ID: 1161839007

View in Genome Browser
Species Human (GRCh38)
Location 19:6667378-6667400
Sequence ACACCTCCTTCCCTGGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 521
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 468}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161839002_1161839007 7 Left 1161839002 19:6667348-6667370 CCGAGGGGTGGGGGTGGCATGGG 0: 1
1: 0
2: 8
3: 112
4: 726
Right 1161839007 19:6667378-6667400 ACACCTCCTTCCCTGGGGCCAGG 0: 1
1: 0
2: 2
3: 50
4: 468

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161839007 Original CRISPR ACACCTCCTTCCCTGGGGCC AGG Intronic
900143787 1:1149527-1149549 CCACCTCCTCCCCTCGGGCTGGG - Intergenic
900290717 1:1922497-1922519 CCACCTCCTCCCCTGGGACTGGG + Intronic
900985542 1:6071179-6071201 ATGCCGCCTTCCCAGGGGCCAGG + Intronic
901674759 1:10876649-10876671 ACATCTCCCTGCCTGGAGCCTGG - Intergenic
902694079 1:18128593-18128615 AGAATTGCTTCCCTGGGGCCTGG - Intronic
903012654 1:20342524-20342546 GCCCTTCCTGCCCTGGGGCCAGG + Exonic
903481177 1:23654505-23654527 CTCCCTCCTTCCCTAGGGCCTGG - Intergenic
904130684 1:28273275-28273297 ACTCATCCTTCCCAGAGGCCAGG - Intronic
905408275 1:37752324-37752346 CCACCTCCTTTCCTGGTCCCGGG - Intronic
905412010 1:37777098-37777120 AGACCTCCATCCATGAGGCCTGG + Intergenic
906142279 1:43540814-43540836 GCCCCTCCTTCCCTGGGTCAGGG + Intronic
906147772 1:43570077-43570099 CCTCCTCCTTCCCTGTAGCCTGG + Intronic
907242243 1:53087328-53087350 GCACCTCCTTCCCGGAGTCCTGG + Exonic
907930081 1:58990924-58990946 ACACCTCCTGACCAGGGCCCTGG + Intergenic
910251381 1:85201537-85201559 ACCCCGCCTTCCCCGGAGCCTGG + Intergenic
910545241 1:88408497-88408519 TCACCTCCTGCCATGTGGCCCGG + Intergenic
910907856 1:92200430-92200452 ACTCCACCATCCCTGGGGTCTGG - Intergenic
912614969 1:111090118-111090140 TCACCTCTTGCCCTGTGGCCTGG - Intergenic
912698692 1:111860464-111860486 ACACCTCTTCCCCAGGGGCCTGG - Intronic
913489866 1:119368864-119368886 ACACTTCTTTCCCTGAGGACTGG + Exonic
914754030 1:150553098-150553120 AGCCCTCCTCCCCCGGGGCCAGG + Exonic
914883111 1:151562892-151562914 CCATCCCCTTGCCTGGGGCCAGG - Intronic
917707479 1:177648962-177648984 ATACCACCTGCCCAGGGGCCTGG - Intergenic
918104188 1:181402346-181402368 CCACCTCTTTCCCTGGCCCCTGG - Intergenic
918435928 1:184512833-184512855 TCACCTCCTGCCGTGTGGCCTGG - Intronic
919747413 1:201017371-201017393 ACTCCTCCATCTCTGGGGCCTGG + Intronic
919925233 1:202188682-202188704 CCGCCTCCCTCCCTGGGCCCAGG + Intergenic
919978572 1:202628463-202628485 ACGTCTCTGTCCCTGGGGCCTGG - Intronic
920099102 1:203505786-203505808 CCCCGTCCTTCCCTGGGGCCAGG - Intronic
920339586 1:205267608-205267630 AGACCTGCTCCCCTGGTGCCTGG - Intronic
922543362 1:226435465-226435487 ACACATCAGTACCTGGGGCCAGG - Intergenic
923500440 1:234559708-234559730 ACACTCCCAGCCCTGGGGCCAGG + Intergenic
923553098 1:234979698-234979720 TCACGGCCTTCACTGGGGCCAGG - Intergenic
923802274 1:237221839-237221861 ACACAGCCTTCCCTAGGGCCAGG - Intronic
924045505 1:240025271-240025293 ACTGCTCCTTACCTGGGGGCAGG - Intronic
924408470 1:243777339-243777361 ACACCTCCTGCCGTGTGGCCTGG + Intronic
1063138693 10:3238370-3238392 ACATCTCCTTCTCTGCAGCCGGG - Intergenic
1063482351 10:6386678-6386700 ACACCTCCTACCCCAGGCCCGGG - Intergenic
1064007485 10:11710006-11710028 AAACATCCTCCCCTGGAGCCCGG - Intergenic
1064156338 10:12906296-12906318 AGAGCTGCTTCCCTGGTGCCAGG + Intronic
1065050775 10:21788804-21788826 ACACCTTCTTCCCTGGAGTCAGG + Intronic
1065925872 10:30433746-30433768 ATACGACCTTCCCTGGGGACCGG + Intergenic
1067058683 10:43066670-43066692 CCACATCCCACCCTGGGGCCTGG + Intergenic
1067164052 10:43851287-43851309 TCACCTCCTTCTGTGTGGCCTGG + Intergenic
1067549664 10:47225595-47225617 ACTCCTTCCTCCCTGAGGCCTGG + Intergenic
1068267476 10:54671887-54671909 TCACCTCCTGCTCTGTGGCCTGG - Intronic
1068836585 10:61561594-61561616 TCACCTCCTGCCGTGTGGCCTGG + Intergenic
1069578019 10:69544550-69544572 ACACCCACTACCCTGGGGGCAGG - Intergenic
1069638220 10:69938372-69938394 CCACCACCCTCCCTGGAGCCCGG + Intronic
1069703077 10:70440525-70440547 AGACGGCCCTCCCTGGGGCCGGG - Intronic
1069882644 10:71603291-71603313 CCCCCTCCTTCCCTGGGACAAGG + Intronic
1070791348 10:79191295-79191317 ATACCTCCATTCCTGGAGCCAGG + Intronic
1070800088 10:79240052-79240074 ACTCCTCCTGCCGTGGGCCCTGG - Intronic
1071118447 10:82250803-82250825 ATAGCTCCTTGCCTGGTGCCTGG + Intronic
1071136203 10:82457475-82457497 TCACCTCCTGCTCTGTGGCCTGG + Intronic
1071581585 10:86776575-86776597 AGACCCCCTTTCCTTGGGCCTGG + Intronic
1071676417 10:87659854-87659876 ATACCTCCTTCCCGGGAGTCCGG + Exonic
1073176140 10:101558851-101558873 GCCTCTCCTTCCCTGGGCCCGGG - Intergenic
1073276448 10:102315723-102315745 TCACCTCCTTCTGTGTGGCCTGG + Intronic
1073740270 10:106398693-106398715 TCACCTCCTGCCATGTGGCCTGG - Intergenic
1074261390 10:111856893-111856915 ACACCTAATTTCCAGGGGCCTGG - Intergenic
1074269481 10:111939373-111939395 AAACCTCTTTTCCTGGGGCAGGG - Intergenic
1075541600 10:123318572-123318594 ACACCTGCTCCCTAGGGGCCAGG - Intergenic
1076343418 10:129765187-129765209 ACACCTGCTCCCCAGGCGCCAGG + Intronic
1076480642 10:130783111-130783133 GCACCTCCATCCCAGGGGCATGG + Intergenic
1076737128 10:132463908-132463930 CCACCTCCTGCCCTGGGACCTGG - Intergenic
1077143572 11:1035297-1035319 ACACCTCCCTCCCTGGCTCCAGG + Intronic
1077522236 11:3043252-3043274 AGAGCTCTGTCCCTGGGGCCAGG + Intronic
1078097283 11:8307778-8307800 TCACCTCCTGCCGTGCGGCCTGG - Intergenic
1078476308 11:11633325-11633347 TCACCTCCTGCCCTGCAGCCCGG + Intergenic
1080614017 11:33930439-33930461 ACAGCTCCTTCAGTGGGGGCTGG - Intergenic
1081961828 11:47143536-47143558 ACACCTGCTGCCCCAGGGCCTGG - Intronic
1083780020 11:64913007-64913029 TCACCCCCTCCCCAGGGGCCTGG + Intronic
1084349261 11:68582854-68582876 ACCCTTCCTTCCCTCGGGCCAGG - Intronic
1084351416 11:68602628-68602650 AACCCTCCTTCCCAGGGGCAAGG + Intronic
1084521051 11:69663062-69663084 TCACCTCCTGCTGTGGGGCCCGG - Intronic
1087812490 11:102623312-102623334 TCACCTCCTGCTGTGGGGCCAGG - Intronic
1087891618 11:103543152-103543174 ACAAAGCCTTCACTGGGGCCAGG + Intergenic
1088242412 11:107785905-107785927 AAGCCTCCTTGCCTGGGGACTGG - Intergenic
1089009237 11:115119272-115119294 CCTCCCCCTTCCCTTGGGCCAGG - Intergenic
1089459921 11:118646609-118646631 ACAGCTCCTTCACTTGGGCACGG + Intronic
1090215540 11:124959923-124959945 TTACCTCCTTCCCTGATGCCTGG + Exonic
1091364382 11:135005355-135005377 CCACCTTCTTCCCTGAAGCCTGG + Intergenic
1091639949 12:2228818-2228840 ACTCCTCTTTCCCTGGCACCTGG - Intronic
1091763417 12:3102730-3102752 AAACATTCCTCCCTGGGGCCAGG - Intronic
1092042955 12:5401498-5401520 TCACCTTCTTCCATGGGCCCAGG - Intergenic
1092206824 12:6619955-6619977 GCACTGCCTTCCCTGGGCCCTGG + Exonic
1092280359 12:7093208-7093230 CCTCCTCCCTCCCAGGGGCCTGG - Intronic
1092781116 12:11988331-11988353 ACACCTCCTGCTGTGCGGCCGGG + Intergenic
1092791799 12:12076698-12076720 ACCCTTGCTTTCCTGGGGCCTGG + Intronic
1093550131 12:20400131-20400153 ACACCTGCATCCCTGGCTCCTGG - Intronic
1094053923 12:26249486-26249508 TCACCTCCTTCTATGTGGCCTGG + Intronic
1095942647 12:47736944-47736966 ACAGCTCCTTCCCAGAGGGCGGG + Intronic
1096627959 12:52906774-52906796 TCACCCCCTTCCCTGGGTCAGGG - Intronic
1097157818 12:57025675-57025697 AGCCCTGCTTCCCTGGTGCCAGG - Intronic
1097257968 12:57694855-57694877 ACACCTGCTTACCAAGGGCCTGG + Exonic
1097729021 12:63106716-63106738 TCACCTCCTACCGTGCGGCCTGG + Intergenic
1100010445 12:89946672-89946694 TCCCCGCCTTCCCTGGTGCCAGG + Intergenic
1100399580 12:94217250-94217272 TCTCCTCCTTCTCTGTGGCCAGG + Intronic
1103963922 12:124626216-124626238 ACAAGTCCTTCACTGGGGTCAGG + Intergenic
1104528636 12:129548246-129548268 ACACCTCCTTCACTCGGTGCTGG + Intronic
1104549174 12:129740128-129740150 ACTCCTGCTACCCTGGGGTCAGG + Intronic
1104740967 12:131173392-131173414 ACACCATCTTCCCAGGGGCATGG - Intergenic
1104791346 12:131483921-131483943 TCACCTAGTTCCATGGGGCCAGG - Intergenic
1104939213 12:132387005-132387027 CCACCCCCTTCCCTAGGACCTGG - Intergenic
1106033392 13:26022721-26022743 ACAACCCCTCCCCTGGGGCAGGG + Exonic
1106224010 13:27771540-27771562 CCAGCTCAGTCCCTGGGGCCAGG + Intergenic
1106486361 13:30176335-30176357 ACATCTCCCTCCCTGGTGTCTGG + Intergenic
1107025984 13:35802005-35802027 GCACCTCCTTCTCTGGGCTCTGG + Intronic
1107327967 13:39265284-39265306 TCACCTCCTGCCATGTGGCCTGG + Intergenic
1108435941 13:50401619-50401641 ACACCTTTTCCCCTGGGGCGTGG - Intronic
1110150915 13:72251958-72251980 TCACCTCCTTCCCTGAAGGCAGG + Intergenic
1111201257 13:84940341-84940363 TCACCTCCTGCCCTGTGGCCCGG - Intergenic
1111572174 13:90103492-90103514 TCACCTCCCTCCATGGGCCCAGG + Intergenic
1111935176 13:94550131-94550153 ACGGCTCCTCACCTGGGGCCTGG - Intergenic
1112806112 13:103165595-103165617 ACACCTCCAACCCTGGGTCCAGG - Intergenic
1113730417 13:112637418-112637440 ACTCCTCCTTCCCTCCTGCCTGG - Intergenic
1113958678 13:114113242-114113264 GCACCTCCTTCCATGGAGACTGG + Intronic
1114482567 14:23044713-23044735 ACATCTCCTCCCCTGAGGCTGGG - Intergenic
1114879111 14:26761746-26761768 TCACCTCCTGCTCTGCGGCCTGG - Intergenic
1115735990 14:36330702-36330724 TCACCCCCTTCTCTGCGGCCCGG - Intergenic
1116843635 14:49844393-49844415 TCACCTCCTGCCGTGTGGCCTGG + Intronic
1118729734 14:68658023-68658045 ACAGCTCCTTGCCTTGGCCCAGG + Intronic
1119406466 14:74402506-74402528 ACCCCTTCTTCCCTGGGGCTGGG + Intergenic
1119418415 14:74491867-74491889 ACCCCTTCTTGCCTGGGGACCGG + Intronic
1119420070 14:74503159-74503181 GCATCCCCCTCCCTGGGGCCTGG + Intronic
1121438527 14:93934368-93934390 AAACCTCTATTCCTGGGGCCAGG - Exonic
1121467495 14:94125444-94125466 ACAGCTCCTACCCTGGTGACAGG - Intergenic
1121633583 14:95438976-95438998 CCACCTCTTGACCTGGGGCCTGG + Intronic
1122066474 14:99177156-99177178 CCCCCGCCTTCCCTGGGGTCTGG - Intronic
1122205570 14:100146355-100146377 GCGCCCCATTCCCTGGGGCCAGG + Exonic
1123134175 14:106012079-106012101 CCAGCCCCTTCCCTGGGGGCTGG + Intergenic
1123139607 14:106062309-106062331 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
1123144637 14:106116795-106116817 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
1123148094 14:106153788-106153810 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
1123149018 14:106163690-106163712 TCAGCTTCTTCCCTGGGGGCTGG + Intergenic
1123156843 14:106235222-106235244 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
1123159972 14:106268766-106268788 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
1123167961 14:106344547-106344569 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
1123170602 14:106369260-106369282 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
1123171132 14:106373818-106373840 CCAGCCCCTTCCCTGGGGGCTGG + Intergenic
1123175254 14:106410648-106410670 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
1123176247 14:106421866-106421888 CCAGCCCCTTCCCTGGGGGCTGG + Intergenic
1123178349 14:106443289-106443311 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
1123187928 14:106537970-106537992 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
1123189685 14:106557102-106557124 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
1123192388 14:106583661-106583683 CCAGCCCCTTCCCTGAGGCCTGG + Intergenic
1123193398 14:106592833-106592855 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
1123194275 14:106601498-106601520 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
1123194818 14:106606273-106606295 CCAGCCCCTTCCCTGGGGGCTGG + Intergenic
1123202030 14:106675172-106675194 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
1123207615 14:106728320-106728342 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
1123214119 14:106790858-106790880 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
1123222225 14:106867809-106867831 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
1123222867 14:106872908-106872930 CCAGCCCCTTCCCTGGGGACTGG + Intergenic
1123584206 15:21742521-21742543 CCAGCCCCTTCCCTGGGGGCTGG + Exonic
1123620857 15:22185124-22185146 CCAGCCCCTTCCCTGGGGGCTGG + Intergenic
1124494190 15:30176383-30176405 ACATCTCTGTCCCTGGCGCCTGG - Intergenic
1124749380 15:32362262-32362284 ACATCTCTGTCCCTGGCGCCTGG + Intergenic
1125442844 15:39722017-39722039 TCACCTCCTGCTCTGGGGCCCGG - Intronic
1125600910 15:40915457-40915479 GCACGTCCCTGCCTGGGGCCAGG + Intergenic
1125966559 15:43879978-43880000 GCAGCTCTTTCCCTGAGGCCTGG + Intronic
1126358699 15:47823339-47823361 AGAGCTCCTTCCTTGGGCCCTGG - Intergenic
1127300428 15:57647724-57647746 ACACCTCCTGCACTTGGCCCTGG + Intronic
1128230573 15:66031909-66031931 TCACCTCCTGCCATGTGGCCTGG - Intronic
1128452195 15:67812066-67812088 CCAACTCCATTCCTGGGGCCAGG + Intergenic
1128566693 15:68705480-68705502 CCACTTCCCTCCCTGGGTCCTGG - Intronic
1129032565 15:72629463-72629485 ACAGCTTCTTCCCTGGGCCAGGG - Intergenic
1129231780 15:74201144-74201166 ACAGCTCCTTCCCCGAGGCCTGG + Intronic
1129452153 15:75657231-75657253 CCCCCTCCTTCCCCTGGGCCTGG + Exonic
1129933596 15:79431858-79431880 ACACCGCCTTCCCGGGGCTCCGG + Intergenic
1130552938 15:84903553-84903575 ACACTTCCCTCCCTGGGGCTGGG - Intronic
1130913195 15:88284835-88284857 CCTCCTCCTTGCCTGGGTCCAGG + Intergenic
1131059751 15:89397466-89397488 ACACCACCCTCCCTGGGGGCAGG + Intergenic
1131336096 15:91550618-91550640 ACAAATCCTCCCCTGGGGCCAGG - Intergenic
1132147586 15:99437674-99437696 TCATCTCCCTCCCTGGGTCCTGG - Intergenic
1132346604 15:101112501-101112523 ACACATGCTTTCCAGGGGCCAGG + Intergenic
1132496602 16:266346-266368 ACACCCGCTTGCATGGGGCCAGG - Intronic
1132538552 16:496159-496181 ACACCCTCACCCCTGGGGCCTGG - Intronic
1132591933 16:729900-729922 ACCCCTGCTTTCCAGGGGCCTGG + Exonic
1133023225 16:2975978-2976000 AAACCTCCATCCCTCGGGCTGGG + Intronic
1133238964 16:4403456-4403478 CCCCCTCCTTCCCTGGTTCCTGG - Intronic
1133562745 16:6965041-6965063 TCTCCTCCTTCCCTGGAGTCTGG + Intronic
1133715346 16:8441805-8441827 ACACATCCTTCAGTGGGGTCAGG + Intergenic
1133809252 16:9148600-9148622 ACACCTCCTGCTGTGTGGCCTGG + Intergenic
1133975305 16:10596164-10596186 ACCCCTGGTTCCCTGGGGCTGGG + Intergenic
1134679448 16:16114004-16114026 TCACCTCCTGCTGTGGGGCCTGG + Intronic
1135149649 16:19994617-19994639 ACAGCTCCTGGCCTGGAGCCTGG + Intergenic
1136021908 16:27445861-27445883 CTCCCTCCTTCCCTGGGGCTTGG - Intronic
1136068533 16:27774754-27774776 ACACCTGCTCCCCTTGGGCCCGG + Intronic
1136146697 16:28320552-28320574 ACACCTCCTTGGCTGGGCCGCGG - Exonic
1136383961 16:29911300-29911322 CCTCCTCCACCCCTGGGGCCAGG + Intronic
1136403577 16:30030963-30030985 CCACCTCCTTCCTTTGGGGCTGG - Exonic
1136483797 16:30558274-30558296 CTCCCTCCTTCCCTTGGGCCCGG - Exonic
1136515887 16:30768177-30768199 CCTCCTCTTTCCCTGGGGCTGGG - Exonic
1136681206 16:31963890-31963912 TCAGCTCCTTCCCTGGGGGCTGG - Intergenic
1136682108 16:31973847-31973869 CCAGCCCCTTCCCTGGAGCCTGG - Intergenic
1136781518 16:32905402-32905424 TCAGCTCCTTCCCTAGGGGCTGG - Intergenic
1136782420 16:32915348-32915370 CCAGCCCCTTCCCTGGAGCCTGG - Intergenic
1136887373 16:33938503-33938525 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
1136888276 16:33948438-33948460 TCAGCTCCTTCCCTGGGGGCTGG + Intergenic
1137275677 16:46931904-46931926 ACAGCCTCTTCCCTGGGGCTGGG + Intergenic
1138229037 16:55324396-55324418 TCACCTCCTCCCCTGCGGCCCGG - Exonic
1138479152 16:57290296-57290318 ACAGCTCCATCCCCAGGGCCTGG - Intergenic
1138950272 16:61904480-61904502 TCACCTCCTGCCCTGAGGCCTGG - Intronic
1139375566 16:66494405-66494427 AGACCTCCTTCCCAGGAGGCTGG + Intronic
1140408967 16:74730008-74730030 AAACCTCCTTCCCCTGGCCCTGG + Intronic
1140771816 16:78212406-78212428 TCACCACCATTCCTGGGGCCTGG - Intronic
1141390681 16:83660531-83660553 TCACCTCCTTCTGTGTGGCCCGG + Intronic
1141652032 16:85397850-85397872 ACACCTCCTTCTATGCGGGCTGG - Intergenic
1142016769 16:87753025-87753047 GCAGCTCCTTCCCTGGAGCAGGG + Intronic
1142057847 16:88011195-88011217 ACACCTCCATCCCGGGGCACAGG - Intronic
1142157552 16:88539538-88539560 ACACCTCCTGCCCAGGCACCTGG + Intergenic
1142252859 16:89000706-89000728 ACACCTCCGTCCCTGGGCTGGGG + Intergenic
1142265780 16:89063414-89063436 GCACCTCCAGCCCTTGGGCCAGG - Intergenic
1142374979 16:89702007-89702029 GCACCTGCTTCCCCGCGGCCGGG - Intergenic
1142424081 16:89991595-89991617 ACACCTGCTTCTCTGGGGAGGGG + Intergenic
1203084172 16_KI270728v1_random:1169384-1169406 TCAGCTCCTTCCCTGGGGGCTGG - Intergenic
1203085080 16_KI270728v1_random:1179335-1179357 CCAGCCCCTTCCCTGGAGCCTGG - Intergenic
1142607062 17:1087787-1087809 ACACCACCCTCCCAGGAGCCAGG + Intronic
1142611316 17:1110252-1110274 ACACCTCCTTCCATGGGAGGAGG + Intronic
1142680580 17:1545797-1545819 ACATCTCCCTGCCTGGGGCAGGG - Intronic
1142977787 17:3655994-3656016 AGTCCTCCTTCCCCGTGGCCTGG + Intronic
1143399827 17:6637029-6637051 ACACCTGTGTGCCTGGGGCCAGG - Intronic
1143409919 17:6702679-6702701 CCACCACCTCCCCTGGGGTCAGG - Intronic
1143839794 17:9723159-9723181 TCACCTGCAACCCTGGGGCCTGG - Intronic
1144450176 17:15370586-15370608 TCACCTCCTGCTCTGAGGCCTGG + Intergenic
1144580234 17:16454758-16454780 AAACCTCTTTCCCTGGGGTTTGG + Intronic
1144644469 17:16962837-16962859 ACCCCTCCTTCACCGGGGGCCGG + Intronic
1146062542 17:29614691-29614713 CCACCCCCTTCCCTGATGCCAGG + Exonic
1147165098 17:38588881-38588903 ACACCACCTTTCATGGGGACAGG + Intronic
1147249485 17:39144491-39144513 ACCCTTCCTTCCCTGTTGCCTGG + Intronic
1148070285 17:44904686-44904708 TCATCTCCTGTCCTGGGGCCCGG + Exonic
1148546644 17:48524352-48524374 CCAACTCCTTCCCAGGAGCCCGG + Intergenic
1150249843 17:63699512-63699534 ACCCCTGCTCCCCAGGGGCCGGG + Intronic
1150286034 17:63954670-63954692 ACACCTGCTTCTCTGAAGCCTGG + Intronic
1151499615 17:74480505-74480527 AGGCCTCCTTCCCTACGGCCTGG + Intronic
1151758755 17:76089064-76089086 CCACCTCGTGCCCTGGGGACCGG - Intronic
1151805264 17:76400982-76401004 CCATCTCCTACCCTTGGGCCCGG + Intronic
1151824146 17:76514208-76514230 AGACCTCCTACCTGGGGGCCAGG - Intergenic
1152045059 17:77930105-77930127 ACACTCCCTTCCCCGGGGCCCGG + Intergenic
1152177219 17:78795706-78795728 GCACCTCCTTTCCGGGGGCCTGG - Exonic
1152229789 17:79108734-79108756 GCACCTGCTGCCCTGGAGCCTGG - Intronic
1152241400 17:79163203-79163225 CCAGCTCCCTCCTTGGGGCCGGG + Intronic
1152316905 17:79586248-79586270 ACACGTCCGTGCCTGGGTCCCGG - Intergenic
1152580755 17:81164721-81164743 CCACCCCCTGCCCTTGGGCCGGG + Intronic
1152907704 17:82977960-82977982 GCTCCTCCTGCCCTGGGGCTTGG + Intronic
1153875571 18:9367562-9367584 TCACCTCCTTCTATGTGGCCCGG - Intronic
1155263404 18:24067454-24067476 TCACCTCCTGCCCTGTGGCTTGG - Intronic
1157476086 18:48024446-48024468 ACTCCTCCTTTCCTGGGGCCTGG - Intergenic
1157528273 18:48401635-48401657 ACACTTCCTCCCCTGGGACTAGG + Intronic
1157546525 18:48550431-48550453 ACCCTGCATTCCCTGGGGCCAGG - Intronic
1157566085 18:48680152-48680174 AAAACTTCTTCCCTGGTGCCTGG - Intronic
1157580580 18:48771743-48771765 CCTCCTCCTTCCCCGGAGCCAGG + Intronic
1159336940 18:67080658-67080680 GCACTTCCTCCCCTAGGGCCTGG + Intergenic
1160874118 19:1289482-1289504 TCTCCTCCTCCCCTGGGGACGGG + Intronic
1160909073 19:1466545-1466567 TCACCACCCTCGCTGGGGCCTGG - Exonic
1160958585 19:1706771-1706793 ACCCCACCTTCCCAGGGCCCGGG - Intergenic
1161008936 19:1950777-1950799 ACACCTCCCTTCCAGCGGCCAGG - Intronic
1161032074 19:2062159-2062181 ACACCTCTTCCTCTGTGGCCAGG + Intergenic
1161169029 19:2803920-2803942 ACCCCTACTGCCCTGGGGTCGGG + Intronic
1161221010 19:3118155-3118177 CCCCGGCCTTCCCTGGGGCCTGG + Intronic
1161246003 19:3252385-3252407 ACTCATCCTTCACTGGGGGCAGG - Intronic
1161323090 19:3650194-3650216 CCAGCACCGTCCCTGGGGCCAGG + Intronic
1161352966 19:3803941-3803963 TCACCTCCTTCTCAGGGTCCCGG - Intergenic
1161370490 19:3908474-3908496 CCACGCCCTTCCCTGGTGCCAGG - Intronic
1161512284 19:4678527-4678549 CCACTGCCTTCCCAGGGGCCAGG - Intronic
1161698863 19:5784395-5784417 ACACCTCTTTCTCTGGGTCTGGG + Exonic
1161771490 19:6233445-6233467 ACACCTCCCCGCCTGGGGCTGGG - Intronic
1161811716 19:6475342-6475364 ACACCCCTTCCCCGGGGGCCAGG + Exonic
1161839007 19:6667378-6667400 ACACCTCCTTCCCTGGGGCCAGG + Intronic
1162657292 19:12140523-12140545 ACAACTCCTTCCCTGAGCCCTGG + Intronic
1162834602 19:13308074-13308096 ACTCCTGGTTCCCTGGGGTCAGG - Intronic
1163054770 19:14710053-14710075 ACACCATCTTCCATGGGCCCTGG - Intronic
1163300387 19:16441792-16441814 AGGCCTCCTTCCATGGGGCCCGG - Intronic
1163410249 19:17149548-17149570 GCACCTCCCTCCCTGGGGCGAGG - Intronic
1164573009 19:29387631-29387653 TCACTTCCTCCCCTGGGCCCTGG + Intergenic
1164624227 19:29715592-29715614 AGACCTCCCTCCCTTTGGCCTGG + Intronic
1164838851 19:31377331-31377353 GCACCTCCTCCCCTGGGGAAGGG - Intergenic
1165844790 19:38811270-38811292 ACTCCTCCATCCCTAGTGCCAGG + Intronic
1165907643 19:39203601-39203623 AAATCTCCGTCCCAGGGGCCTGG + Intronic
1166131899 19:40750683-40750705 CCACCTCCTTCCGTGGCGCCCGG - Intronic
1166222883 19:41376885-41376907 ACAGTCCCTTCCCTGGGTCCTGG + Intronic
1166304476 19:41929680-41929702 ACACCACCTTCTCTGGGGAAAGG + Intronic
1166764633 19:45245468-45245490 ACCCCTCCCTCTCTGGGGCCAGG + Intronic
1167301792 19:48681936-48681958 ACGCCTTCTTCCCTGCGCCCAGG - Intergenic
1167539307 19:50075202-50075224 CCAGCCCCTTCCCTGTGGCCAGG - Intergenic
1167630400 19:50622656-50622678 CCAGCCCCTTCCCTGTGGCCAGG + Intronic
1168255757 19:55164183-55164205 AAACCTCTTTTCTTGGGGCCGGG + Intronic
925005596 2:440938-440960 CCACCTGCTTCCCCGAGGCCTGG - Intergenic
925123515 2:1437815-1437837 ACCCCTCCTGCCCTGAAGCCTGG + Intronic
926060339 2:9801079-9801101 TGCCCTCATTCCCTGGGGCCTGG - Intergenic
927422090 2:22944357-22944379 GCACCTGCTGCCCCGGGGCCTGG - Intergenic
927878734 2:26675828-26675850 ACAGCTCCTTCCCAAAGGCCAGG + Intergenic
928645163 2:33344517-33344539 ACCTCTCCTTCCCTGAGCCCTGG + Intronic
928648921 2:33384561-33384583 TCACCTCCTTGTCTGGGGCTCGG - Intronic
929600222 2:43199997-43200019 ACACCACATACCCTGGAGCCAGG - Intergenic
930422723 2:51174742-51174764 TCACCTCCTTCCGTGTGGCCTGG - Intergenic
933710521 2:85322342-85322364 TGACCACCCTCCCTGGGGCCCGG - Exonic
933815341 2:86063499-86063521 ACACCTCATTCTGTGAGGCCAGG + Intronic
934511529 2:94948019-94948041 CCAGCCCCTTCCCTGGAGCCTGG + Intergenic
934852907 2:97712748-97712770 GCACCCCCTACCCTTGGGCCTGG - Intergenic
935579449 2:104744074-104744096 ACCCCTCCTTTCCTGTGGCTTGG - Intergenic
936545660 2:113390871-113390893 ACAAGTCCTTCCTTGCGGCCAGG + Intergenic
937014237 2:118589066-118589088 TCACCTCCTGCTGTGGGGCCTGG + Intergenic
937096217 2:119236843-119236865 ACACATCATCCCCTGGGCCCTGG + Intronic
937223822 2:120356955-120356977 TCACCTCTGTCCCTGGGGCTGGG - Intergenic
937260938 2:120586559-120586581 ACTCCTCTTTCCATGGGCCCGGG - Intergenic
937609329 2:123840947-123840969 ACACCTGCTTGCCTGGTTCCTGG + Intergenic
937917284 2:127105495-127105517 CCTCCTCCTTCCCTGGGGTGGGG + Intronic
937923221 2:127146790-127146812 ACACCATCTCCCCTGTGGCCTGG - Intergenic
937986439 2:127640220-127640242 CCACCTGCTCTCCTGGGGCCTGG - Intronic
938409178 2:131049614-131049636 ACACCTTCTCCCCTGAGGCTTGG - Exonic
941658788 2:168172956-168172978 ACAGCAGCCTCCCTGGGGCCGGG - Intronic
943614831 2:190081232-190081254 ACAACTCCTTCCCTGGATCTAGG + Intronic
946146521 2:217735231-217735253 TCACCTCCTGCTCTGTGGCCTGG + Intronic
946408642 2:219505774-219505796 ACCCTTCCCTCCCTGGGGCTGGG - Intronic
947463958 2:230325287-230325309 ACATCTCCTTCCCTGCTGTCAGG + Intergenic
947472873 2:230414422-230414444 ACATCTCCTTCCCTGCTGCCAGG + Intergenic
947924737 2:233911429-233911451 CCACCTCCTTCACTCGGTCCTGG + Intergenic
948237476 2:236401443-236401465 ACCCCGCCAGCCCTGGGGCCTGG + Intronic
948400129 2:237678321-237678343 ACACCTCTTTCCCTGCAGCAGGG + Intronic
948830671 2:240596950-240596972 CCCCCTCCCTCCCTGGGGCAAGG - Intronic
948890045 2:240903181-240903203 ACGCCTCCCTCCCTGGGACTGGG - Intergenic
948977961 2:241475399-241475421 TCACCTCCTGCCGTGTGGCCTGG - Intronic
949054931 2:241922397-241922419 ACGTCTCCATCCCTGGTGCCCGG + Intergenic
949054950 2:241922460-241922482 ACGTCTCCATCCCTGGTGCCCGG + Intergenic
1169080931 20:2797394-2797416 TGAGCTCCTTCCCTGGGTCCTGG - Intronic
1169322020 20:4640785-4640807 TCACCTCCTGCTGTGGGGCCCGG - Intergenic
1170321432 20:15103478-15103500 TCACCTCCTTCCCTGTGACTTGG - Intronic
1171508640 20:25661100-25661122 TCACCTCCTGCTCTGTGGCCCGG + Intergenic
1172629615 20:36369092-36369114 ACACCTCCCTCGCTGCCGCCCGG - Intronic
1173886653 20:46465162-46465184 CCACCCCCATCCCTGGGGACGGG - Intergenic
1174085746 20:48006166-48006188 CCACAACCTTCCCTGGGGCTCGG - Intergenic
1174194533 20:48763713-48763735 GCACCTCCCTCACTGAGGCCTGG - Intronic
1174855770 20:54043702-54043724 ACACCCCCTTCCCTGGGGGTGGG - Intronic
1175645001 20:60663641-60663663 TCACCTGCATCCCTGGAGCCTGG - Intergenic
1175825384 20:61933939-61933961 GCACCTGCTGCCCTGTGGCCTGG - Intronic
1176929063 21:14786343-14786365 ATTCCTCCATCCCTGGGCCCAGG - Intergenic
1178325292 21:31640924-31640946 TCACCTCCTGCCATGTGGCCCGG + Intergenic
1178952146 21:36993959-36993981 AGGCCTCCTTACCAGGGGCCTGG - Intergenic
1179794876 21:43776755-43776777 ACACCTGCTCCCGCGGGGCCGGG - Intergenic
1180211871 21:46299755-46299777 ACACCTCCTTGCCTGTGGTGGGG - Intergenic
1180354086 22:11824583-11824605 TCAGCCCCTTCCCTGGGCCCTGG - Intergenic
1180384159 22:12167742-12167764 TCAGCCCCTTCCCTGGGCCCTGG + Intergenic
1180701472 22:17783681-17783703 ACTACCCCCTCCCTGGGGCCAGG + Intergenic
1180796932 22:18610466-18610488 ACACCTCCACCCCTGGCTCCCGG - Exonic
1180831905 22:18910872-18910894 CCACCGCCTGCCGTGGGGCCGGG - Exonic
1181052570 22:20244750-20244772 GCACTTCCTGTCCTGGGGCCAGG + Intronic
1181224792 22:21384805-21384827 ACACCTCCACCCCTGGCTCCCGG + Exonic
1181253840 22:21550008-21550030 ACACCTCCACCCCTGGCTCCCGG - Exonic
1181867907 22:25873833-25873855 ACCCAGCCTTTCCTGGGGCCTGG + Intronic
1182195641 22:28513439-28513461 AAAACTCCTTCCTTAGGGCCAGG + Intronic
1182461400 22:30486294-30486316 ACACCCGCAACCCTGGGGCCTGG + Intergenic
1182758998 22:32706883-32706905 TCACCTTCTTCCCTGGCCCCTGG + Intronic
1183142452 22:35955732-35955754 TCACCTCCTGCCGTGTGGCCTGG + Intronic
1183282334 22:36938320-36938342 AAACCTTCTTCCCCGGGACCCGG + Exonic
1183286243 22:36965956-36965978 ACCCCTCCTTCCCCGGGTCAGGG - Intergenic
1184005748 22:41707286-41707308 ACAACTCCCTCACTGGGGCTGGG + Intronic
1184320488 22:43738963-43738985 GCACTTCCTTGCCTGGGGACAGG - Intronic
1184336302 22:43855174-43855196 CCACCTCCTTCCAATGGGCCTGG - Intronic
1184419673 22:44372379-44372401 ACAGCACCTTCCCAGGGGGCAGG + Intergenic
1184663346 22:45975678-45975700 TCACCGCCTTGCCTGTGGCCTGG + Intronic
1184679422 22:46062082-46062104 GCACCTCCCGCCCCGGGGCCGGG + Intronic
1184787552 22:46679137-46679159 ACACCTCTCTCCCCAGGGCCCGG + Exonic
1185137914 22:49083814-49083836 ACACCGCCTTCCCTGGATGCAGG + Intergenic
1203281983 22_KI270734v1_random:136143-136165 CCACCGCCTGCCGTGGGGCCGGG - Intergenic
950398727 3:12753877-12753899 AGCCCTCCTGCCCTGGGCCCAGG - Intronic
951319129 3:21223922-21223944 CCTCCTCCTTCCCTGAGGTCAGG - Intergenic
952089647 3:29868944-29868966 ACCTCTCCTTCCCTGGGCCAAGG - Exonic
952339269 3:32431967-32431989 ACACCTCCTACCCTGGGGGTGGG + Intronic
953943120 3:47119964-47119986 ACATCTCCTTTCCTGGGGATGGG + Intronic
954707770 3:52490125-52490147 TCACCTCCAGCCCTGGGGTCTGG - Exonic
956637692 3:71382482-71382504 ATACCACCCTCCCTGTGGCCAGG - Intronic
960702582 3:120451645-120451667 TCCCCTCCTTCCCTCGGGCCGGG + Intergenic
960823417 3:121758125-121758147 ACACCTCCTGCTGTGTGGCCTGG + Intergenic
961032711 3:123620418-123620440 ACAGCTGCTTCTCTGGGGCTGGG - Intronic
961321924 3:126082735-126082757 ACACATCCTGCCCGGGGACCTGG + Intronic
961329145 3:126128689-126128711 ACACATCCTGCCCTGGGGCCTGG - Intronic
961457820 3:127032977-127032999 CCACCTGGTTCCTTGGGGCCAGG + Intronic
962708716 3:138068157-138068179 ACCCCTCCTTCCTCGGGGCCCGG - Exonic
963121994 3:141784172-141784194 ACAGCTCCTTCCTTGGCTCCCGG + Intronic
967824613 3:193868488-193868510 ATACCTGCTTCTCTTGGGCCAGG - Intergenic
967910319 3:194537394-194537416 ACAGCTCCCTTCCTGGGGCCTGG + Intergenic
967998288 3:195183366-195183388 GCACCTTCTTCCCAGGGGTCAGG - Intronic
968656565 4:1780886-1780908 TCCCCTCATTCCCTGGGGCCTGG + Intergenic
968808330 4:2788862-2788884 CCACCTGCTTCCCTGGGGATAGG - Intergenic
968983880 4:3865144-3865166 CCACCTCCCTGCCTGGGCCCAGG + Intergenic
969533653 4:7742554-7742576 CCACCTCCTTCCCAGGTGCTTGG - Exonic
969578151 4:8048388-8048410 ACAGCTGCCTCCCTGGGGCCAGG - Intronic
969611991 4:8232589-8232611 TCACCTGCTTCCCTGGGGCAGGG + Intronic
970046708 4:11862217-11862239 ACACATCCTTCGAGGGGGCCAGG + Intergenic
973647916 4:52968618-52968640 ACACCCACTTCCCTGTGGCTAGG - Intronic
976705624 4:88016154-88016176 TCACCTCCTGCTGTGGGGCCCGG + Intronic
977305981 4:95324150-95324172 ACACCTCCTGCCATGTGGCCCGG - Intronic
979665663 4:123308412-123308434 TCACCTCCTACCGTGTGGCCTGG - Intronic
980306402 4:131065677-131065699 ACACCTCCTGCACTGCAGCCTGG + Intergenic
982158037 4:152540469-152540491 GCACTTCCTCCCCTGAGGCCCGG - Intergenic
984852264 4:184164498-184164520 ACATCATCTTCCCTGGGGGCAGG - Intronic
985146971 4:186903470-186903492 ACACTCCCTTGCCTGGGCCCTGG + Intergenic
985517452 5:354285-354307 ATCCCTCATTCCCTGGAGCCGGG - Intronic
986236726 5:5917490-5917512 ACACAGCCCTCCCTGGGGCTTGG - Intergenic
986762133 5:10889810-10889832 ACCCCTTCTTCCCTGGCTCCAGG - Intergenic
987193080 5:15499644-15499666 AAACCTCCTTCACCGGGGCGGGG + Intergenic
988805025 5:34732183-34732205 ACACCACCTTCCCTGGCAGCAGG - Intronic
988882280 5:35516605-35516627 TCACCTCCTGCTGTGGGGCCTGG - Intergenic
989145944 5:38250287-38250309 ACCCTTCCTTCCCTGGGACTGGG + Intergenic
991677768 5:69105740-69105762 TCACCTCCTGCTCTGTGGCCTGG - Intronic
994166593 5:96615591-96615613 TGGCCTCCTTCCCTGGGGCCTGG - Intronic
995256210 5:110049661-110049683 ACTTCTCCATCCCTGGGGCTGGG + Intergenic
995636731 5:114201683-114201705 ACCCCGCCTTCTCTGGTGCCAGG - Intergenic
996409275 5:123139615-123139637 ACACCTGCATCCCTGAGGACTGG - Intronic
997210573 5:132074566-132074588 TCACCTCCTTCCCTAAGGCTGGG + Intronic
997232226 5:132253457-132253479 ACACATCTGTCCCTGGGGCAAGG + Intronic
997485405 5:134226484-134226506 TCAGCTCCTCACCTGGGGCCTGG + Intergenic
998006058 5:138657767-138657789 ACCCTCCCTTCCCTGGGGTCTGG + Intronic
998104398 5:139459218-139459240 TCAGCCCCTTCCCTGGGGGCAGG - Intronic
998183219 5:139959965-139959987 GCACCTCTATCCCTGGGTCCTGG + Intronic
998477378 5:142433170-142433192 ATACTTCCTTGCCTGCGGCCTGG + Intergenic
999316261 5:150585950-150585972 GCTCCTCCTTCCATGGGGCCTGG - Intergenic
1000065425 5:157690084-157690106 ACACTGCTTCCCCTGGGGCCCGG - Intergenic
1000831774 5:166110951-166110973 ACTCCTTCTTGCCTGGGGACTGG + Intergenic
1001843018 5:174895600-174895622 TCACCTCCTGCTCTGTGGCCTGG + Intergenic
1002100696 5:176856095-176856117 AGGCCTCCGTCCCTGGGGGCAGG - Intronic
1002415612 5:179119472-179119494 GGACCTCCTGACCTGGGGCCTGG - Intronic
1002674655 5:180900990-180901012 ACAGCTCCGTCCCTGGAGCCTGG - Intronic
1002683817 5:180991060-180991082 ACAGCTCCGCCCCTGGAGCCTGG - Intronic
1003007213 6:2393080-2393102 TCACCTCCTGCTCTGTGGCCTGG + Intergenic
1004481804 6:16026532-16026554 ACACCTCCTTCCATGGTACCTGG - Intergenic
1005926519 6:30449888-30449910 GCACCTCCAGCCCTGGGTCCTGG - Intergenic
1005928234 6:30462460-30462482 GCACCTCCAGCCCTGGGTCCTGG - Intergenic
1006187958 6:32191211-32191233 ACATCACCTTCCCTGGGAACTGG - Exonic
1007178046 6:39909770-39909792 ACACCTCCCTCCCAGGGACAAGG + Intronic
1007390494 6:41547263-41547285 ACACCCCATTCCCAGAGGCCCGG - Intronic
1007765762 6:44158916-44158938 ACAGCTCCTCCCCTGGGGGGAGG - Intronic
1008543258 6:52564184-52564206 ACACCTCTTTCCTTGGGTCATGG + Intronic
1008679150 6:53853806-53853828 ACACCTGCTTCCAAGGGACCTGG - Intronic
1009296063 6:61949102-61949124 ACAGCCTCTTCCATGGGGCCTGG - Intronic
1009582062 6:65549112-65549134 TCACCTCCTGCCGTGAGGCCTGG + Intronic
1012147654 6:95706436-95706458 AGTCCTCCTTACCTGGTGCCAGG + Intergenic
1013304814 6:108838363-108838385 ACACCTCCCTCACTCAGGCCTGG - Intergenic
1013472200 6:110475936-110475958 ACACCTCCTTTGCAGGGTCCCGG + Intronic
1015074165 6:129134738-129134760 ACACCTCCTTCTGTGCAGCCTGG + Intronic
1015254736 6:131165610-131165632 AGAGCTCTTTGCCTGGGGCCTGG + Intronic
1016651694 6:146469241-146469263 AGATTTCCTTCCCTGGAGCCAGG - Intergenic
1017690068 6:156955652-156955674 TCAGCTCCTTCCCTGTGTCCAGG + Intronic
1017821114 6:158049640-158049662 ACAGCTGCTTCCCTGGGCTCAGG - Intronic
1018867204 6:167755578-167755600 CCACCTCTCTCACTGGGGCCTGG + Intergenic
1019512420 7:1424316-1424338 ACACCGTCTGCGCTGGGGCCTGG - Intergenic
1020008124 7:4792953-4792975 TCCCCTCCTGCCCTGGGGCGGGG + Intronic
1023132542 7:37017148-37017170 ACTCCTCCTTTCCTGGGTCTGGG + Intronic
1023393013 7:39728568-39728590 GCCCCTCTTTCCCTGGGACCGGG - Intergenic
1023418038 7:39950423-39950445 ATTCCTGCTTCCCTGGGGCCCGG + Exonic
1023874664 7:44280364-44280386 CCACCTCGTGCCCTGTGGCCTGG - Intronic
1023882171 7:44326620-44326642 AAACAGCCTTCCCTGAGGCCTGG + Intronic
1024272809 7:47655324-47655346 CTGCCTCCCTCCCTGGGGCCCGG - Exonic
1024550412 7:50558420-50558442 ACAGCTGCTGGCCTGGGGCCTGG + Intronic
1026894662 7:74003145-74003167 CCACCCCCAGCCCTGGGGCCTGG - Intergenic
1028684461 7:93575982-93576004 ACACCTCCTTCTCTGTCACCCGG - Intergenic
1031532679 7:122895345-122895367 TCACCTCCTTCTGTGAGGCCTGG + Intergenic
1033924172 7:146437025-146437047 TCACCTCCTGCCGTGCGGCCCGG - Intronic
1034171314 7:149065514-149065536 CCAGCTCGCTCCCTGGGGCCTGG - Intergenic
1035078604 7:156198114-156198136 CCACCTTCATCCCTGGGCCCAGG + Intergenic
1036677948 8:10850713-10850735 TTACCTCCTTCCCTGGGGAGTGG - Intergenic
1037485880 8:19346262-19346284 TCACCTCCTGCCATGTGGCCTGG - Intronic
1037988662 8:23305463-23305485 ACATCTCCTTCCCAGCTGCCTGG + Intronic
1038240484 8:25803405-25803427 AGCACTCCTTCCCTGGTGCCAGG - Intergenic
1039063665 8:33591892-33591914 ACCCATCCTCCCCTGGGGTCAGG - Exonic
1039377107 8:37045518-37045540 ACATCTCCCTCCCTGGTCCCTGG + Intergenic
1041012494 8:53558650-53558672 ACTCCCCCTTTCCTGGGGGCGGG - Intergenic
1042418272 8:68553088-68553110 ACATATCCTCCACTGGGGCCAGG + Intronic
1043691822 8:83163532-83163554 AACCATCCTTCCCTGGGCCCTGG + Intergenic
1043853922 8:85244028-85244050 AAACCTTCTTTCCTGGGGACTGG + Intronic
1043917018 8:85934635-85934657 AAACCTCCATTTCTGGGGCCTGG - Intergenic
1048011916 8:130464682-130464704 ACACATCATTCCCTGAAGCCTGG + Intergenic
1048081292 8:131130562-131130584 AAACCACCTTGCCTGTGGCCTGG - Intergenic
1048268230 8:133005978-133006000 AGAACTCCTTTCCTGAGGCCTGG + Intronic
1048551049 8:135433798-135433820 CCACATCCTTCTCTGGGGACCGG - Intergenic
1049193688 8:141303845-141303867 ATACCTCCCTCACTGGGGCCTGG + Intronic
1049205988 8:141363829-141363851 CCATCTGCTGCCCTGGGGCCGGG - Intronic
1049323910 8:142011963-142011985 ACAGCTTCTGCCCTGGGGCGTGG - Intergenic
1049685746 8:143938705-143938727 AGACCAGCTTACCTGGGGCCTGG + Intronic
1056775461 9:89509046-89509068 CCACGTCCTTCCCTAGGACCTGG - Intergenic
1057269564 9:93643110-93643132 TCACCTCCTTCTGTGGGGCATGG + Intronic
1057476993 9:95411476-95411498 ACAGCCTCTTCCCTGGGGCTGGG + Intergenic
1057718585 9:97514921-97514943 ACACATCCTGCCCTAGGGCAGGG - Intronic
1057748349 9:97770358-97770380 CCTCCACCTTCCTTGGGGCCTGG - Intergenic
1058766252 9:108185301-108185323 AGTCCTCCTGCCCTGTGGCCTGG - Intergenic
1059728805 9:117035789-117035811 ACTCCTCCATCTCTGGGGCTTGG - Intronic
1060740697 9:126095906-126095928 ACACCTCGGTTCCTGGGGCTTGG + Intergenic
1061114923 9:128604033-128604055 TCACCTCCTAGCCTGGGGCCTGG - Intronic
1061415515 9:130445051-130445073 ACGCCTCCTCCTCTGGGCCCGGG - Intronic
1061500288 9:130997945-130997967 TCCCCTGCTTCCCTGTGGCCTGG - Intergenic
1061811316 9:133164012-133164034 AGAGCCCCTTCCCTGCGGCCTGG + Intergenic
1061871406 9:133522615-133522637 ACACCTCCCTGCCTGGGCCTAGG - Intronic
1062057269 9:134475147-134475169 TCAGCTGTTTCCCTGGGGCCTGG + Intergenic
1062402041 9:136376988-136377010 AGGCCTCCTCCCCTGGTGCCAGG - Intronic
1185667092 X:1774508-1774530 CCACCTCCTGCTCTGTGGCCCGG + Intergenic
1186169494 X:6861836-6861858 ATGCCTCCTTCCCTGGGGTGGGG - Intergenic
1187426955 X:19186543-19186565 AGACCTACTGCCCTGAGGCCGGG + Intergenic
1189115157 X:38334826-38334848 TCACCTCCTGCCGTGTGGCCCGG - Intronic
1189295478 X:39914726-39914748 ACACCACCATCCCAGGGTCCAGG + Intergenic
1189733355 X:44045113-44045135 TCACCTCTTGCCCTGGGCCCAGG - Intergenic
1189742481 X:44134212-44134234 TCACTTCCTTTCCTGGGGCTTGG + Intergenic
1190780485 X:53589816-53589838 ACACTTCCTTCCCTGCTTCCAGG - Exonic
1191975207 X:66863947-66863969 ACACCTCCTGATCTGGGGCTAGG + Intergenic
1192223870 X:69215436-69215458 CCACCTCCATCCCTGGAGACTGG + Intergenic
1192264673 X:69530275-69530297 CAGCCTCCTTCCCTGGGGTCAGG - Exonic
1193143173 X:78050947-78050969 ACACATCCTTCTCTGAGGTCAGG - Intergenic
1194401328 X:93440469-93440491 ACACCAGCTTCCCAGGGGCCTGG + Intergenic
1195293320 X:103450049-103450071 ACACCACACTCACTGGGGCCAGG - Intergenic
1195300400 X:103524570-103524592 ACACCCCACTCACTGGGGCCAGG + Intergenic
1196032285 X:111103647-111103669 TCTCCTCCTTTCCTGGTGCCTGG + Intronic
1196763809 X:119224551-119224573 AAAACACCTTCCCTGGGGCCAGG - Intergenic
1197549631 X:127873968-127873990 TCACCTCCTTCTGTGTGGCCTGG + Intergenic
1198055409 X:132989954-132989976 ACCCCTACTTTTCTGGGGCCTGG - Intergenic
1199711574 X:150473372-150473394 ACAGGTGCTTCCCTTGGGCCAGG - Intronic
1199816048 X:151397471-151397493 CCGCCCCCTTCCCTGAGGCCAGG - Intronic
1200104664 X:153705699-153705721 GCAGCTCCTTGCCGGGGGCCTGG - Intronic
1201559826 Y:15304124-15304146 ATGCCTCCTTCCCTGGGGTGGGG - Intergenic
1201730722 Y:17199899-17199921 CCACCTGCTTTCCTGGGTCCTGG + Intergenic