585-79864607 GGGAACAAATGGAATTAACAAGG - Intergenic
1070974290 10:80593138-80593160 CTGAAAAAGAAGAACAAACATGG - Intronic
1072127544 10:92460545-92460567 TGGAAGAAGAAGAATTGTCATGG + Intronic
1072830545 10:98653121-98653143 CAGAACAAGGACAATTAACAGGG - Intronic
1075405285 10:122191449-122191471 TGGAACAAGAAGAATTGTCTTGG + Intronic
1078942867 11:16028558-16028580 GGGAACAAGAGGAAATAACATGG - Intronic
1080494920 11:32807652-32807674 TGGAACAAGAAGAATTATCTTGG - Intergenic
1082681011 11:56170435-56170457 AGAAAAAAGAAGAATTAAAAGGG - Intergenic
1084300448 11:68247230-68247252 TGGAAGAAGAAGAATTGACTTGG + Intergenic
1086145864 11:83550922-83550944 GGGAAAAAGAAGAAATAACCTGG + Intronic
1086208747 11:84292846-84292868 TGGAAGAAGAAGAATTATCTTGG + Intronic
1086319915 11:85634814-85634836 AGGAACCTGAAGAATGAACAAGG - Intronic
1086754714 11:90545418-90545440 CTGAACAAGATGAATATACATGG - Intergenic
1087242225 11:95791851-95791873 CGGAATGAGAAGAAGTAATACGG + Intronic
1087474001 11:98614573-98614595 CGGAATAACAAGAATTCATAAGG + Intergenic
1088888009 11:114022718-114022740 TGGAAGAAGAAGAATTATCTTGG + Intergenic
1089101566 11:115966862-115966884 TGGAAGAAGAAGAATTATCTTGG + Intergenic
1090018452 11:123106194-123106216 TGGAAGAAGAAGAATTATCTTGG - Intronic
1091859676 12:3768909-3768931 CAGAACAAGAAAAATTGACAGGG + Intergenic
1092107521 12:5932888-5932910 TGCAACTAGAAGAATTAACTAGG + Intronic
1095662654 12:44755692-44755714 TGGAACAGGAAGCACTAACAAGG - Intronic
1096249696 12:50022111-50022133 CAGAATAGGAAGAATTCACAGGG - Intronic
1096566903 12:52489646-52489668 TGGAACAAGAAGAACTATCTTGG - Intronic
1097496465 12:60343837-60343859 CTGAACAAGAAAAATAAAGAAGG - Intergenic
1098011258 12:66054880-66054902 CTGAACCAGAAGAATTTTCACGG + Intergenic
1098157125 12:67610864-67610886 TGGAACAAGAAGAATTGTCTTGG - Intergenic
1098734118 12:74076142-74076164 CTCAACAAGATGAATCAACAAGG + Intergenic
1099953607 12:89330974-89330996 AGGACCAAGAAGAAGTTACAAGG + Intergenic
1099981350 12:89607237-89607259 CGAAGCTAGAAGAATTCACAGGG - Intronic
1100440524 12:94613160-94613182 CAGAACTACAAGAATTAAAATGG + Intronic
1102545759 12:113654103-113654125 TGGAAGAAGAAGAATTATCTTGG + Intergenic
1106286259 13:28320602-28320624 TGGAAGAAGAAGAATTATCTTGG - Intronic
1108275157 13:48800831-48800853 TGGAACATGAAGAATGAAGAGGG + Intergenic
1109533860 13:63690369-63690391 GGGAATAAGAAAAATTAACAAGG + Intergenic
1110294049 13:73841336-73841358 CGGAAGAAGAAAAATTAACTTGG + Intronic
1111583584 13:90255723-90255745 CCGAAGGAGAAGAATTATCATGG - Intergenic
1112051954 13:95651634-95651656 CAGAACAAGGAAAATTATCAGGG + Intergenic
1112921763 13:104621979-104622001 TGGAACAAGAAGAATTGTCTCGG + Intergenic
1114326343 14:21593012-21593034 CAGGACAAGAAGAACTAAGAGGG + Intergenic
1116453688 14:45093191-45093213 TGGAATAATAAGAATTAAAAAGG - Intronic
1117052560 14:51876339-51876361 TGGACAAAGAAGAATTATCAAGG - Intronic
1117177082 14:53155760-53155782 CGGAAGAAGAAGAATTGTCTTGG + Intergenic
1120110057 14:80543484-80543506 CTGAACAAAAAGTATTAAGAGGG + Intronic
1120888109 14:89467765-89467787 AGGAAGAAGAAGAATTAGCTGGG - Intronic
1125473137 15:40024136-40024158 CAGAACAAGAAATATTACCAGGG - Intronic
1126438481 15:48661671-48661693 AGAACCAACAAGAATTAACAAGG - Intergenic
1126544260 15:49855274-49855296 CTGACCAATAAGAATGAACATGG - Intergenic
1127176346 15:56362407-56362429 CAGAACAAGGAAAATTATCAGGG - Intronic
1127234310 15:57031811-57031833 AGGAAAAAGAAAAAATAACAAGG - Intronic
1128854477 15:70996825-70996847 TGGAAAAAGAAGAAATCACAAGG - Intronic
1129768945 15:78191137-78191159 TGGAACAAGAATTATTACCAGGG + Intronic
1130735394 15:86542783-86542805 CAGAACAAGAAGAATTATCTGGG - Intronic
1131171707 15:90183788-90183810 CGGAAAAAAAAAAATTAACAAGG + Intronic
1131328789 15:91476444-91476466 CAGAACAAGGAAAATTACCAGGG - Intergenic
1133338038 16:5019228-5019250 TGGAACAAGAAGAATTGTCTTGG - Intergenic
1134485712 16:14656732-14656754 AGGAACAAGTTGAATAAACAAGG + Intronic
1135026150 16:19000719-19000741 TGGAACAAAAATAATTTACAGGG - Intronic
1139988306 16:70918690-70918712 CGCAAAAAGAAAAATTAACATGG - Intronic
1141200406 16:81893376-81893398 CTGCAGAAGATGAATTAACAAGG - Intronic
1143448774 17:7023507-7023529 ATGAACAAGAAGAATTAGGAGGG + Intronic
1143665711 17:8358281-8358303 CAAAAAAAGAAGAATTGACAAGG - Intergenic
1146579311 17:34022751-34022773 TGTAAAAAGAAGAGTTAACAAGG - Intronic
1146975059 17:37104059-37104081 TGGAAGAAGAAGAATTATCTTGG + Intronic
1147354505 17:39883661-39883683 CTGAACAAGGAAAATTATCAGGG - Intergenic
1147493757 17:40896134-40896156 CGGCAGAAGAAGTACTAACAAGG - Intergenic
1149970974 17:61218074-61218096 CAGAACAAGAAGAACTGAGATGG + Intronic
1150601509 17:66654835-66654857 TGGAAAATGAAGAATTAAAATGG + Intronic
1156272585 18:35550339-35550361 CAGAACAAGAAGTATTATCAGGG + Intergenic
1158290522 18:55935964-55935986 CAGAGCAAGAAGCATTAACTAGG + Intergenic
1159146403 18:64459359-64459381 CAGAACAAGAAAAATTATAAAGG + Intergenic
1159502371 18:69290043-69290065 AGGAAGATGAAGAATTAATAGGG - Intergenic
1161802140 19:6422187-6422209 CGGAACAAGAAGAATTAACAAGG + Intronic
1163965335 19:20741455-20741477 CTGAAGAAGGAGAAATAACATGG - Intronic
925674694 2:6349741-6349763 TGGAACAAGAAGAAATTTCAAGG - Intergenic
925683474 2:6447588-6447610 GGGATTAAGAGGAATTAACATGG - Intergenic
926863167 2:17330310-17330332 TGGAAGAAGAAGAATTATCTTGG + Intergenic
927524898 2:23729778-23729800 CTGAACAAGGACAATTACCAGGG + Intergenic
927648132 2:24892761-24892783 TGGAACAAGAAATATTATCAGGG - Intronic
928125573 2:28613222-28613244 GGGAACAAGAAGAAAAAACCAGG - Intronic
929708840 2:44245553-44245575 CAGAACAGGAAGAATAATCAGGG - Intergenic
930361942 2:50391750-50391772 CAGAAGAATAAGAATTAAAATGG + Intronic
931210161 2:60185935-60185957 CAGAACAAGGAAAATTATCAGGG + Intergenic
932271658 2:70415576-70415598 TGGAGCAAGAAGCATTAAAATGG + Intergenic
933529762 2:83492467-83492489 TAGAACAAGAAAAATTAGCATGG + Intergenic
934026140 2:88003111-88003133 CGCAGCAAGAAGAATCACCAGGG - Intergenic
936990550 2:118360461-118360483 GGGTACAAGAAGAAATAGCAAGG - Intergenic
940405772 2:153300207-153300229 AGGTGCAATAAGAATTAACATGG + Intergenic
941526839 2:166616650-166616672 TGGAACAAGAAAAATTACCTAGG - Intergenic
941622579 2:167795020-167795042 CTGAACAAGAACAAATAACATGG + Intergenic
941952414 2:171169767-171169789 AAGAAAAAGAAGGATTAACAGGG + Intronic
941979440 2:171439078-171439100 GGGAACAATAAGAATTAATTTGG - Intronic
942974550 2:182000014-182000036 CAGGACAAGAAGAACTAAAATGG - Intronic
943017991 2:182537662-182537684 ATGAACAAGAAAAATTAAGAAGG + Intergenic
944745959 2:202656935-202656957 AAGAACAAGAAAAATTACCAGGG - Intronic
945537984 2:211043626-211043648 GGGAAGAGGAAGAATTGACAAGG - Intergenic
945757420 2:213865105-213865127 TGGAATTAGAAGAATTAACATGG + Intronic
946393381 2:219430054-219430076 CTGAACATCAAGAAGTAACAGGG + Intergenic
1169644584 20:7795678-7795700 TGCTACAAGAAAAATTAACAGGG + Intergenic
1169970912 20:11268657-11268679 TGGAAGAAGAAGAATTATCTTGG - Intergenic
1170731178 20:18976221-18976243 CAGAACAAGAACAATTGCCAGGG - Intergenic
1173577263 20:44120672-44120694 CAGAAGAAGAAGAATTGTCATGG + Intronic
1177086857 21:16716323-16716345 AGAAATAAAAAGAATTAACAAGG - Intergenic
1178482757 21:32993896-32993918 AGTACCAAGAAGAATTAAAAAGG + Intergenic
1178945545 21:36944084-36944106 AGGAACCAAAAGAATTAAAATGG - Intronic
1179071055 21:38071360-38071382 CGGAACAAGCAGATTTTAGATGG + Intronic
1179775884 21:43661770-43661792 CGGAACATGAAGCAGTTACACGG - Intronic
1180519312 22:16181437-16181459 CTGAACAAAAAGAATAAACCTGG - Intergenic
1180661670 22:17472949-17472971 GGGAACAAGCAGAAGAAACAGGG - Intronic
1181016706 22:20074133-20074155 CAGAACAAGAATAAATTACATGG - Intergenic
1182489102 22:30658236-30658258 CTGAAAAAGAAATATTAACAAGG + Intronic
1183159904 22:36105743-36105765 AGGAAAAAGAAGAATTCACCAGG - Intergenic
1183965966 22:41442956-41442978 GGGAGCAAGAAGAATAAAAATGG + Intronic
1183981848 22:41545246-41545268 CGGAAGAAGAAGAAAGAAGAAGG + Intergenic
949243508 3:1898326-1898348 GTGAACAAGATGAATTAAAATGG + Intergenic
949581300 3:5391059-5391081 CTGAACCAGATCAATTAACACGG - Intergenic
950960679 3:17103071-17103093 CAGAACAATAACAAGTAACAAGG + Intergenic
951073469 3:18361028-18361050 CAGAACAAGATGAATTAGCAGGG + Intronic
951352721 3:21626274-21626296 AGGAAGAAAAGGAATTAACATGG + Intronic
951738434 3:25893800-25893822 GGGAACAAGGAGATTTACCAGGG - Intergenic
952076704 3:29705558-29705580 CACAACAAGAAGAATAAACCTGG - Intronic
952510748 3:34052560-34052582 GGGGACAAGAAGAACTTACAAGG - Intergenic
954553714 3:51502621-51502643 GGGAGCAAGAAGCATTAAGAAGG + Intergenic
955123330 3:56083873-56083895 CCGAACAAGAAGAGTTAAAAGGG + Intronic
956690013 3:71867835-71867857 CAGAGCAAAAAAAATTAACACGG + Intergenic
958813237 3:98887522-98887544 CAGAACAAGGAAAATTACCAGGG - Intronic
958994261 3:100884166-100884188 TGGGAAAAGAAGCATTAACAAGG - Intronic
959219015 3:103491318-103491340 AGAAACAGGAAGAATTAACTGGG + Intergenic
962507926 3:136067258-136067280 CTGACCAAGAAGGACTAACAGGG + Intronic
964505316 3:157392554-157392576 CGGAAGAAGAAGAATTGTCTTGG + Intronic
965883910 3:173420727-173420749 CGGAAGAAGAAGAATTGTCTTGG - Intronic
965907693 3:173729323-173729345 AGGAACAAGAAGTATTATCTGGG - Intronic
969195120 4:5555532-5555554 CAGAACAAGGAAATTTAACAAGG + Intronic
970018585 4:11540673-11540695 TGGAAGAAGAAGAATTATCTTGG + Intergenic
971879537 4:32352165-32352187 TGGAACAAGAGGAATTATCTTGG + Intergenic
972541195 4:40040864-40040886 TGGAGCAAGAAGAATTAGCTCGG + Intergenic
973597847 4:52510975-52510997 TGGAAGAAGAAGAATTATCTTGG - Intergenic
977251757 4:94696079-94696101 CAGAAAAAGAAGAAATAACTTGG - Intergenic
977274989 4:94966196-94966218 CAGAACAAGAAAAATTACCAGGG - Intronic
977737796 4:100438435-100438457 CGCAAAAGGAAAAATTAACATGG - Intronic
982286240 4:153738501-153738523 CAGAACAAGGAAAATTATCAGGG - Intronic
984074503 4:175158037-175158059 TGGATCAAGAAGAAATTACAAGG - Intergenic
984144761 4:176046723-176046745 TGGAAGAAGAAGAATTATCTTGG - Intergenic
985465731 4:190193416-190193438 CCGAAAAAAAAGAACTAACATGG + Intergenic
987472344 5:18348247-18348269 CAGAGCAAGAAAAATTATCAGGG - Intergenic
989997160 5:50849474-50849496 CTCAACAAGAAAAATTAACAAGG - Intergenic
990221435 5:53594295-53594317 CAGAACAAGAAAAATTATCAGGG - Intronic
990324445 5:54661084-54661106 TGGAAGAAGAAGAATTGTCATGG - Intergenic
991336442 5:65553298-65553320 TGGAAGAAGAAGAATTATCTTGG + Intronic
993437144 5:87911858-87911880 GGGATCAAGAAGAATTAAAATGG + Intergenic
994809350 5:104493421-104493443 GGTACCAAGAAAAATTAACAGGG - Intergenic
995552569 5:113295293-113295315 CGGAACATTAAGATTTTACAAGG + Intronic
995980089 5:118091117-118091139 CAGAACAAGTAAAATTATCAGGG + Intergenic
996221265 5:120935954-120935976 GAGAACAGGAAGAATTAAAAAGG - Intergenic
996436972 5:123444934-123444956 CTGCAGAAGAAGAATTTACAAGG + Intergenic
996622673 5:125527816-125527838 CGGAAAAAGAAAAAGTAAAATGG - Intergenic
998618448 5:143767698-143767720 AGGAAGAAGAAGAATTATCTTGG - Intergenic
1000356683 5:160403180-160403202 GGCAGCAAGAAGAATAAACAAGG + Exonic
1000758684 5:165193574-165193596 CGGTTTAAGAAGGATTAACAAGG + Intergenic
1003144755 6:3500413-3500435 TGGAACAAGGAGAATTATCTTGG + Intergenic
1004053545 6:12112543-12112565 AGGAAAAGGAAGAATAAACAGGG - Intronic
1004496650 6:16170110-16170132 TGGAAGAAGAAGAATTATCTTGG - Intergenic
1005670755 6:28104330-28104352 CAGAACAAGAATTAATAACATGG + Intergenic
1005758251 6:28944662-28944684 TGGATCAAGAAGAAGTAAAATGG - Intergenic
1007998112 6:46330139-46330161 AGGTGCAAGAATAATTAACAAGG + Intronic
1010081001 6:71862417-71862439 CAGAACAAGAAAAATTATCAAGG - Intergenic
1012705970 6:102530938-102530960 ATGAACTGGAAGAATTAACATGG - Intergenic
1013568304 6:111392875-111392897 GGGAACAAGATGAAATACCAAGG - Exonic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1015667673 6:135649514-135649536 CGGAACAAGGAAAGTTATCAGGG - Intergenic
1016578064 6:145593179-145593201 CAGAACAAGAAAAATTTTCAAGG + Intronic
1018150875 6:160937429-160937451 CAGCAAAAGAAGTATTAACAGGG - Intergenic
1019141375 6:169946769-169946791 CAGAACAAGGAAAATTATCAGGG + Intergenic
1021778505 7:24078255-24078277 CAGATCAAGAAGAAATAAAAAGG + Intergenic
1025640298 7:63360956-63360978 CTGAACAAGAAGAGTCCACAGGG + Intergenic
1025642401 7:63387137-63387159 CTGAACAAGAAGAGTCCACAGGG - Intergenic
1027684019 7:81258795-81258817 CAGAACAAGAAATATTATCATGG - Intergenic
1028053793 7:86218846-86218868 CTGTACAAAAAGAAATAACAGGG - Intergenic
1028753525 7:94409478-94409500 GGGAAGAAGAAGAATGAAGATGG + Intronic
1030492364 7:110254056-110254078 TGGAAGAAGAAGAATTGTCATGG - Intergenic
1031096801 7:117429724-117429746 CTGAAAAAGAAGAATAAAGAAGG + Intergenic
1031177154 7:118368238-118368260 CTGATCAAGATGAACTAACAGGG + Intergenic
1035842555 8:2828099-2828121 TGGAAGAAGAAGAATTCACTGGG + Intergenic
1036975992 8:13413321-13413343 TGGAAGAAGAAGAATTATCTTGG - Intronic
1039698322 8:39936484-39936506 CAGAAAAAGAAAAATTAATAGGG + Intronic
1042951927 8:74209404-74209426 CGGAAGAAGAAGAATTGTCTTGG - Intergenic
1045005393 8:97912905-97912927 AGGAAGAAAAAGATTTAACACGG + Intronic
1046279939 8:112014159-112014181 CAGAACAAGAAAGATTATCAAGG + Intergenic
1046685084 8:117215874-117215896 GGGACCAAGAAGAAATATCAAGG - Intergenic
1049062493 8:140286868-140286890 TGGAAGAGGAAGAGTTAACAGGG + Intronic
1050455402 9:5830241-5830263 TGGAAGAAGAAGAATTGTCATGG - Intronic
1052768752 9:32668381-32668403 TGGAAGAAGAAGAATTATCTTGG + Intergenic
1054926710 9:70596923-70596945 AAGAAAAAGAAAAATTAACAGGG - Intronic
1056287191 9:85101407-85101429 AGCAACATGAAGAATTATCATGG - Intergenic
1056888891 9:90470837-90470859 TAGAACAAGAAGGACTAACAGGG - Intergenic
1058003609 9:99892597-99892619 CAGAACAAGGAAAATTATCAGGG - Intergenic
1059478798 9:114571726-114571748 CGGAAGAAGAAGAATTGTCTTGG + Intergenic
1061966545 9:134017644-134017666 TGGAAGAAGAAGAATTATCTTGG - Intergenic
1186741707 X:12525018-12525040 TGGAAGAAGAAGAATTATCTTGG - Intronic
1189173057 X:38927667-38927689 TGGAACAAGAAAAATTAGGAGGG - Intergenic
1189671305 X:43413088-43413110 CAGAACAAGGAAAATTATCATGG - Intergenic
1189873402 X:45407739-45407761 AGGAACAAGAAAAATTACAAAGG - Intergenic
1190487661 X:50943924-50943946 TGGATCAAGAAGAAATCACAAGG - Intergenic
1190518510 X:51250700-51250722 AGAGACAAGAAGTATTAACATGG + Intergenic
1192046276 X:67677191-67677213 TGGAATAAAAAGAATCAACAGGG - Intronic
1193035229 X:76942921-76942943 CAGAACAAGGAAAATTAACAAGG - Intergenic
1193216777 X:78874257-78874279 CCTACCAAGAAGAATTAAAATGG + Intergenic
1193440454 X:81534788-81534810 TGCAACATGAAGAAGTAACAAGG - Intergenic
1193586790 X:83332100-83332122 TGGAACAAGAAGACACAACATGG - Intergenic
1193867692 X:86756179-86756201 CTGAGCAAAAAGAATGAACATGG - Intronic
1193967009 X:88000163-88000185 TGGATCAAGAAGAAGTCACAAGG - Intergenic
1194311411 X:92312834-92312856 CTGAATGAGAAGAATTAACCAGG + Intronic
1195452927 X:105035553-105035575 GGGAATAAAAAAAATTAACATGG + Intronic
1195489081 X:105445063-105445085 CAGACCAAGAATAAGTAACAAGG - Intronic
1195897826 X:109765858-109765880 CAGAGCAAGAAAAATTATCAGGG + Intergenic
1196998502 X:121411014-121411036 AAGAATTAGAAGAATTAACATGG - Intergenic
1198143419 X:133829780-133829802 CAGAGCAAAAAGAATTATCAGGG + Intronic
1198260661 X:134961998-134962020 CAGAACAGGAAGAATTCAGATGG + Intergenic
1198803284 X:140469309-140469331 AGGAAAAAGAAAAATTAACTGGG + Intergenic
1199040819 X:143113023-143113045 CAGAAAAAGCAGTATTAACATGG - Intergenic
1200619686 Y:5427055-5427077 CTGAATGAGAAGAATTAACCAGG + Intronic