ID: 1161828095

View in Genome Browser
Species Human (GRCh38)
Location 19:6583011-6583033
Sequence AGCCCCTCTCCAACCTTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161828095_1161828098 -3 Left 1161828095 19:6583011-6583033 CCAGGTAAGGTTGGAGAGGGGCT No data
Right 1161828098 19:6583031-6583053 GCTGCAGGGCTAGATTTGTGAGG No data
1161828095_1161828103 12 Left 1161828095 19:6583011-6583033 CCAGGTAAGGTTGGAGAGGGGCT No data
Right 1161828103 19:6583046-6583068 TTGTGAGGGCGGGTGGCGCATGG No data
1161828095_1161828102 5 Left 1161828095 19:6583011-6583033 CCAGGTAAGGTTGGAGAGGGGCT No data
Right 1161828102 19:6583039-6583061 GCTAGATTTGTGAGGGCGGGTGG No data
1161828095_1161828099 -2 Left 1161828095 19:6583011-6583033 CCAGGTAAGGTTGGAGAGGGGCT No data
Right 1161828099 19:6583032-6583054 CTGCAGGGCTAGATTTGTGAGGG No data
1161828095_1161828101 2 Left 1161828095 19:6583011-6583033 CCAGGTAAGGTTGGAGAGGGGCT No data
Right 1161828101 19:6583036-6583058 AGGGCTAGATTTGTGAGGGCGGG No data
1161828095_1161828100 1 Left 1161828095 19:6583011-6583033 CCAGGTAAGGTTGGAGAGGGGCT No data
Right 1161828100 19:6583035-6583057 CAGGGCTAGATTTGTGAGGGCGG No data
1161828095_1161828104 13 Left 1161828095 19:6583011-6583033 CCAGGTAAGGTTGGAGAGGGGCT No data
Right 1161828104 19:6583047-6583069 TGTGAGGGCGGGTGGCGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161828095 Original CRISPR AGCCCCTCTCCAACCTTACC TGG (reversed) Intergenic
No off target data available for this crispr