ID: 1161819684

View in Genome Browser
Species Human (GRCh38)
Location 19:6522240-6522262
Sequence AGTGAACAGACTCCTCCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161819684_1161819691 22 Left 1161819684 19:6522240-6522262 CCTGGGGGAGGAGTCTGTTCACT No data
Right 1161819691 19:6522285-6522307 AGGGCCCCCCTGGCACAGCCTGG No data
1161819684_1161819692 23 Left 1161819684 19:6522240-6522262 CCTGGGGGAGGAGTCTGTTCACT No data
Right 1161819692 19:6522286-6522308 GGGCCCCCCTGGCACAGCCTGGG No data
1161819684_1161819687 2 Left 1161819684 19:6522240-6522262 CCTGGGGGAGGAGTCTGTTCACT No data
Right 1161819687 19:6522265-6522287 ACCTCAGAGGCAGAAGAAGGAGG No data
1161819684_1161819690 12 Left 1161819684 19:6522240-6522262 CCTGGGGGAGGAGTCTGTTCACT No data
Right 1161819690 19:6522275-6522297 CAGAAGAAGGAGGGCCCCCCTGG No data
1161819684_1161819686 -1 Left 1161819684 19:6522240-6522262 CCTGGGGGAGGAGTCTGTTCACT No data
Right 1161819686 19:6522262-6522284 TCAACCTCAGAGGCAGAAGAAGG No data
1161819684_1161819693 24 Left 1161819684 19:6522240-6522262 CCTGGGGGAGGAGTCTGTTCACT No data
Right 1161819693 19:6522287-6522309 GGCCCCCCTGGCACAGCCTGGGG No data
1161819684_1161819689 3 Left 1161819684 19:6522240-6522262 CCTGGGGGAGGAGTCTGTTCACT No data
Right 1161819689 19:6522266-6522288 CCTCAGAGGCAGAAGAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161819684 Original CRISPR AGTGAACAGACTCCTCCCCC AGG (reversed) Intergenic
No off target data available for this crispr