ID: 1161802745

View in Genome Browser
Species Human (GRCh38)
Location 19:6424861-6424883
Sequence GTCGTCCGTCACGTCGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 14
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 12}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161802745_1161802753 -3 Left 1161802745 19:6424861-6424883 CCGCCGCCGACGTGACGGACGAC 0: 1
1: 0
2: 0
3: 1
4: 12
Right 1161802753 19:6424881-6424903 GACTCCGGCGGGCCAATGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 57
1161802745_1161802756 14 Left 1161802745 19:6424861-6424883 CCGCCGCCGACGTGACGGACGAC 0: 1
1: 0
2: 0
3: 1
4: 12
Right 1161802756 19:6424898-6424920 GGGAGGCAGCCGCCGCACCCCGG 0: 1
1: 0
2: 3
3: 38
4: 384
1161802745_1161802752 -6 Left 1161802745 19:6424861-6424883 CCGCCGCCGACGTGACGGACGAC 0: 1
1: 0
2: 0
3: 1
4: 12
Right 1161802752 19:6424878-6424900 GACGACTCCGGCGGGCCAATGGG 0: 1
1: 0
2: 0
3: 0
4: 18
1161802745_1161802751 -7 Left 1161802745 19:6424861-6424883 CCGCCGCCGACGTGACGGACGAC 0: 1
1: 0
2: 0
3: 1
4: 12
Right 1161802751 19:6424877-6424899 GGACGACTCCGGCGGGCCAATGG 0: 1
1: 0
2: 0
3: 2
4: 27

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161802745 Original CRISPR GTCGTCCGTCACGTCGGCGG CGG (reversed) Intergenic
904641983 1:31938048-31938070 CTCCTCAGTCACCTCGGCGGCGG + Exonic
905819699 1:40979915-40979937 GACGTCCGTCACCGCGGCGGCGG - Intronic
1078246152 11:9574299-9574321 GTCGCCGGTCAAGTCGCCGGCGG + Exonic
1160991903 19:1863547-1863569 GGCGTCCGTCCGGCCGGCGGCGG + Exonic
1161802745 19:6424861-6424883 GTCGTCCGTCACGTCGGCGGCGG - Intergenic
929189284 2:39124380-39124402 CTCGTGCGTCACGTCCGCCGTGG - Intergenic
934943572 2:98520110-98520132 GTCGGCCGCCACGTCGATGGTGG - Exonic
948610653 2:239164372-239164394 GCCGGCCGTCATGTCGGCGCAGG - Intronic
1182532287 22:30969582-30969604 GTCGTCCGGGTGGTCGGCGGCGG + Intergenic
954717571 3:52534016-52534038 TTCGGCCGTCACGCCGGCGATGG + Intronic
992249910 5:74866367-74866389 CTAGTGCGTCACGTCGTCGGAGG - Intronic
1022299698 7:29091504-29091526 GCCGTCCGTTACGTCTGTGGAGG + Intronic
1025226921 7:57173610-57173632 CTCTTCCTACACGTCGGCGGAGG + Intergenic
1039881726 8:41629377-41629399 GTCTCCCGTCACGTCAGCGCAGG - Intergenic