ID: 1161819689

View in Genome Browser
Species Human (GRCh38)
Location 19:6522266-6522288
Sequence CCTCAGAGGCAGAAGAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161819684_1161819689 3 Left 1161819684 19:6522240-6522262 CCTGGGGGAGGAGTCTGTTCACT No data
Right 1161819689 19:6522266-6522288 CCTCAGAGGCAGAAGAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161819689 Original CRISPR CCTCAGAGGCAGAAGAAGGA GGG Intergenic
No off target data available for this crispr