ID: 1161839585

View in Genome Browser
Species Human (GRCh38)
Location 19:6671265-6671287
Sequence GTGTGTGTGCGCACTTGCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161839583_1161839585 -2 Left 1161839583 19:6671244-6671266 CCTGTGCATTGGTGCGTGTATGT No data
Right 1161839585 19:6671265-6671287 GTGTGTGTGCGCACTTGCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161839585 Original CRISPR GTGTGTGTGCGCACTTGCAC GGG Intergenic