ID: 1161826685

View in Genome Browser
Species Human (GRCh38)
Location 19:6572271-6572293
Sequence CACTGCAGGGTGGAGTGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161826685_1161826692 17 Left 1161826685 19:6572271-6572293 CCAGAGCACTCCACCCTGCAGTG No data
Right 1161826692 19:6572311-6572333 TCAAGCCCTGACCACTGAAATGG No data
1161826685_1161826693 18 Left 1161826685 19:6572271-6572293 CCAGAGCACTCCACCCTGCAGTG No data
Right 1161826693 19:6572312-6572334 CAAGCCCTGACCACTGAAATGGG No data
1161826685_1161826691 -9 Left 1161826685 19:6572271-6572293 CCAGAGCACTCCACCCTGCAGTG No data
Right 1161826691 19:6572285-6572307 CCTGCAGTGGCAAGGCTTGCTGG 0: 4
1: 3
2: 33
3: 71
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161826685 Original CRISPR CACTGCAGGGTGGAGTGCTC TGG (reversed) Intergenic
No off target data available for this crispr