ID: 1161819096

View in Genome Browser
Species Human (GRCh38)
Location 19:6518150-6518172
Sequence TGGGATTCCCTTTCCAAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161819087_1161819096 17 Left 1161819087 19:6518110-6518132 CCAGGGGAGTTGGAAAGTCCTTT No data
Right 1161819096 19:6518150-6518172 TGGGATTCCCTTTCCAAAGCGGG No data
1161819082_1161819096 24 Left 1161819082 19:6518103-6518125 CCCTCCCCCAGGGGAGTTGGAAA No data
Right 1161819096 19:6518150-6518172 TGGGATTCCCTTTCCAAAGCGGG No data
1161819086_1161819096 18 Left 1161819086 19:6518109-6518131 CCCAGGGGAGTTGGAAAGTCCTT No data
Right 1161819096 19:6518150-6518172 TGGGATTCCCTTTCCAAAGCGGG No data
1161819085_1161819096 19 Left 1161819085 19:6518108-6518130 CCCCAGGGGAGTTGGAAAGTCCT No data
Right 1161819096 19:6518150-6518172 TGGGATTCCCTTTCCAAAGCGGG No data
1161819084_1161819096 20 Left 1161819084 19:6518107-6518129 CCCCCAGGGGAGTTGGAAAGTCC No data
Right 1161819096 19:6518150-6518172 TGGGATTCCCTTTCCAAAGCGGG No data
1161819089_1161819096 -1 Left 1161819089 19:6518128-6518150 CCTTTCCAGGTAGTTACCCTGCT No data
Right 1161819096 19:6518150-6518172 TGGGATTCCCTTTCCAAAGCGGG No data
1161819092_1161819096 -6 Left 1161819092 19:6518133-6518155 CCAGGTAGTTACCCTGCTGGGAT No data
Right 1161819096 19:6518150-6518172 TGGGATTCCCTTTCCAAAGCGGG No data
1161819083_1161819096 23 Left 1161819083 19:6518104-6518126 CCTCCCCCAGGGGAGTTGGAAAG No data
Right 1161819096 19:6518150-6518172 TGGGATTCCCTTTCCAAAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161819096 Original CRISPR TGGGATTCCCTTTCCAAAGC GGG Intergenic
No off target data available for this crispr