ID: 1161841771

View in Genome Browser
Species Human (GRCh38)
Location 19:6686043-6686065
Sequence GCCTCCTAGAGAAGACACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 225}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161841771_1161841783 26 Left 1161841771 19:6686043-6686065 CCTCAGTGTCTTCTCTAGGAGGC 0: 1
1: 0
2: 1
3: 18
4: 225
Right 1161841783 19:6686092-6686114 TGCATGTGCCTAGGGGCTGTGGG 0: 1
1: 0
2: 0
3: 9
4: 209
1161841771_1161841777 2 Left 1161841771 19:6686043-6686065 CCTCAGTGTCTTCTCTAGGAGGC 0: 1
1: 0
2: 1
3: 18
4: 225
Right 1161841777 19:6686068-6686090 GTGGGAAGCCGCAGGAGACAGGG 0: 1
1: 0
2: 1
3: 23
4: 274
1161841771_1161841780 18 Left 1161841771 19:6686043-6686065 CCTCAGTGTCTTCTCTAGGAGGC 0: 1
1: 0
2: 1
3: 18
4: 225
Right 1161841780 19:6686084-6686106 GACAGGGATGCATGTGCCTAGGG 0: 1
1: 0
2: 2
3: 11
4: 277
1161841771_1161841782 25 Left 1161841771 19:6686043-6686065 CCTCAGTGTCTTCTCTAGGAGGC 0: 1
1: 0
2: 1
3: 18
4: 225
Right 1161841782 19:6686091-6686113 ATGCATGTGCCTAGGGGCTGTGG 0: 1
1: 0
2: 0
3: 13
4: 254
1161841771_1161841779 17 Left 1161841771 19:6686043-6686065 CCTCAGTGTCTTCTCTAGGAGGC 0: 1
1: 0
2: 1
3: 18
4: 225
Right 1161841779 19:6686083-6686105 AGACAGGGATGCATGTGCCTAGG 0: 1
1: 0
2: 1
3: 36
4: 681
1161841771_1161841774 -6 Left 1161841771 19:6686043-6686065 CCTCAGTGTCTTCTCTAGGAGGC 0: 1
1: 0
2: 1
3: 18
4: 225
Right 1161841774 19:6686060-6686082 GGAGGCCAGTGGGAAGCCGCAGG 0: 1
1: 1
2: 5
3: 35
4: 351
1161841771_1161841776 1 Left 1161841771 19:6686043-6686065 CCTCAGTGTCTTCTCTAGGAGGC 0: 1
1: 0
2: 1
3: 18
4: 225
Right 1161841776 19:6686067-6686089 AGTGGGAAGCCGCAGGAGACAGG 0: 1
1: 0
2: 0
3: 24
4: 221
1161841771_1161841781 19 Left 1161841771 19:6686043-6686065 CCTCAGTGTCTTCTCTAGGAGGC 0: 1
1: 0
2: 1
3: 18
4: 225
Right 1161841781 19:6686085-6686107 ACAGGGATGCATGTGCCTAGGGG 0: 1
1: 0
2: 2
3: 17
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161841771 Original CRISPR GCCTCCTAGAGAAGACACTG AGG (reversed) Intronic
901288301 1:8100684-8100706 GCCTCCTAGAGAGGACTCACGGG + Intergenic
901672575 1:10864849-10864871 CCCTCCTGGAGCGGACACTGGGG - Intergenic
901907757 1:12429058-12429080 GCATCCCAGAGTAGACCCTGTGG + Intronic
903156729 1:21449841-21449863 GCCACCTGAAGAAGACAATGAGG - Intronic
903266779 1:22162648-22162670 CCCTTCCTGAGAAGACACTGAGG - Intergenic
903266884 1:22163073-22163095 CCCTTCCTGAGAAGACACTGAGG - Intergenic
904115538 1:28159108-28159130 TCTTCATGGAGAAGACACTGAGG + Intronic
904356620 1:29944429-29944451 GCCTCCTAGGGTACACAGTGAGG - Intergenic
906069538 1:43007177-43007199 GCCTCTTAGAGAAGAAATTACGG + Intergenic
909329672 1:74396343-74396365 CCCTCTTAGAGAAGTCCCTGTGG + Intronic
912964740 1:114227811-114227833 GCCTCCTAGAGAAAATACTTGGG + Intergenic
913073170 1:115319108-115319130 CCATGCTGGAGAAGACACTGTGG - Intronic
913601530 1:120425797-120425819 GCCACCTGAAGAAGACAATGAGG - Intergenic
913992842 1:143630826-143630848 GCCACCTGAAGAAGACAATGAGG + Intergenic
914085519 1:144450798-144450820 GCCACCTGAAGAAGACAATGAGG + Exonic
914191406 1:145414777-145414799 GCCACCTGAAGAAGACAATGAGG + Intergenic
914362721 1:146949374-146949396 GCCACCTGAAGAAGACAATGAGG - Intronic
914488953 1:148137737-148137759 GCCACCTGAAGAAGACAATGAGG + Exonic
914589338 1:149092781-149092803 GCCACCTGAAGAAGACAATGAGG + Exonic
915366919 1:155321893-155321915 CCCTCCTCCAGGAGACACTGGGG + Exonic
915982138 1:160426911-160426933 GCCTCCCAGGGGAGACACTGGGG - Exonic
917471896 1:175332772-175332794 GCTTCCTGGAGAAGGCATTGAGG - Intronic
917504007 1:175612065-175612087 GCATCCTAGAAAGGACTCTGTGG - Intronic
918185641 1:182124759-182124781 GCCTCCAAGAGAATACAGTGAGG + Intergenic
920664601 1:207953340-207953362 GCCCCTTAGAGAAGGCAATGGGG - Intergenic
921584154 1:216928298-216928320 TCCTCTGAGAGGAGACACTGGGG - Intronic
922878960 1:228964763-228964785 GCCTCCAAGACAAGGCACAGGGG + Intergenic
922998771 1:229988183-229988205 GTCTGCTATTGAAGACACTGGGG + Intergenic
1063402538 10:5760491-5760513 CCCTCCTAGAGATGGAACTGAGG - Intronic
1063774391 10:9244597-9244619 CCCTCCAAGAAAAGAGACTGGGG - Intergenic
1065359899 10:24879657-24879679 GAATTCTAAAGAAGACACTGGGG + Intronic
1068221155 10:54047568-54047590 GACTACTAGAGAAGAGACTGGGG - Intronic
1069225229 10:65934890-65934912 GCCTTTTAGAGAAAATACTGGGG + Intronic
1069850232 10:71399361-71399383 GCCTCTTAGAGAAGGCACTGTGG - Intronic
1069997998 10:72354790-72354812 GCTTCCTGGAGAAGGCACAGCGG - Exonic
1070539162 10:77403761-77403783 GCCTCCTGCAGAAGACCCTGGGG + Intronic
1070638741 10:78150496-78150518 GCTTCCTAGAGCAGAGCCTGAGG + Intergenic
1070702339 10:78613134-78613156 GTATCCTAGGGAAGATACTGAGG - Intergenic
1073379481 10:103066837-103066859 GGGCCCTAGAGATGACACTGTGG - Intronic
1075623809 10:123947558-123947580 AGCTCCTACAGAAGCCACTGCGG + Intergenic
1076537278 10:131187721-131187743 GCCCCCAAGAGAGGACGCTGGGG + Intronic
1076720448 10:132390059-132390081 GACTCCTAGGGGAGACAGTGTGG - Intergenic
1077039103 11:510203-510225 GCCATCTAGAGAAAACACCGTGG + Intergenic
1077445550 11:2589028-2589050 TCCTCCTTGGGAAGACTCTGAGG - Intronic
1080820092 11:35797444-35797466 TCCTTCCAGAGAATACACTGTGG + Intronic
1081006836 11:37755006-37755028 GTAAACTAGAGAAGACACTGTGG - Intergenic
1081442174 11:43092789-43092811 TCCTTCTGTAGAAGACACTGCGG + Intergenic
1082884842 11:58070719-58070741 GCTTGATAGTGAAGACACTGTGG - Intronic
1082956032 11:58870851-58870873 GCATCCTTGAGAAGATACTCAGG + Intronic
1083206325 11:61151520-61151542 CCATCTTATAGAAGACACTGAGG - Intronic
1084013895 11:66367638-66367660 GACCCCCAGAGAAGACACTGAGG - Intronic
1084194499 11:67516732-67516754 GGCTCCCAGAGAAGCCACTGAGG + Intergenic
1090187747 11:124749355-124749377 ACTTCCTAGAGAGGAAACTGAGG - Intronic
1090769301 11:129905459-129905481 GCCTCCTGGACAGGGCACTGAGG + Intronic
1091206001 11:133821600-133821622 GCCTCCTAGAGGGTACACAGGGG + Intergenic
1091826720 12:3518317-3518339 CCCTCCTAGAGAAGCCTCTATGG + Intronic
1095086628 12:38063243-38063265 GCCTACTACAGAAGATACTTGGG - Intergenic
1095804516 12:46303831-46303853 GGCTCCAACAGCAGACACTGAGG + Intergenic
1097580700 12:61453397-61453419 GCCTCATGAAGAAGAAACTGAGG - Intergenic
1099742573 12:86659752-86659774 GCCTGGCAGAGAAGTCACTGTGG + Intronic
1099983066 12:89629103-89629125 GCTTACTGGAAAAGACACTGTGG + Intronic
1101416342 12:104511714-104511736 GTCTCCAAGTGAAGAAACTGAGG - Intronic
1101586557 12:106090344-106090366 GCCTCCTTGATGAAACACTGAGG - Intronic
1102044783 12:109822975-109822997 GACTCCTAGAGAAGGCAGAGCGG + Intronic
1102261702 12:111447104-111447126 GCCTGCTGGAGAAGAGGCTGAGG - Exonic
1103463881 12:121126460-121126482 GCCACGTAGAGAAGAGAGTGAGG + Intergenic
1104561843 12:129852829-129852851 GCCTCCAAAAGAAGATTCTGTGG + Intronic
1106085045 13:26534376-26534398 TCCTGCAAGAGAAGACCCTGTGG + Intergenic
1107937515 13:45357492-45357514 GCCTCTTGGGGAAGACAGTGTGG + Intergenic
1114537945 14:23434789-23434811 TTCTCAGAGAGAAGACACTGTGG + Intronic
1115965331 14:38880891-38880913 GCCTTCATGAGAAGAAACTGAGG - Intergenic
1116440015 14:44940563-44940585 GCCTGCTAGAGAAGAAAGTGGGG - Intronic
1118611947 14:67548113-67548135 GCCTGCTAGAGAAGCCACAAAGG + Intronic
1121892737 14:97611176-97611198 GACTCCAAGAGCATACACTGGGG - Intergenic
1124113735 15:26819730-26819752 GGCGCCTAGAGCATACACTGGGG + Intronic
1124196325 15:27633533-27633555 CCCTGCTAGAGAAAACACAGGGG + Intergenic
1124626449 15:31310214-31310236 GCCTTCTGGAGAGCACACTGGGG + Intergenic
1128765872 15:70250813-70250835 GCCTCCTTGAGAAGAGGCAGGGG - Intergenic
1129387532 15:75203937-75203959 CCAGCCTAGAGAAGACACAGAGG - Intronic
1133212368 16:4270794-4270816 GCCTACTGGAGAAGACATTCTGG - Intronic
1133317344 16:4892853-4892875 CCATCCTACTGAAGACACTGAGG + Intronic
1134027542 16:10965822-10965844 GCCTCCAAGAGATGACTCTGTGG - Intronic
1137237762 16:46629364-46629386 TTCTCCTACAGAAGACACTCAGG - Intergenic
1137495272 16:48964631-48964653 GCCTTGAAGAGAAGAGACTGGGG - Intergenic
1137766298 16:50980139-50980161 GGCCTCAAGAGAAGACACTGAGG + Intergenic
1137856114 16:51796299-51796321 ACCTCCTAGAGAAGTGACTTAGG - Intergenic
1139063323 16:63282311-63282333 GCTTCCTAGAGAAGAATTTGTGG - Intergenic
1140012852 16:71153540-71153562 GTCTCCCAGGGAAGACAATGGGG + Intronic
1141296487 16:82774491-82774513 ACCTCCTAAAGAATACACAGTGG - Intronic
1141646101 16:85368779-85368801 GCCCCCTAGAGAAAACAGGGTGG - Intergenic
1142070660 16:88089976-88089998 GCCTGAGAGAGAAGACACTCGGG - Intronic
1142243296 16:88956815-88956837 GCCACCTGGAGAAGGCACAGAGG - Intronic
1143251203 17:5524555-5524577 GCCTCTTGGAGAAGCAACTGGGG - Intronic
1144647436 17:16984972-16984994 GAATCCTAGAGGAGACACAGAGG - Intergenic
1144890908 17:18493879-18493901 GCCTCATGGAGAAGGCATTGGGG + Intronic
1144932016 17:18867264-18867286 GCCGCCTAGAGAAGAGAAAGGGG - Exonic
1145141316 17:20450439-20450461 GCCTCATGGAGAAGGCATTGGGG - Intronic
1145796007 17:27655701-27655723 GGCCCATAAAGAAGACACTGGGG - Intergenic
1146275254 17:31512268-31512290 GCCCCCTAGAGCTGCCACTGAGG + Intronic
1147401791 17:40184624-40184646 GCCTCCGAGAGGACACTCTGAGG + Exonic
1148566676 17:48636977-48636999 GCTTGCAAAAGAAGACACTGAGG + Intergenic
1148657442 17:49298381-49298403 GTCTCCTGGAGAACACACTAAGG + Exonic
1149880928 17:60289472-60289494 TCCTCCTAGAGTAGACATTCAGG + Intronic
1150070970 17:62149503-62149525 GCCTCTTAGTGAAGAAACTAAGG + Intergenic
1151328663 17:73394092-73394114 GCCTCCTAGAGTGGATACAGGGG - Intronic
1151657687 17:75503320-75503342 GTCTCCAAGAGAAGACAGTATGG - Intronic
1153640795 18:7155300-7155322 GCCTCCTCCAGGAGACACTCTGG + Intergenic
1156151007 18:34242893-34242915 GCCTCTGAGAGAAGACTATGGGG + Intergenic
1157166849 18:45365574-45365596 CCTTGCTAGAGAAGAAACTGAGG + Intronic
1159147696 18:64475747-64475769 GCCTGCTAAATCAGACACTGGGG + Intergenic
1159660094 18:71084732-71084754 GCCTCGTATAGATGACAATGTGG + Intergenic
1159893211 18:73972398-73972420 GCCCCCATGAGCAGACACTGGGG - Intergenic
1160445123 18:78921691-78921713 ACCTCCCAGAGTAGACGCTGAGG + Intergenic
1160506997 18:79432774-79432796 GCCTCCTACAGAACACAGTTGGG + Intronic
1161841771 19:6686043-6686065 GCCTCCTAGAGAAGACACTGAGG - Intronic
1162042225 19:7977880-7977902 GCATCCTAGAGGAGACCCAGTGG - Intronic
1164790123 19:30970318-30970340 GCTTCCTAAAGAAAACATTGAGG + Intergenic
1164799804 19:31067223-31067245 GGCCCCTAGAGCAGACTCTGAGG + Intergenic
1166101939 19:40576370-40576392 GCCGCCTGGAGAAGCCGCTGGGG + Exonic
1166272851 19:41727765-41727787 GCCTACTCAAGAAGACACAGGGG + Intronic
1166514108 19:43432984-43433006 GCCTGGTGGAGAATACACTGGGG + Intergenic
926128189 2:10284667-10284689 GCCTCCCAGGGAACACAGTGTGG - Intergenic
926303574 2:11620934-11620956 GCATCCTGGACAGGACACTGAGG - Exonic
928143935 2:28754240-28754262 GGTTACTAGAAAAGACACTGGGG + Intronic
928427224 2:31189283-31189305 GCTTCCTGGAGAAGACCCTGAGG + Exonic
929598813 2:43192346-43192368 GCCTCCTACAGGGGACTCTGAGG - Intergenic
929967665 2:46547761-46547783 CCCTCCTTGAGCAGACAATGGGG - Intronic
931049310 2:58393064-58393086 GCCGGCTACAGAAGACACGGAGG + Intergenic
931461050 2:62450481-62450503 GCCTCCTTGAGAAGATGATGAGG + Intergenic
932010076 2:67967524-67967546 GACTCTCAGAGTAGACACTGGGG + Intergenic
932672034 2:73746270-73746292 GCCTTCCAGAGAAGACACACAGG - Intergenic
932836905 2:75046433-75046455 GACCCCTAGAGAAGAGACAGAGG + Intergenic
933581864 2:84136186-84136208 GTCTCCTAGGGAAGATACTGAGG - Intergenic
935340998 2:102059858-102059880 GCCTCCTGGAGAAGCCATGGAGG - Intergenic
936269894 2:111041540-111041562 GGCTGCTGGAGATGACACTGGGG + Intronic
938258720 2:129880369-129880391 GCCTCCTTGAGCAGGGACTGAGG - Intergenic
938748770 2:134308053-134308075 TTCTACTACAGAAGACACTGAGG - Intronic
940400064 2:153238429-153238451 AACTCATAGAGAAAACACTGGGG - Intergenic
944511058 2:200466569-200466591 CACACGTAGAGAAGACACTGGGG - Intronic
946720406 2:222599952-222599974 GCCTCCTGGTGAAGACAAGGGGG - Exonic
947859044 2:233345779-233345801 GCATCCTAGAGTTGAGACTGGGG + Intronic
1169016004 20:2293293-2293315 CCCTCCTAGAGAAGACCAGGTGG + Intergenic
1169323655 20:4656760-4656782 ACCTCCTCCAGCAGACACTGTGG - Intergenic
1171147073 20:22794249-22794271 GCTTCTTAGAGAGGGCACTGGGG + Intergenic
1175977054 20:62716276-62716298 GCATCTTAGAGAAGACCCAGGGG - Intronic
1179835181 21:44026857-44026879 GCCTACGAGAGAAGACCCTGAGG - Intronic
1180594464 22:16964195-16964217 GCCTTCTAGAGAGGAGGCTGCGG - Intronic
1180733123 22:17996841-17996863 GCCACCTAAAGCAGAAACTGAGG + Intronic
1181113883 22:20618924-20618946 GCCTCCTGGGGAAGGCAATGGGG + Intergenic
1181517814 22:23425832-23425854 GCCACCTAAAGCAGAAACTGAGG + Intergenic
1181517820 22:23425876-23425898 GCCACCTAAAGCAGAAACTGAGG + Intergenic
1181517826 22:23425920-23425942 GCCACCTAAAGCAGAAACTGAGG + Intergenic
1181517832 22:23425964-23425986 GCCACCTAAAGCAGAAACTGAGG + Intergenic
1181517838 22:23426008-23426030 GCCACCTAAAGCAGAAACTGAGG + Intergenic
1182634732 22:31716641-31716663 GGCTTCTAGAGAAGAAAATGAGG - Exonic
1183083109 22:35469792-35469814 ACCTCCTGGAGAAGCCAGTGAGG + Intergenic
1184124701 22:42478968-42478990 GCCTCCTCCAGAAACCACTGGGG - Intergenic
1184583227 22:45430827-45430849 GCCTCCTAGATAATCCCCTGGGG + Intronic
950096680 3:10334750-10334772 GCCTCCTACTGGAGGCACTGAGG + Intronic
951045337 3:18031434-18031456 ACCTCATAGAGGAGATACTGAGG - Intronic
951500425 3:23380523-23380545 GCCTGCTAAAGAAGAAAGTGAGG - Intronic
954416276 3:50394960-50394982 GCTTGCTGGAGAAGACGCTGGGG + Intronic
956055065 3:65289963-65289985 GCCTCCCACAGGAGGCACTGGGG - Intergenic
960807279 3:121596377-121596399 GTTTCCTAGAGGAGAAACTGAGG - Intronic
962257070 3:133879613-133879635 TCCTCATAGCTAAGACACTGGGG - Intronic
962600723 3:136989152-136989174 GCCTCCTGGAGAAGGAACAGTGG + Intronic
962658836 3:137579887-137579909 GCTTCAGGGAGAAGACACTGTGG - Intergenic
963057634 3:141200406-141200428 GACACATAGAGAACACACTGGGG + Intergenic
963288937 3:143466847-143466869 GCCTCCTGGAAAAGTCAGTGTGG + Intronic
964628698 3:158784893-158784915 TCCTCCTAGAGAAGAAAAGGAGG - Intronic
966814328 3:183877361-183877383 TACTCCTGGTGAAGACACTGTGG + Intronic
967196672 3:187032392-187032414 GCCCCCTGTAGAAAACACTGTGG - Intronic
967264893 3:187681860-187681882 GCCTCTTAAAGAAGAAAATGAGG - Intergenic
968134667 3:196212289-196212311 GCCTCAAAAAGAAGAAACTGAGG + Intronic
969530565 4:7728191-7728213 GCCTGCTTGAGAAGACGATGGGG + Intronic
973693068 4:53460070-53460092 GCCTCCTAGAAACTACACTATGG - Intronic
982720209 4:158851644-158851666 TCCTCCTTTGGAAGACACTGGGG + Intronic
984620341 4:181944971-181944993 GCCTCTCAGGGAAGACACTGTGG + Intergenic
987309729 5:16670739-16670761 GCTTCCTAGAGGGGACCCTGAGG - Exonic
990621784 5:57567802-57567824 GCCTCCTAGAGAAGAAAGCAGGG - Intergenic
992144314 5:73830044-73830066 GACTCCCATAGGAGACACTGGGG + Intronic
995814791 5:116155763-116155785 GCCTACAAGAGTAGAAACTGTGG - Intronic
998036769 5:138923978-138924000 GCCTCCTCTAGAGGACCCTGAGG - Intronic
999512044 5:152262520-152262542 GCATTTTACAGAAGACACTGAGG - Intergenic
1000171440 5:158706682-158706704 GCCACCAAGGGAAGACACTGTGG + Intronic
1001114837 5:168930879-168930901 GCCTCCTAGACAATAACCTGTGG + Intronic
1001970859 5:175953937-175953959 GCTTCCTGAAGAAGGCACTGGGG - Intronic
1002075312 5:176705047-176705069 GTTTCCTAGAGAAGCCACTCCGG + Intergenic
1002246579 5:177889827-177889849 GCTTCCTGAAGAAGGCACTGGGG + Intergenic
1002614743 5:180444289-180444311 AACTCTTAGAGAAAACACTGGGG - Intergenic
1003611512 6:7618678-7618700 GCCTCCTACAGAAGCAAGTGGGG + Intergenic
1006192354 6:32217362-32217384 GCTTCCCAGAGAAGACACCTGGG + Intronic
1006988819 6:38195355-38195377 GCCTACTAGAGAAGAGATTCTGG - Intronic
1009559755 6:65223765-65223787 GCCTCGGAAAGAAGAGACTGGGG + Intronic
1013805310 6:113989913-113989935 GCCTGCTGGAGAGGAAACTGTGG + Intronic
1014884182 6:126759500-126759522 TCCTCATGTAGAAGACACTGGGG + Intergenic
1016324057 6:142879746-142879768 GCTGCCTGGAGAAGAGACTGTGG - Intronic
1016642652 6:146367166-146367188 GACTCCAAGAAAATACACTGGGG - Intronic
1016863145 6:148741848-148741870 GCATCCTAGAGTAGCCTCTGAGG - Intergenic
1018560883 6:165099813-165099835 ACCTCCTAGGGAAGAAGCTGGGG + Intergenic
1018982119 6:168609303-168609325 GCCTCACAAGGAAGACACTGAGG - Intronic
1020462945 7:8443971-8443993 ACGCCCTAGAGCAGACACTGCGG + Intronic
1022350546 7:29563677-29563699 GACTCCTTGAGAAGAAACGGCGG - Intergenic
1023362601 7:39431739-39431761 GCTTACTAGACAAGACACAGGGG - Intronic
1028021697 7:85784225-85784247 GCCTCCTAGAACACACAATGAGG - Intergenic
1030428409 7:109409833-109409855 GCCTTCCAGAGAAGACCCAGGGG + Intergenic
1031969543 7:128054193-128054215 GTCTCCTGGAGAAGGCACTGAGG - Intronic
1032862557 7:135894403-135894425 GCCATCTAGTGAAAACACTGTGG - Intergenic
1033264801 7:139875806-139875828 GGCTTCTAGAGAAGACCCTGGGG + Intronic
1033684408 7:143625225-143625247 GAGTCTCAGAGAAGACACTGTGG + Intronic
1033687584 7:143704444-143704466 GAGTCTCAGAGAAGACACTGTGG + Intronic
1033700203 7:143832398-143832420 GAGTCTCAGAGAAGACACTGTGG - Intergenic
1033894900 7:146057366-146057388 CCCTCTTAGAGAAGGCCCTGTGG - Intergenic
1035727456 8:1833756-1833778 GCTTCCTAAAGAAGGCAGTGGGG - Intronic
1035901259 8:3460562-3460584 GCCGCCTAGAGGGGACACTGTGG + Intronic
1036458605 8:8931586-8931608 GTGTCCTAGAAAAGACATTGAGG + Intergenic
1039510644 8:38089317-38089339 GCCTCCCATAGAACTCACTGGGG + Intergenic
1040580902 8:48697706-48697728 GCCTCCTTGACAACAGACTGAGG - Intergenic
1044089928 8:87987426-87987448 GCCTACCAGAGAAAATACTGTGG - Intergenic
1044585459 8:93865373-93865395 GAGGCCTAGAGAAGACAGTGAGG + Intronic
1046908180 8:119596973-119596995 CCCTCCGAGAGAAGTCAGTGAGG - Intronic
1049130467 8:140835643-140835665 ACCTGCTACAGAAGAGACTGGGG - Intronic
1049494740 8:142924400-142924422 GCCGCCTGGAGAAGATCCTGGGG + Intergenic
1049565435 8:143335552-143335574 GCTCCCCAGTGAAGACACTGGGG - Intronic
1051101707 9:13529758-13529780 ACCTCTTAGAGTAGACCCTGGGG + Intergenic
1051393066 9:16587666-16587688 GCCTACTAGAGTAGAAACAGTGG + Intronic
1053540509 9:38968984-38969006 ACCACATAGAGAAGAAACTGGGG - Intergenic
1053804855 9:41791140-41791162 ACCACATAGAGAAGAAACTGGGG - Intergenic
1054140428 9:61524316-61524338 ACCACATAGAGAAGAAACTGGGG + Intergenic
1054625631 9:67394939-67394961 ACCACATAGAGAAGAAACTGGGG + Intergenic
1055284437 9:74713239-74713261 GCTTCCTGGAGAAGATATTGTGG - Intergenic
1056290148 9:85134857-85134879 GCCTCATAGAGGAAATACTGTGG + Intergenic
1057160745 9:92886583-92886605 GCTTCCCAGGGAAGACTCTGGGG + Intergenic
1059177871 9:112183789-112183811 GGCTCCCAGAGAAGGCACTGGGG - Intergenic
1061464073 9:130764001-130764023 GCTTCCCAGAGGAGACACTTAGG + Intronic
1061933682 9:133846123-133846145 CCATCCCAAAGAAGACACTGAGG + Intronic
1062218708 9:135403034-135403056 GCCTCCGAGATTAGACACAGTGG + Intergenic
1062572321 9:137191374-137191396 GCCTCCCAGAGCTGGCACTGTGG - Intergenic
1186792845 X:13015854-13015876 CCCTCCTACTGAAGGCACTGTGG + Intergenic
1187068571 X:15865304-15865326 ACCTCCTAGAGACTACTCTGAGG - Intergenic
1189507264 X:41624385-41624407 GAATCTTAGAGAAGAGACTGAGG - Intronic
1194434668 X:93855839-93855861 GCCTCCTAGGGCAGAGGCTGTGG + Intergenic
1195197334 X:102512110-102512132 GTCTCCTGGAGAAGACTTTGAGG + Intergenic
1200867526 Y:8060811-8060833 TCTGCCTAGAGAAGACATTGTGG + Intergenic
1201516849 Y:14827014-14827036 TCTTGCTAAAGAAGACACTGAGG - Intronic