ID: 1161830348

View in Genome Browser
Species Human (GRCh38)
Location 19:6598197-6598219
Sequence CAACCTAGTTCCTAGTAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161830348_1161830352 12 Left 1161830348 19:6598197-6598219 CCACCCTACTAGGAACTAGGTTG No data
Right 1161830352 19:6598232-6598254 AAAACATTTAAAGGAGACTATGG 0: 1
1: 2
2: 15
3: 79
4: 536
1161830348_1161830353 29 Left 1161830348 19:6598197-6598219 CCACCCTACTAGGAACTAGGTTG No data
Right 1161830353 19:6598249-6598271 CTATGGAGTACTATGACACCAGG 0: 22
1: 20
2: 8
3: 1
4: 49
1161830348_1161830351 3 Left 1161830348 19:6598197-6598219 CCACCCTACTAGGAACTAGGTTG No data
Right 1161830351 19:6598223-6598245 ATTTTCAAAAAAACATTTAAAGG 0: 1
1: 1
2: 18
3: 206
4: 1882

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161830348 Original CRISPR CAACCTAGTTCCTAGTAGGG TGG (reversed) Intronic
No off target data available for this crispr