ID: 1161832443

View in Genome Browser
Species Human (GRCh38)
Location 19:6616778-6616800
Sequence GAGTTCCACTTTAGCGAACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161832439_1161832443 3 Left 1161832439 19:6616752-6616774 CCTGGCTGCACTGCAGACCTGAG No data
Right 1161832443 19:6616778-6616800 GAGTTCCACTTTAGCGAACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161832443 Original CRISPR GAGTTCCACTTTAGCGAACA CGG Intergenic
No off target data available for this crispr