ID: 1161815207

View in Genome Browser
Species Human (GRCh38)
Location 19:6495629-6495651
Sequence GGTGAGCTCGGGCACCGTCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 3, 2: 0, 3: 16, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161815198_1161815207 30 Left 1161815198 19:6495576-6495598 CCGTGGCGCGGGTCGCACGCCGC 0: 1
1: 0
2: 3
3: 11
4: 48
Right 1161815207 19:6495629-6495651 GGTGAGCTCGGGCACCGTCAGGG 0: 1
1: 3
2: 0
3: 16
4: 85
1161815200_1161815207 11 Left 1161815200 19:6495595-6495617 CCGCCATCATGTTCTTGGCATCG 0: 1
1: 0
2: 0
3: 15
4: 188
Right 1161815207 19:6495629-6495651 GGTGAGCTCGGGCACCGTCAGGG 0: 1
1: 3
2: 0
3: 16
4: 85
1161815201_1161815207 8 Left 1161815201 19:6495598-6495620 CCATCATGTTCTTGGCATCGAAC 0: 3
1: 3
2: 16
3: 12
4: 90
Right 1161815207 19:6495629-6495651 GGTGAGCTCGGGCACCGTCAGGG 0: 1
1: 3
2: 0
3: 16
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161815207 Original CRISPR GGTGAGCTCGGGCACCGTCA GGG Exonic
900083106 1:873862-873884 GGTGAGCTCAGCCACAGTCAAGG - Intergenic
901078844 1:6572195-6572217 TGTGAGCTGGGGCACCTTCTAGG + Intronic
903499273 1:23792696-23792718 GGTGAGCAGGGGCACAGACATGG - Exonic
903743602 1:25572546-25572568 GGTGGGCTGGGGAACCATCAGGG - Intergenic
904767921 1:32864569-32864591 GGTCAGCTCGGGGACTGGCATGG - Intronic
922684382 1:227627855-227627877 GTTGAGCTCAGGATCCGTCAAGG + Intronic
923796693 1:237163840-237163862 GGTGAGCTAAGGGACCGCCAAGG + Intronic
924243293 1:242059801-242059823 GATAAGCTCAGCCACCGTCAGGG - Intergenic
1062763951 10:47522-47544 GGTAAGCTCAGCCACAGTCAAGG + Exonic
1063268426 10:4479694-4479716 GGTGAGCCAGGGCACTGGCAAGG + Intergenic
1063487167 10:6430699-6430721 GGGGAGTTGGGGCACCGGCAGGG + Intronic
1075224008 10:120608999-120609021 GGTGAGCAAGGGAACCGTCCAGG - Intergenic
1084426892 11:69088988-69089010 GCTGAGCTCGGGCACAGACCGGG - Intronic
1086438029 11:86800651-86800673 GGTGAGTGCGGGCACCGACTGGG + Exonic
1088905740 11:114154373-114154395 GGTGAACTCGCACACAGTCATGG - Intronic
1091848612 12:3677547-3677569 GGTGAGCTGAGGCACCGTAACGG - Intronic
1095261579 12:40105231-40105253 GGTGAGTTCGGGCTCCGTGAAGG - Exonic
1098103132 12:67040241-67040263 GGTGAGCTCTGGCATCGTGTGGG + Intergenic
1102291032 12:111699867-111699889 GGGGAGCTGTGGCACAGTCATGG - Intronic
1103172043 12:118829697-118829719 GATGAGATCGGGCACGTTCAGGG - Intergenic
1113945290 13:114040524-114040546 AGTGAGCGCGGGCTCCGCCATGG - Intronic
1113945300 13:114040583-114040605 AGTGAGCGCGGGCTCCGCCATGG - Intronic
1113945333 13:114040820-114040842 AGTGAGCGCGGGCTCCGCCATGG - Intronic
1118902806 14:70000898-70000920 GGTGGCCTCGGCCAACGTCAGGG + Intronic
1120780028 14:88479025-88479047 GGTGAGGTCGGACTCCGACATGG + Exonic
1202905759 14_GL000194v1_random:71721-71743 GGGCAGCTCGGGCACCAGCATGG - Intergenic
1128743228 15:70097188-70097210 GGCGAGCTCGGGCCCCCTCCGGG + Exonic
1131720512 15:95163398-95163420 GGTGAGGTGGGGCACGGTGACGG + Intergenic
1142209787 16:88803645-88803667 GGTGGGCGCGGGCACCGGCTTGG - Exonic
1142414756 16:89935299-89935321 GGTGAGCTCGGGCACGGTCAGGG - Exonic
1142440697 16:90095705-90095727 GGTGAGCTCAGCCACAGTCAAGG - Intergenic
1143137996 17:4722762-4722784 GGGGAGTTCGGGGACCGTCCAGG + Intergenic
1146319363 17:31834505-31834527 GGTGAGCTCCTGCAGCCTCATGG - Intergenic
1148734704 17:49858855-49858877 GGGGAGCCGGGGCACTGTCAGGG + Intergenic
1149517502 17:57291858-57291880 GATGAGATCGGGCACATTCAGGG - Intronic
1150571959 17:66394325-66394347 GGTGTGCTTGGGCACAGTTAGGG + Intronic
1151329463 17:73398337-73398359 GTTGAGGTCGGGCACCTCCATGG + Exonic
1152082954 17:78199846-78199868 GCTGTGCTCAGGCACCATCAGGG - Intronic
1152956858 18:47855-47877 GGTGAGCTCAGCCACAGTCAAGG + Exonic
1154186897 18:12192224-12192246 TGTGTCCTCAGGCACCGTCATGG + Intergenic
1154204505 18:12325637-12325659 GGTGAGCTCGGGCACGGTCAGGG - Exonic
1155068626 18:22292289-22292311 GATGAGATCGGGCACGTTCAGGG + Intergenic
1157225416 18:45858718-45858740 GGTGAGCTCGGGAACCTGAAGGG + Exonic
1160921445 19:1522845-1522867 GCTGAGCTCGGGCACCTTTGCGG - Intergenic
1161168099 19:2799434-2799456 GGTGACCTCGGGCAACCTCAGGG - Intronic
1161815207 19:6495629-6495651 GGTGAGCTCGGGCACCGTCAGGG + Exonic
927199783 2:20571190-20571212 GGGGTGCTGGGGTACCGTCAAGG - Intronic
937478503 2:122236310-122236332 GGTGAGCACACACACCGTCACGG + Intergenic
940982037 2:160014415-160014437 GATGAGATCGGGCACATTCAGGG - Intronic
944341157 2:198601563-198601585 GATGAGATCGGGCACATTCAGGG - Intergenic
946322095 2:218960179-218960201 GGTGGGCACTGGCACCGCCAGGG - Exonic
947043412 2:225949781-225949803 GGTGTGCTTGGGCACTGACAGGG - Intergenic
948794921 2:240397579-240397601 TGTGAGCTCTGGCACAGTCCAGG + Intergenic
1171892069 20:30725504-30725526 GGGCAGCTCGGGCACCAGCATGG + Intergenic
1173002472 20:39114475-39114497 GCTGAGCTCTGGCAGCCTCAGGG + Intergenic
1175446580 20:59024275-59024297 GGTGAGCTCGGCCACGGAGAGGG - Exonic
1176310608 21:5147016-5147038 GGTTGGCTCGGGCAGCGTCTGGG - Intronic
1176625115 21:9086478-9086500 GGGCAGCTCGGGCACCAGCATGG - Intergenic
1179846447 21:44115019-44115041 GGTTGGCTCGGGCAGCGTCTGGG + Intronic
1179950521 21:44706806-44706828 GGGCAGCTTGGGCACTGTCAGGG - Intronic
1181234988 22:21443336-21443358 ATTGAGCTCTGGCACCTTCAGGG + Intronic
1182929268 22:34157457-34157479 GGTGATCACAGGCACCTTCATGG + Intergenic
1185361022 22:50406897-50406919 CGTGACTTGGGGCACCGTCATGG + Intronic
950050223 3:9982833-9982855 GGAGAGCACTGGCACAGTCAAGG - Intronic
950962968 3:17124378-17124400 GGTGTGCTGGGGCACAATCACGG - Intergenic
961497666 3:127306229-127306251 GGGGAGCTCTGGCAACGCCAAGG - Intergenic
962192728 3:133328373-133328395 GGTGAGATCAGGCACATTCAGGG + Intronic
968357454 3:198120292-198120314 GGTGAGCTCAGCCACAGTCAAGG - Intergenic
968576340 4:1367951-1367973 GGTGTGCTCAGGCACCCCCAGGG - Intronic
978735346 4:112077924-112077946 GGTGAGCTCAGCCACCATCAAGG - Intergenic
985441086 4:189982958-189982980 GGTGAGCTCAGCCACAGTCAAGG + Intergenic
985716639 5:1466804-1466826 GGTGAGCTCTGCCACCCCCAGGG + Exonic
993502677 5:88680446-88680468 GGTGAGCACGGGCACAGTCCCGG + Intergenic
994287733 5:97990737-97990759 GATGAGATCGGGCACATTCAGGG + Intergenic
1001519604 5:172381674-172381696 GGTGTGCTCGGGAACTGCCAGGG - Intronic
1001636819 5:173216269-173216291 GATGAGATCGGGCACGTTCAGGG + Intergenic
1005012449 6:21348696-21348718 GGTGAGCGAGGGCACAGGCATGG - Intergenic
1007535825 6:42587821-42587843 GATGAGATCGGGCACATTCAGGG - Intronic
1011628523 6:89302611-89302633 GGTGAGCTCGGGCACGGTCAGGG - Intronic
1015636088 6:135275825-135275847 GCTGAGATCGGGCACGTTCAGGG + Intergenic
1017304310 6:152898825-152898847 GGTGAGCTCAGGCACTATGAGGG - Intergenic
1018268610 6:162052038-162052060 GATGAGATCGGGCACGTTCAGGG + Intronic
1020119460 7:5495048-5495070 GGTCAGCTCTGCCACCGTCCTGG - Intronic
1030662715 7:112238895-112238917 GATGAGGTCGGGCACGTTCAGGG - Intronic
1034096899 7:148417452-148417474 GTTGAGCTCAGGCACTGTCATGG + Exonic
1035046902 7:155973760-155973782 GGGCAGCACGGGCACCGGCACGG + Intergenic
1035046910 7:155973792-155973814 GGGCAGCACGGGCACCGGCACGG + Intergenic
1036621374 8:10426243-10426265 TGTGAGCTGGGGCCCGGTCATGG + Intronic
1038814799 8:30891198-30891220 GGTGAGTGAGGGCACCGTCATGG + Intergenic
1047256865 8:123220476-123220498 GATAAGATCGGGCACAGTCAGGG - Intronic
1049316782 8:141973512-141973534 CGTGAGCGCAGGCACCGTGAGGG - Intergenic
1049585172 8:143429684-143429706 GTTCAGCTCGCGCACCGACATGG + Exonic
1051907157 9:22108403-22108425 GGTGAGATCGGGCACGTTCAGGG + Intergenic
1054356752 9:64070196-64070218 GGGCAGCTCGGGCACCAGCATGG - Intergenic
1059384881 9:113956659-113956681 GGTGTGCTCAGGCACCTTCTTGG + Intronic
1061183859 9:129040641-129040663 GGGGATCTCGGCCACCGTCATGG - Exonic
1062348650 9:136127950-136127972 GGTGGGCTCAGGTACAGTCAAGG - Intergenic
1062741304 9:138176777-138176799 GGTGAGCTCAGCCACAGTCAAGG - Intergenic
1203748287 Un_GL000218v1:56934-56956 GGGCAGCTCGGGCACCAGCATGG - Intergenic
1203561434 Un_KI270744v1:61074-61096 GCTCAGCTCGGGCACCAGCATGG + Intergenic
1186816361 X:13241605-13241627 GATGAGATCGGGCACATTCAGGG + Intergenic
1192339651 X:70253058-70253080 GATGAGATCGGGCACGTTCATGG - Intergenic
1197183553 X:123562489-123562511 TGTGAGCTCAGGCACCCTCAGGG - Intergenic
1201076592 Y:10194478-10194500 GGAGTGCAAGGGCACCGTCATGG + Intergenic
1201161637 Y:11171908-11171930 GGGAAGCTCGGGCACCAGCATGG - Intergenic