ID: 1161822631

View in Genome Browser
Species Human (GRCh38)
Location 19:6539710-6539732
Sequence CTCCAAAAGAAGTGAGGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161822626_1161822631 6 Left 1161822626 19:6539681-6539703 CCGCTCTGTGTGACACAGCAAGA No data
Right 1161822631 19:6539710-6539732 CTCCAAAAGAAGTGAGGGTAGGG No data
1161822625_1161822631 16 Left 1161822625 19:6539671-6539693 CCACTGCAATCCGCTCTGTGTGA No data
Right 1161822631 19:6539710-6539732 CTCCAAAAGAAGTGAGGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161822631 Original CRISPR CTCCAAAAGAAGTGAGGGTA GGG Intergenic
No off target data available for this crispr