ID: 1161836649

View in Genome Browser
Species Human (GRCh38)
Location 19:6652115-6652137
Sequence GGGTGTTTCACCCACAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161836649_1161836655 2 Left 1161836649 19:6652115-6652137 CCTGGCTTGTGGGTGAAACACCC No data
Right 1161836655 19:6652140-6652162 AGGGTTTCACCATATTGGTTAGG 0: 32
1: 1232
2: 13940
3: 77439
4: 172988
1161836649_1161836659 28 Left 1161836649 19:6652115-6652137 CCTGGCTTGTGGGTGAAACACCC No data
Right 1161836659 19:6652166-6652188 GTCTCGAATTCCTGACCTCAGGG 0: 22
1: 708
2: 2217
3: 4077
4: 5723
1161836649_1161836658 27 Left 1161836649 19:6652115-6652137 CCTGGCTTGTGGGTGAAACACCC No data
Right 1161836658 19:6652165-6652187 GGTCTCGAATTCCTGACCTCAGG 0: 1129
1: 35970
2: 89365
3: 72296
4: 36742
1161836649_1161836656 6 Left 1161836649 19:6652115-6652137 CCTGGCTTGTGGGTGAAACACCC No data
Right 1161836656 19:6652144-6652166 TTTCACCATATTGGTTAGGCTGG 0: 108
1: 3953
2: 38516
3: 155897
4: 166924
1161836649_1161836653 -3 Left 1161836649 19:6652115-6652137 CCTGGCTTGTGGGTGAAACACCC No data
Right 1161836653 19:6652135-6652157 CCCATAGGGTTTCACCATATTGG No data
1161836649_1161836660 29 Left 1161836649 19:6652115-6652137 CCTGGCTTGTGGGTGAAACACCC No data
Right 1161836660 19:6652167-6652189 TCTCGAATTCCTGACCTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161836649 Original CRISPR GGGTGTTTCACCCACAAGCC AGG (reversed) Intergenic
No off target data available for this crispr