ID: 1161828544

View in Genome Browser
Species Human (GRCh38)
Location 19:6586176-6586198
Sequence CAGGCTGATGCTACGGGAGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161828539_1161828544 0 Left 1161828539 19:6586153-6586175 CCTTGGTGGAAGCTGAGACGCAG 0: 1
1: 0
2: 0
3: 23
4: 234
Right 1161828544 19:6586176-6586198 CAGGCTGATGCTACGGGAGGCGG 0: 1
1: 0
2: 0
3: 12
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161828544 Original CRISPR CAGGCTGATGCTACGGGAGG CGG Exonic
901229665 1:7634679-7634701 CAGGCTGGGGCTGCCGGAGGAGG + Intronic
903399295 1:23028255-23028277 CAGGCAGATGCCAAGGCAGGAGG - Intronic
909574789 1:77161396-77161418 CAGGTTGATGCTATGGAAAGGGG + Exonic
912142470 1:106748010-106748032 CTGGCTGATCCGACAGGAGGCGG - Intergenic
912640674 1:111342627-111342649 CAGGCAGAGGCAAAGGGAGGAGG - Intergenic
915881138 1:159672925-159672947 CAGGCTGAATCTACAGGTGGTGG - Intergenic
921222900 1:212986334-212986356 CAGGCTGATGCTAATGTATGGGG + Intronic
1067045754 10:42984341-42984363 CAGGCTGATGTTATGCCAGGTGG - Intergenic
1067549802 10:47226352-47226374 CAGGGTGATATTATGGGAGGTGG - Intergenic
1069842190 10:71346856-71346878 CAGGCTGCTGCGATGGAAGGGGG + Intronic
1072661436 10:97366147-97366169 CCGGCTGATCATAAGGGAGGAGG - Exonic
1074109690 10:110414033-110414055 CAGATTGATGCAACGGGAAGAGG - Intergenic
1075419005 10:122287058-122287080 CAGGCTCAGGCTCAGGGAGGGGG - Intronic
1077268001 11:1661466-1661488 CAGCCAGATGCCACGGGATGTGG - Intergenic
1077272918 11:1690266-1690288 CAGCCAGATGCCACGGGATGTGG + Intergenic
1080088512 11:28315810-28315832 CAGGCTGTTGCTTCAGGGGGTGG + Intronic
1080725311 11:34893590-34893612 TAGGCTGATGGTAAGAGAGGAGG + Intronic
1084194460 11:67516553-67516575 CAGGCTGAGGCCTGGGGAGGTGG + Intergenic
1086941872 11:92806783-92806805 AAGGCTGTTGCTAGGGGAGAGGG + Intronic
1089111573 11:116061889-116061911 CAGGCTGATGCAAGAGGATGGGG - Intergenic
1089570734 11:119407296-119407318 AATGCTGATGTGACGGGAGGCGG + Intergenic
1089596854 11:119585926-119585948 CAGGCTGATGGGAAGGAAGGTGG - Intergenic
1090077042 11:123586095-123586117 CAGGCGGAGGCTAAGGGAGAAGG - Intronic
1091978955 12:4850282-4850304 CAGGCTGAGGGTCCGAGAGGGGG + Intronic
1092085805 12:5758490-5758512 CAGCCTGATTCTAGGGGAGCGGG + Intronic
1093843351 12:23933875-23933897 CAGGCTGTTGCTAAGAGATGAGG - Intronic
1096102527 12:48978413-48978435 CTGGCTGAAGTGACGGGAGGAGG - Intergenic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1096846066 12:54407796-54407818 CAGGCTGGGGCCAAGGGAGGGGG - Intronic
1101059278 12:100954275-100954297 CAGGCTGAAGTGATGGGAGGTGG - Intronic
1101326790 12:103722835-103722857 CAGGTTGTTGTTACAGGAGGGGG + Intronic
1101964550 12:109273553-109273575 CAGGCTCATTCTCCGTGAGGCGG + Intergenic
1106700996 13:32228522-32228544 CAGACTGATGCTAGAGGAGGTGG - Exonic
1107228255 13:38076749-38076771 CATGCTGCTGCTACTGGGGGTGG - Intergenic
1111542578 13:89688743-89688765 CCGGCTGATGCTGGGGGATGTGG - Intergenic
1112398440 13:99054782-99054804 CAGGCTGAAGTTAAGGGATGAGG + Intronic
1112490499 13:99859004-99859026 CAGCCTGATGCTACCAAAGGTGG + Exonic
1113867633 13:113537849-113537871 CAGGGTGATGCTATAGAAGGGGG - Intronic
1115778007 14:36737452-36737474 CAGGATGGTGGTATGGGAGGAGG - Intronic
1120841781 14:89091902-89091924 CAGCCTCATACTATGGGAGGGGG + Intergenic
1121622780 14:95361690-95361712 CTGGCTGATCCTTCTGGAGGAGG + Intergenic
1122436444 14:101704331-101704353 CAGGTTGTTGCTACGGAAAGGGG - Intergenic
1122577547 14:102751567-102751589 CACCCTGGTGCTGCGGGAGGCGG + Intergenic
1127519301 15:59727510-59727532 TGGGGTGATGCTATGGGAGGAGG - Intergenic
1128734347 15:70044335-70044357 CAGGCTGGTGAAACCGGAGGAGG - Intergenic
1129389800 15:75214830-75214852 CAGGCTGAGGCTAGGGGCTGTGG - Intergenic
1130680044 15:85988831-85988853 CAGTGTGATGGTACAGGAGGTGG - Intergenic
1130832719 15:87617821-87617843 CAGTCTAATACTAAGGGAGGAGG - Intergenic
1132749886 16:1452669-1452691 CTCGCTTAGGCTACGGGAGGAGG - Intronic
1133051598 16:3120262-3120284 CATGCTGATGCTGGGGGCGGCGG + Exonic
1133175201 16:4009356-4009378 GAGGCTGAGGCTATAGGAGGTGG - Intronic
1137706567 16:50539676-50539698 CAGGCTGCTGCTGGCGGAGGGGG - Intergenic
1138103723 16:54275352-54275374 CAGGCTGATGCTGTGGGTGCTGG + Intergenic
1139968175 16:70757057-70757079 TACTCTGAAGCTACGGGAGGGGG + Intronic
1141611523 16:85183762-85183784 CAGGCTGAGGCTCAGAGAGGTGG + Intronic
1143454698 17:7058969-7058991 CAGGCTGATTCTCAGGCAGGAGG + Intergenic
1144458068 17:15435117-15435139 GAGGCTGATCCTGGGGGAGGAGG - Intergenic
1147176153 17:38657454-38657476 CTGGCTGGGGCTCCGGGAGGTGG - Intergenic
1147510982 17:41068698-41068720 CAGGCTGATGCTGGAGGAGAAGG + Intergenic
1147760784 17:42796275-42796297 TAGGCTGTTGCGGCGGGAGGTGG - Exonic
1147960733 17:44166114-44166136 CAGGCTGAGGCTAAGGCAGGAGG - Intergenic
1148125226 17:45233247-45233269 CACGCAGGTGCTACGGGAGCTGG + Exonic
1148241999 17:46005733-46005755 CAGGCTGGAGCTGCGGAAGGAGG - Intronic
1152930763 17:83108490-83108512 GAAGCTGTTGCTTCGGGAGGAGG + Intergenic
1156894572 18:42230673-42230695 CAGACTGATGCTAAGGCAGCAGG - Intergenic
1159180290 18:64893537-64893559 CAGGCTGTTGCTACAGAGGGTGG - Intergenic
1160493221 18:79355030-79355052 CAGGGTGATGGAATGGGAGGAGG + Intronic
1161435181 19:4258752-4258774 CAGGCTGGTGCTAGGGGATGAGG - Intronic
1161828544 19:6586176-6586198 CAGGCTGATGCTACGGGAGGCGG + Exonic
1162033366 19:7926632-7926654 CAGGCGGCTGCTGTGGGAGGCGG - Intergenic
1162849127 19:13417118-13417140 CAGCCTGATGTTCCAGGAGGTGG + Intronic
1162970385 19:14177697-14177719 CGGGCTGATGCGCCGGGAGCTGG - Exonic
1166074062 19:40403713-40403735 CAGGCTGAGGCTCCTGGCGGCGG + Exonic
1167768325 19:51499038-51499060 AAGGCTGAGGCTGAGGGAGGGGG + Intronic
925892996 2:8451161-8451183 CATGCTGATGTGACGGGAGGTGG + Intergenic
926008975 2:9393618-9393640 CAGGCTTCTTCTGCGGGAGGCGG - Exonic
931819983 2:65942019-65942041 CAGGCTGTTGCTGGGGGAGGAGG + Intergenic
932180130 2:69639549-69639571 AAGGCTGATGCTACCAGGGGAGG + Intronic
932775186 2:74524273-74524295 CAGGCTGCTTCTGCAGGAGGTGG - Exonic
935594098 2:104866501-104866523 CAGGATGATGCAAATGGAGGTGG - Intergenic
938690298 2:133782002-133782024 TGGGCTGATGCTACTGGAGCGGG + Intergenic
939619367 2:144399389-144399411 CATGCTGATGCAAAGGGATGGGG + Exonic
940453719 2:153871826-153871848 CAGGCTGGGGCTACGAGAGGAGG + Intergenic
944649656 2:201816863-201816885 CAGGTTGTTGCTACGGGAAAGGG - Intronic
944766734 2:202871764-202871786 CAGGCTCCCGCTGCGGGAGGCGG + Intronic
946336508 2:219040861-219040883 GAGGCTGAGGCTCCGGGAGATGG - Intronic
1169994977 20:11546339-11546361 CAGCCTGATGCTGAGTGAGGTGG - Intergenic
1170612412 20:17925484-17925506 CAGGCTGAGGCTACATGATGGGG + Intergenic
1171173367 20:23034549-23034571 CTGGCAGAAGCTACGGGAGCCGG - Intergenic
1171419383 20:25007757-25007779 CAGGCTGCTGCTAAGTGAGCTGG - Exonic
1173279660 20:41617781-41617803 CAGGCTGCTGTTCCGGGAGGGGG - Intronic
1174361560 20:50032017-50032039 CACTCTGATGCCCCGGGAGGAGG + Intergenic
1174427015 20:50439064-50439086 CTGGCTGATGCTACAGAGGGAGG - Intergenic
1175746967 20:61463826-61463848 CAGGAGGATGCTAAGGAAGGTGG + Intronic
1179356180 21:40662652-40662674 CAACATGATGCTATGGGAGGTGG + Intronic
1179990878 21:44947742-44947764 CAGCCTCCTGCTACGGGAGGAGG + Intronic
1181762400 22:25067374-25067396 CAGACTGATGGCCCGGGAGGCGG - Intronic
1182782762 22:32881101-32881123 CAGGCTGCTGCTCGGGGAAGGGG + Intronic
1184010152 22:41741686-41741708 CAGGCTGATGCTGGGCGTGGTGG + Intronic
1184402162 22:44280560-44280582 CAGCCTGAAGCTTCAGGAGGGGG + Intronic
1185301622 22:50083974-50083996 CATGCTCAGGCCACGGGAGGTGG + Intronic
949962307 3:9322543-9322565 CACGCCGATGCAACAGGAGGTGG - Intronic
951644357 3:24871930-24871952 CAGGGTGATGATAGGGGAAGTGG - Intergenic
952506105 3:34008042-34008064 CAGGCTGGTGCTTCCCGAGGAGG - Intergenic
955003217 3:54946212-54946234 CAGCCTGAAGCTAGGGGTGGAGG - Intronic
958805867 3:98809377-98809399 GAGGCTGAAGATACAGGAGGGGG + Intronic
960876076 3:122296365-122296387 CAGGCAGATTTTACTGGAGGGGG - Intergenic
961387254 3:126529751-126529773 CAGGATGATGGGAGGGGAGGAGG - Intronic
963174531 3:142283944-142283966 GAGGGAGATGCTACAGGAGGAGG - Intergenic
969538906 4:7773730-7773752 GAGGCTGACCCTACGGGAGGAGG - Intronic
974074262 4:57154640-57154662 GTGGCTGATGCTACTGGTGGAGG + Intergenic
974847363 4:67367178-67367200 CTGGCTGATGGAATGGGAGGGGG - Intergenic
978343889 4:107745640-107745662 CAGGCTATTGCGATGGGAGGAGG - Intergenic
981718458 4:147775347-147775369 TAGGCTGAGGCTAATGGAGGTGG + Intronic
983234984 4:165169393-165169415 CAGGCTGTTGCTACCCAAGGTGG + Intronic
986582789 5:9282697-9282719 CAATCTGATGACACGGGAGGCGG - Intronic
987091703 5:14513428-14513450 CAGGCTGATCTGACAGGAGGCGG + Intronic
987621316 5:20340777-20340799 CACGGTCATGCTACAGGAGGAGG - Intronic
997172421 5:131736585-131736607 GAGGCTGATGTGACAGGAGGTGG - Intronic
997531108 5:134581744-134581766 CTGGCTGCTGCGAGGGGAGGGGG + Exonic
997610547 5:135212864-135212886 CAGGCTGAGGCTGGGGGATGGGG - Intronic
998291943 5:140924598-140924620 CAGGCTGATGCCAGGTGCGGTGG + Intronic
1001017672 5:168156128-168156150 CAGGCTGAGGCTCAGAGAGGTGG + Intronic
1003456913 6:6291864-6291886 GAGTCTGAAGCTTCGGGAGGAGG - Intronic
1006336206 6:33421825-33421847 CAGGCTGCAGCCAAGGGAGGCGG - Intronic
1006341158 6:33447840-33447862 CAGGCTGATGCTGGTGGAGGAGG + Exonic
1006513758 6:34534896-34534918 CAGGCAGGAGCTACAGGAGGAGG - Exonic
1007397462 6:41585918-41585940 CAGGCTGAGGTAAGGGGAGGTGG - Intronic
1007573085 6:42907407-42907429 GAGGCTGATGTTTTGGGAGGAGG - Intergenic
1008153832 6:47989586-47989608 CAGGCTGTTGCTTCAGAAGGTGG + Intronic
1018993522 6:168692825-168692847 CAGACAGGTGCTGCGGGAGGAGG - Intergenic
1019310248 7:356981-357003 CAGGCTGCTGCTGCGGGAACAGG + Intergenic
1020027773 7:4911227-4911249 CAGGCTGAACCTTCGGGAGCTGG - Exonic
1026111120 7:67459602-67459624 CAAGCTGGTGATACGGGAGGGGG - Intergenic
1027907737 7:84207785-84207807 GGGGCTGTTGCTATGGGAGGCGG + Intronic
1029232059 7:99078629-99078651 CCGGCTGATGTGACAGGAGGCGG - Intronic
1029254650 7:99261415-99261437 CAGGGTGATGTTAGAGGAGGTGG - Intergenic
1034289035 7:149913383-149913405 CAGACTGAGGATAGGGGAGGCGG + Intergenic
1034447257 7:151120036-151120058 CTGGCTGATGCTGGGGGTGGAGG - Exonic
1034662036 7:152779466-152779488 CAGACTGAGGATAGGGGAGGCGG - Intronic
1036645291 8:10608633-10608655 CAGGGTGAAGCTGCGGCAGGAGG - Exonic
1036754472 8:11463424-11463446 CAGGCTCATGCTTAGGGTGGTGG - Intronic
1037715312 8:21392497-21392519 CTGGCTGATGGGAGGGGAGGTGG - Intergenic
1037891775 8:22627473-22627495 CAGGCTGCTGGCAGGGGAGGTGG + Intronic
1038581493 8:28752642-28752664 CAGGCTGATGCTGGGGTTGGGGG - Exonic
1040482865 8:47842126-47842148 CAGGCTACTGCTAAGGGATGGGG + Intronic
1048455365 8:134573446-134573468 CAGGCTGATGTTGCTGGTGGAGG + Intronic
1049151460 8:141037854-141037876 CAGGCTGACTCCACGGGTGGGGG + Intergenic
1049180265 8:141218593-141218615 CTGGCTGGTGCTGCGGGGGGTGG + Exonic
1053003095 9:34588676-34588698 CCGCCTGAAGCTACTGGAGGGGG + Intronic
1055743458 9:79415699-79415721 CAGGATGTTGATACTGGAGGAGG + Intergenic
1060479202 9:124008288-124008310 CGGCCTGATGCCGCGGGAGGAGG + Intronic
1060549533 9:124478393-124478415 GAGGCTGAGGCCACGGGAGCTGG - Exonic
1061449429 9:130660437-130660459 CCGGCAGATGTTTCGGGAGGAGG + Intergenic
1062016365 9:134293217-134293239 CAGGCTGGGGCTCCTGGAGGGGG + Intergenic
1185865643 X:3621519-3621541 AAGGCTGAAGCTAAGGGAAGGGG + Intronic
1186768047 X:12791403-12791425 GAGGCTGCTGCTGCGGGAGCGGG - Exonic
1187532142 X:20106754-20106776 CATGCTGAGGCTAGGTGAGGTGG + Intronic
1189348803 X:40262126-40262148 CAGGCTGCTGCTGCTGCAGGAGG - Intergenic
1190387659 X:49898417-49898439 CATGCTGATGCAAGGGGGGGCGG - Intergenic
1191774769 X:64801916-64801938 CAGACTGGGGCTATGGGAGGGGG - Intergenic
1197147414 X:123185112-123185134 CAGGCTGGTGCTGGGGGAGGTGG + Intronic
1199272352 X:145898904-145898926 CAGGCTGCTTCTAGGGGAAGGGG - Intergenic
1199472507 X:148210416-148210438 CAGGCTGTTGCTTCAGAAGGTGG + Intergenic