ID: 1161805570

View in Genome Browser
Species Human (GRCh38)
Location 19:6441346-6441368
Sequence CAGCTGAGCTTGGAGATCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 213}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161805565_1161805570 11 Left 1161805565 19:6441312-6441334 CCAGTGGTGAGGTTTGTTGACAT 0: 1
1: 0
2: 1
3: 13
4: 92
Right 1161805570 19:6441346-6441368 CAGCTGAGCTTGGAGATCCAGGG 0: 1
1: 0
2: 0
3: 14
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161805570 Original CRISPR CAGCTGAGCTTGGAGATCCA GGG Exonic
901348483 1:8569014-8569036 CAGCAGATTTTGGAGGTCCAAGG - Intronic
903142080 1:21345021-21345043 CAGCTTGGCTTGGAGACCCAGGG - Intronic
903328651 1:22585859-22585881 CAGCTGAGTTAGAAGAGCCAGGG - Intronic
904959806 1:34323415-34323437 CTCCTGTGCTTGGACATCCAAGG - Intergenic
905241329 1:36583377-36583399 CAGCTAAGCTAGGGAATCCAGGG - Intergenic
905934326 1:41811669-41811691 CCACTGAGCTTGGAGCACCACGG + Intronic
906647911 1:47489349-47489371 AAGCTGATGTTGTAGATCCATGG + Intergenic
906665508 1:47618591-47618613 CAGCTGAGCCCTGAAATCCAGGG + Intergenic
908503349 1:64768046-64768068 AACCTGAGCTTAGAGATCCCTGG - Intronic
911367574 1:96956876-96956898 CCACTGGGCATGGAGATCCAAGG - Intergenic
912558711 1:110534951-110534973 GAGCTGAGGTTTGAGACCCAGGG + Intergenic
916656215 1:166877622-166877644 CAGCAGAGCGTGGGGAGCCATGG - Intergenic
916993234 1:170267506-170267528 CAGCACAGCTTGCAGCTCCAGGG - Intergenic
917968413 1:180192743-180192765 CAGTTGAGTCTGGAGTTCCAGGG + Intronic
918531250 1:185524707-185524729 CACCTCAGCTTGGACTTCCATGG + Intergenic
920237030 1:204514797-204514819 CTGCATAGCTGGGAGATCCAGGG - Intergenic
1063593479 10:7412475-7412497 CTGCCGAGCTGAGAGATCCAGGG + Intergenic
1064577848 10:16763854-16763876 CAGCTGAGGTTGCAGAACCAGGG - Intronic
1067012349 10:42726491-42726513 CAACTGAGGTTGCAGAACCAGGG + Intergenic
1067807133 10:49400571-49400593 AAGCTGAGCTCTGAGATCCCTGG - Intergenic
1071929965 10:90458027-90458049 CAATTGACCTTGGAGGTCCATGG - Intergenic
1072167887 10:92831278-92831300 CGGCTCAGCCTGGAGATTCAAGG - Intergenic
1072455366 10:95570891-95570913 AAACTGAGGTTTGAGATCCAAGG - Intergenic
1072536384 10:96367266-96367288 CACCTGTGCTTGGAATTCCATGG - Exonic
1074258732 10:111830509-111830531 CAGCTGAGCTGGTGCATCCAAGG + Intergenic
1075420186 10:122294873-122294895 TAGCTGGGCTTGGAGTTGCAGGG - Intronic
1076271013 10:129152302-129152324 CAGCTCAACTTGGAAAACCAGGG + Intergenic
1077472228 11:2769447-2769469 CAGGTGAGGCTGGAGCTCCAGGG + Intronic
1078416828 11:11172917-11172939 CAAGTGAGCTTGGAAAGCCAGGG - Intergenic
1080412493 11:32038873-32038895 GAGCTGAGCTTGGAGAAGCTGGG - Intronic
1083203564 11:61134128-61134150 GAGCGGAACTTGGAGTTCCAGGG - Exonic
1083278442 11:61610880-61610902 GAGTTGAGGTTGGAGATCCCAGG + Intergenic
1083336310 11:61923806-61923828 AATCTGAGCTCAGAGATCCAGGG - Intergenic
1086948249 11:92865745-92865767 CAGTTGAGCCTGGGGCTCCATGG + Intronic
1088735766 11:112726571-112726593 CTGCTGAGCTTTGGAATCCATGG + Intergenic
1089902677 11:122004308-122004330 CAGCTGTGGTTGGAGATCATAGG + Intergenic
1092522675 12:9290211-9290233 AAGCTGAGCTAGGAGAGCCCTGG - Intergenic
1092544610 12:9441686-9441708 AAGCTGAGCTAGGAGAACCCTGG + Intergenic
1093234640 12:16591785-16591807 AAGCTGAGCTTTGAGCTTCACGG - Intronic
1094508343 12:31080384-31080406 AAGCTGAGCTAGGAGAGCCCTGG - Intronic
1095803590 12:46294121-46294143 CAGCTGAGCCTGGAAAGTCAAGG - Intergenic
1096524765 12:52203876-52203898 CAGCTGACCTTGGGGAGCGAGGG + Intergenic
1097026757 12:56062161-56062183 CACCTGAGCTTGGGAATTCAAGG - Intergenic
1097297967 12:57987626-57987648 CAGCTGTGTTTGGATATGCAAGG + Intergenic
1100607989 12:96167530-96167552 AAACAGAGCTTGGAGAGCCAGGG - Intergenic
1102192475 12:110999112-110999134 CAGCTGGTCTGGGAGATCCCAGG - Intergenic
1102306556 12:111809078-111809100 GAGATGGGCTTGGAGCTCCAGGG + Intronic
1104548768 12:129736541-129736563 CAGCTGAACGTGGAGCTACAAGG + Intronic
1106506529 13:30375585-30375607 CTGCTGAGGCTGGAGAACCACGG + Intergenic
1109853466 13:68099676-68099698 CAGCTGAGTGAGGAGATACAAGG + Intergenic
1110292724 13:73825838-73825860 TAGCTGAGATCTGAGATCCAGGG + Intronic
1110425545 13:75362384-75362406 CAGCAGCGCCTGAAGATCCAAGG - Exonic
1112143506 13:96672475-96672497 CAGCTGAGGTTGGAGATGGAGGG - Intronic
1113705575 13:112430616-112430638 CGGCTGAGCTGGGAGAACCCAGG - Intronic
1114422790 14:22598508-22598530 CGGCTGAGCCTGGGGAGCCATGG + Intronic
1114460897 14:22885578-22885600 CAGCCTAGCTTGGAGCTGCAGGG - Intronic
1116235571 14:42275005-42275027 CAGCTGCTCTTAGAGATCAATGG + Intergenic
1118988974 14:70780953-70780975 TAGCAGAGCTTGGGGATACAAGG - Intronic
1119332669 14:73806728-73806750 CAGCTGGGCTTAGAGATGCTGGG + Intergenic
1121132532 14:91461428-91461450 CAGGAGAGCCTGGAGATCCTGGG + Exonic
1121409487 14:93739655-93739677 CAGCTGGATTAGGAGATCCAGGG + Intronic
1121454844 14:94031562-94031584 CAGCTGAGATTAAAGAGCCAGGG - Intronic
1121496984 14:94399393-94399415 ATGCTGAGCTTGAAGATGCAGGG - Intergenic
1123879070 15:24657663-24657685 CACCTGAGCTTGGAAAGTCAAGG - Intergenic
1123988734 15:25667868-25667890 CAGACGACCTTGGGGATCCACGG + Intergenic
1125370441 15:38970805-38970827 CAGCTCTGGTTGGAGTTCCATGG + Intergenic
1125972324 15:43921864-43921886 CAGGAGAGCTTGCAGATGCATGG + Intronic
1130014681 15:80177371-80177393 CATCAGAGCTGGGAGGTCCAGGG - Intronic
1132036216 15:98487033-98487055 CAGCAGGGCTTGGAGATGCCTGG - Intronic
1132237474 15:100232911-100232933 CAGTGGACCTTGGAGATTCACGG - Intronic
1135258899 16:20964269-20964291 GAGTTGATCTTGGAGACCCAAGG + Exonic
1135522410 16:23187563-23187585 CATGTGAGCTCGGAGAGCCAGGG - Intronic
1135673614 16:24395414-24395436 CAGATGAGATCTGAGATCCAAGG + Intergenic
1136104354 16:28018860-28018882 CAGCTGGGCTTGGGGATCAAAGG - Intronic
1138676805 16:58657250-58657272 CACCTGAGCTTGGAAAGTCAAGG - Intergenic
1139040190 16:62990840-62990862 CAGCTGAGCACAGAGGTCCATGG - Intergenic
1139275524 16:65724059-65724081 CAGCTGCTCTTTGAGTTCCATGG - Intergenic
1139314490 16:66056733-66056755 CACATGAGTTTGGAGGTCCATGG - Intergenic
1139847918 16:69933622-69933644 CAACTGAGCATGGTGACCCAGGG + Intronic
1141833682 16:86524214-86524236 CAGCTGAGGGTGCAGAGCCATGG + Intergenic
1142432856 16:90039931-90039953 CAGGTGAGATTTGAGATCCAGGG - Intronic
1142623873 17:1180311-1180333 AAGCCGCGCTTGGAGATCCCGGG - Intronic
1142722466 17:1785831-1785853 AAGCTAAACTTGGAGACCCAAGG - Intronic
1142781164 17:2182328-2182350 CTGCACAGCTTGGAGCTCCAAGG + Intronic
1143256078 17:5559007-5559029 TGGCTGAGCTTGGAGAGCCTGGG + Exonic
1143585748 17:7849355-7849377 CTGCAGAGCGAGGAGATCCAGGG + Exonic
1145884261 17:28371688-28371710 CGGCTGAGCTGGGAGATGCTCGG - Exonic
1147263786 17:39223494-39223516 GGTCTGAGCTTGGAGATTCAAGG - Intronic
1147664704 17:42139161-42139183 AAGCTGTGCTAGCAGATCCATGG - Intronic
1149987282 17:61356908-61356930 CAGGTGAGCCTGCAGCTCCATGG - Intronic
1151435193 17:74091106-74091128 CAGCAGAGCCTCAAGATCCAGGG - Intergenic
1152097903 17:78282707-78282729 CAGATGGGCTTGGAGGTCCATGG + Intergenic
1153679773 18:7489648-7489670 CACCTGAGCCTGGAGGTCAAGGG + Intergenic
1154024549 18:10695322-10695344 GAGCAGAGCTTGGAGATGCCAGG + Intronic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1160537063 18:79600351-79600373 CGGCTGAGGTGGGAGATCCCTGG + Intergenic
1160873146 19:1286028-1286050 CGGCGGCGCTTGGAGATCCCGGG - Intergenic
1160967648 19:1753666-1753688 GAGCTGAGCCTGGAGAGCCTGGG + Exonic
1161201801 19:3019335-3019357 CAGCTGAGCCTGGGCAGCCAGGG + Exonic
1161805570 19:6441346-6441368 CAGCTGAGCTTGGAGATCCAGGG + Exonic
1162283503 19:9719572-9719594 CAGGTGTGCTGGGAAATCCAGGG - Intergenic
1164072460 19:21780692-21780714 CAGCAGGGCTGGGAGCTCCATGG + Intergenic
1164116389 19:22223288-22223310 CAAAAGAGCTTTGAGATCCAGGG - Intergenic
1164279034 19:23752071-23752093 TAGGAGAGCTTTGAGATCCAGGG + Intronic
1164365228 19:27573149-27573171 TAGGTGAGCTTTGAGGTCCATGG + Intergenic
1164752219 19:30665482-30665504 CAGCTCAGTTGAGAGATCCATGG + Intronic
1165148913 19:33749752-33749774 CTGCTGAGCCAGGAGACCCAGGG + Intronic
1165756170 19:38294342-38294364 CAGCTGAGCTTCAAGGGCCACGG - Intronic
1165829016 19:38721352-38721374 CAGTTGGGCTTAGAGATCCCTGG + Intronic
1166883690 19:45944969-45944991 GAGCTGAGGTGGGAGATCGAGGG + Intronic
1167623696 19:50572832-50572854 CAGCTGAGCGTGGTGGCCCATGG - Intergenic
926785777 2:16517198-16517220 CAGATGAGCTTGCACATCCTGGG - Intergenic
931125678 2:59273920-59273942 CAGCTGAGCTTGGAGTTTAAGGG - Intergenic
933430184 2:82166897-82166919 CAGCTGAGCTTTAATATTCAGGG + Intergenic
935134120 2:100284421-100284443 CAGCTGAGCCTTGCGCTCCAGGG + Exonic
935756774 2:106282570-106282592 CAGCTGGGCTTTGCGATCCCTGG + Intergenic
936112794 2:109678455-109678477 CAGCTGGGCTTTGCGATCCCTGG - Intergenic
936513847 2:113169274-113169296 CATCTGAGCTTGGAGAGAGAAGG - Intronic
936597110 2:113858578-113858600 CAGCTGAGCTGGGAGAACTGGGG - Intergenic
937534427 2:122868200-122868222 CAGCTGAACTTCAAGATCCTTGG + Intergenic
938664566 2:133521163-133521185 CAGCAGAGACTGCAGATCCAGGG + Intronic
938712342 2:133986182-133986204 CAGCAGAGCTAGGAGAGGCAAGG - Intergenic
940358884 2:152776049-152776071 TACCTGAGCCTTGAGATCCAGGG - Intergenic
940533434 2:154908259-154908281 CATCTGAACTTGGAGACCTAAGG - Intergenic
942715416 2:178886147-178886169 CTGCTGACCTGGGAGAACCAGGG + Intronic
944294445 2:198046753-198046775 CATCTGAGCTTGGAAAGTCAAGG + Intronic
1173181959 20:40812563-40812585 CAGCTGAGCCAGGACATCCTTGG + Intergenic
1173209595 20:41021873-41021895 CAGATTAGCTCGGAGGTCCAGGG - Intergenic
1174339133 20:49885051-49885073 CAGCTGAGCATGGAGATTGGAGG - Intronic
1175632759 20:60556106-60556128 GGGCTGAGCTTGGGGACCCAGGG + Intergenic
1175936930 20:62518251-62518273 CAGCTGTACTTGGGGAGCCATGG + Intergenic
1176884817 21:14243066-14243088 AAGCTAAACTGGGAGATCCACGG - Intergenic
1177523031 21:22254766-22254788 CAGCTGAGAATGTGGATCCATGG + Intergenic
1179562788 21:42227095-42227117 CAACTGGGCTTGCAGATCCCAGG - Intronic
1180626504 22:17197343-17197365 CACCTGAGCCTGGAAATTCAAGG - Intronic
1181916213 22:26282488-26282510 CAGGTCAGACTGGAGATCCATGG - Intronic
952203046 3:31151160-31151182 CAGCTGATTATGGAGTTCCAGGG - Intergenic
953727438 3:45412661-45412683 CATCTCAGCCTGGAAATCCAAGG + Intronic
953885104 3:46710551-46710573 CAGCTGTGCTGGGAGGTCCCAGG + Exonic
954914726 3:54139045-54139067 CTGCTGAGCTTGGGGATCTGGGG + Intronic
955066327 3:55536399-55536421 CAGCTGGGCTGTGAGCTCCATGG + Intronic
956043874 3:65174691-65174713 AACCTGAGCTTGGAGATGGAGGG - Intergenic
958657594 3:97022148-97022170 CACCTGAGCTTTATGATCCATGG + Intronic
959744344 3:109759255-109759277 CAGCTGAGATTGGAGAATGATGG - Intergenic
959841692 3:110983930-110983952 CAGTTCAGCTTGCAGCTCCAAGG + Intergenic
961641657 3:128368574-128368596 CAGCTGAGCTACCACATCCAGGG - Intronic
961741251 3:129034332-129034354 CAGCAGAGCCTAGAGATCAAAGG + Intronic
962264642 3:133936189-133936211 CAGCTCAGAGTGGAGATACACGG + Intronic
962505769 3:136045265-136045287 CAGCTGTGCTGGGTGAGCCAAGG - Intronic
963243212 3:143031896-143031918 GAGCTGAGTTTGCAGATCCTAGG - Intronic
964443031 3:156731593-156731615 CAGCTGAGCTTGGAAATCACTGG - Intergenic
964569629 3:158097540-158097562 AAGCTGAAATTGGAGAACCAAGG - Exonic
965486482 3:169284522-169284544 CAGCATTGCTTGGAGATTCAGGG - Intronic
968264145 3:197349680-197349702 CAGGTGAGCTGTGAGACCCAGGG - Intergenic
969106508 4:4810771-4810793 CAGCTGGGATTGGGGATGCAAGG + Intergenic
969728409 4:8939324-8939346 CAGCTGAGCTTTGGGGACCAGGG - Intergenic
970329643 4:14966352-14966374 CATCTGCGCTTGGAGAGTCAAGG - Intergenic
972740126 4:41880581-41880603 CTGCTCCGCTTGGAGATCAAAGG - Intergenic
975919782 4:79371331-79371353 AAGCTGGGCTAGAAGATCCAAGG - Intergenic
976324347 4:83753533-83753555 CAGTTCAGCTAGAAGATCCAGGG - Intergenic
976780617 4:88754576-88754598 CAGCTGAGCTAGGAGGTACTTGG + Intronic
978366850 4:107991183-107991205 CAGCTCACATTGGAGAACCATGG + Intronic
980082438 4:128358214-128358236 CAGATGACCTTGGAGAGCCAGGG + Intergenic
983761191 4:171408476-171408498 CAGCTGAACTAACAGATCCATGG + Intergenic
986199711 5:5569982-5570004 CAGCTGTGCTTGGGGCCCCAGGG - Intergenic
986622685 5:9691998-9692020 CAGCTGAGAATGGAACTCCATGG - Intronic
988158452 5:27486612-27486634 CAGCTGGGCTTGGGAAGCCAGGG - Intergenic
990540924 5:56771710-56771732 CAGCTGATCCTGGGGATCCCGGG - Intergenic
996377902 5:122834015-122834037 CAACTAAACTAGGAGATCCAGGG + Intergenic
997233216 5:132258242-132258264 CGGCAGAGCTTGGTGACCCAGGG + Intronic
998006279 5:138659219-138659241 CAGCTGGGCTTGAAGATGCCAGG + Intronic
998104964 5:139462627-139462649 CAGCTGTGCTGGGTGATCCTGGG - Exonic
998793607 5:145793227-145793249 GACCTCAGCTTGGGGATCCATGG + Intronic
1001202992 5:169736337-169736359 CAGGTGAGCTTTAAAATCCAGGG - Intronic
1001663206 5:173412143-173412165 CAGGTAAGCTTGGAGATGCCAGG - Intergenic
1002036630 5:176475798-176475820 CAGCCGAGCTGGGAAATCCGTGG - Intronic
1009615269 6:65997131-65997153 CAGCTTGGATTGGATATCCAAGG - Intergenic
1009783266 6:68297377-68297399 CTGCTGATTGTGGAGATCCAGGG + Intergenic
1009820823 6:68798853-68798875 CAGCTTTTCTGGGAGATCCACGG - Intronic
1010626415 6:78140616-78140638 CAGCACAGCTAGGAGATGCATGG - Intergenic
1011003698 6:82620375-82620397 TTGCTGACCTTGGAGATGCAGGG + Intergenic
1011596106 6:89018139-89018161 CAGCAGAAGTTGTAGATCCATGG - Intergenic
1014972372 6:127833485-127833507 AATCTGAGCTTTGACATCCAAGG + Intronic
1015457675 6:133446046-133446068 CAGCTGACCTTGTTGACCCAGGG - Intronic
1017274392 6:152549070-152549092 TGACTGAGCTTGAAGATCCAAGG - Intronic
1017958300 6:159198562-159198584 CAGCTGGACTTGGGGAGCCAAGG - Intronic
1020690813 7:11352736-11352758 AAGGTGAGCTTGGGGATTCAGGG + Intergenic
1021778409 7:24076596-24076618 CAGCAGACTTTGGAGATACAAGG - Intergenic
1024820168 7:53319198-53319220 CAACTGAGCCCGGAAATCCAAGG + Intergenic
1026175340 7:67991692-67991714 CAGCTGAGCATGGTGGTGCATGG - Intergenic
1026489130 7:70847720-70847742 CAGGTGTGCTGGGAGCTCCAGGG - Intergenic
1030173367 7:106627131-106627153 CACCTGAGCTTGGAAGTTCAAGG - Intergenic
1035290907 7:157837833-157837855 CAGCAGGGCTGTGAGATCCACGG - Intronic
1035373698 7:158394500-158394522 CAGGTGGGCTTGGACAGCCACGG - Intronic
1035758602 8:2052616-2052638 CAGCTGGGCTTAGAGCTCCAGGG + Intronic
1036152103 8:6308314-6308336 CAGCTGAGCTGTGAGGCCCATGG - Intergenic
1038849067 8:31256449-31256471 CAGCACAGGCTGGAGATCCAAGG + Intergenic
1039640700 8:39218392-39218414 CTGCTGATCGTGGAGCTCCAGGG - Intronic
1040676130 8:49752672-49752694 CAGCTGGTCTTGAACATCCAGGG - Intergenic
1041079476 8:54202669-54202691 CAGCTGAGCTTGGGGATGTTGGG + Intergenic
1044884021 8:96757067-96757089 CAGCTGAGCGTGGTGACTCATGG + Intronic
1044951693 8:97441612-97441634 ACGCTGAGCTTGAACATCCAAGG + Intergenic
1048164944 8:132054107-132054129 CGGCTGTGCTTGGAAGTCCAAGG + Intronic
1048228096 8:132610014-132610036 CAGCTGAGGTAGGAGAACAACGG - Intronic
1050640845 9:7666048-7666070 CAGCTGAGATTGGAGAGCAGGGG - Intergenic
1052033919 9:23659022-23659044 CAGCAGAGCTTGCAGATGCATGG + Intergenic
1055797572 9:79992034-79992056 CAGCTGGGCTTGAGGATCCAAGG + Intergenic
1056825524 9:89874008-89874030 CAGGTGAGCTGGGAGAGACAAGG - Intergenic
1057455022 9:95200204-95200226 CAGCTTTGCTCTGAGATCCAGGG - Intronic
1057482873 9:95459530-95459552 TTGCTGAGTTTGGAGAACCAGGG + Intronic
1057871969 9:98725254-98725276 CAGCTGGGTTTGGAGATCTCTGG - Intergenic
1060292950 9:122320835-122320857 CTGCTGAGCATGCAGATCCTTGG + Intronic
1060809651 9:126604193-126604215 CAGCGTAGCATGGAGAGCCAAGG + Intergenic
1061502366 9:131011365-131011387 CATCTGAGCGTGGACATCCATGG + Intronic
1061920397 9:133779385-133779407 GAGCTGGGCTGGGAGAGCCATGG - Intronic
1062285191 9:135769702-135769724 CAGCTCAGCGAGGAGTTCCAGGG - Intronic
1185623108 X:1465428-1465450 GGGCGCAGCTTGGAGATCCAGGG - Exonic
1186443843 X:9608824-9608846 CAGCTGAGGTGGGAGATCCCAGG + Intronic
1186983005 X:14978366-14978388 CAGCTGTGCTTGGAGGTAGAGGG - Intergenic
1188669704 X:32868259-32868281 CAGCTGTGTTTTGAGACCCAAGG - Intronic
1189482730 X:41405691-41405713 CAGCTGAGCCTGGTGAGCCCAGG - Intergenic
1192232089 X:69272384-69272406 CAGCTGAGCTTGAACACCCCAGG - Intergenic
1195890369 X:109687016-109687038 CAGCTGAACTGGAAGTTCCAAGG - Intronic
1195905786 X:109842952-109842974 CAGCTGAACCTGTAGATCAAAGG + Intergenic
1197874906 X:131092108-131092130 CAGCTGAGGTTGGAAATTCTTGG - Intergenic
1198126219 X:133646629-133646651 AAGCTGAGCTTGGAGTTGAAAGG + Intronic
1199587505 X:149431747-149431769 CAGCTGAGCTTGGTGATGATGGG + Intergenic
1201514383 Y:14802198-14802220 CACCTGTGCTTGGAGATACCTGG + Intronic