ID: 1161807977

View in Genome Browser
Species Human (GRCh38)
Location 19:6456093-6456115
Sequence CTGTGTGGGTGGAAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2303
Summary {0: 1, 1: 0, 2: 16, 3: 185, 4: 2101}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161807971_1161807977 -9 Left 1161807971 19:6456079-6456101 CCAGCAGAAGAGAGCTGTGTGGG 0: 1
1: 0
2: 3
3: 25
4: 263
Right 1161807977 19:6456093-6456115 CTGTGTGGGTGGAAGGTGGGAGG 0: 1
1: 0
2: 16
3: 185
4: 2101
1161807969_1161807977 -8 Left 1161807969 19:6456078-6456100 CCCAGCAGAAGAGAGCTGTGTGG 0: 1
1: 0
2: 4
3: 24
4: 214
Right 1161807977 19:6456093-6456115 CTGTGTGGGTGGAAGGTGGGAGG 0: 1
1: 0
2: 16
3: 185
4: 2101
1161807967_1161807977 20 Left 1161807967 19:6456050-6456072 CCGTAGAATCTTTTATCCAGGCA 0: 1
1: 0
2: 0
3: 9
4: 179
Right 1161807977 19:6456093-6456115 CTGTGTGGGTGGAAGGTGGGAGG 0: 1
1: 0
2: 16
3: 185
4: 2101
1161807968_1161807977 4 Left 1161807968 19:6456066-6456088 CCAGGCAGAGAACCCAGCAGAAG 0: 1
1: 0
2: 2
3: 41
4: 439
Right 1161807977 19:6456093-6456115 CTGTGTGGGTGGAAGGTGGGAGG 0: 1
1: 0
2: 16
3: 185
4: 2101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161807977 Original CRISPR CTGTGTGGGTGGAAGGTGGG AGG Intronic
Too many off-targets to display for this crispr