ID: 1161828099

View in Genome Browser
Species Human (GRCh38)
Location 19:6583032-6583054
Sequence CTGCAGGGCTAGATTTGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161828095_1161828099 -2 Left 1161828095 19:6583011-6583033 CCAGGTAAGGTTGGAGAGGGGCT No data
Right 1161828099 19:6583032-6583054 CTGCAGGGCTAGATTTGTGAGGG No data
1161828088_1161828099 18 Left 1161828088 19:6582991-6583013 CCAGATGCATGGTTCTGAGTCCA No data
Right 1161828099 19:6583032-6583054 CTGCAGGGCTAGATTTGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161828099 Original CRISPR CTGCAGGGCTAGATTTGTGA GGG Intergenic
No off target data available for this crispr