ID: 1161842732

View in Genome Browser
Species Human (GRCh38)
Location 19:6692799-6692821
Sequence CCCTTTGCAAAGATTGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 149}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161842732_1161842741 -2 Left 1161842732 19:6692799-6692821 CCCAGCCCAATCTTTGCAAAGGG 0: 1
1: 0
2: 1
3: 6
4: 149
Right 1161842741 19:6692820-6692842 GGAATTGGGCAGTGGGCACATGG 0: 1
1: 0
2: 0
3: 37
4: 379
1161842732_1161842743 4 Left 1161842732 19:6692799-6692821 CCCAGCCCAATCTTTGCAAAGGG 0: 1
1: 0
2: 1
3: 6
4: 149
Right 1161842743 19:6692826-6692848 GGGCAGTGGGCACATGGAGGTGG 0: 1
1: 0
2: 2
3: 65
4: 550
1161842732_1161842742 1 Left 1161842732 19:6692799-6692821 CCCAGCCCAATCTTTGCAAAGGG 0: 1
1: 0
2: 1
3: 6
4: 149
Right 1161842742 19:6692823-6692845 ATTGGGCAGTGGGCACATGGAGG 0: 1
1: 0
2: 0
3: 27
4: 232
1161842732_1161842739 -10 Left 1161842732 19:6692799-6692821 CCCAGCCCAATCTTTGCAAAGGG 0: 1
1: 0
2: 1
3: 6
4: 149
Right 1161842739 19:6692812-6692834 TTGCAAAGGGAATTGGGCAGTGG 0: 1
1: 0
2: 1
3: 14
4: 254
1161842732_1161842745 6 Left 1161842732 19:6692799-6692821 CCCAGCCCAATCTTTGCAAAGGG 0: 1
1: 0
2: 1
3: 6
4: 149
Right 1161842745 19:6692828-6692850 GCAGTGGGCACATGGAGGTGGGG 0: 1
1: 2
2: 3
3: 49
4: 400
1161842732_1161842740 -9 Left 1161842732 19:6692799-6692821 CCCAGCCCAATCTTTGCAAAGGG 0: 1
1: 0
2: 1
3: 6
4: 149
Right 1161842740 19:6692813-6692835 TGCAAAGGGAATTGGGCAGTGGG 0: 1
1: 0
2: 0
3: 22
4: 261
1161842732_1161842744 5 Left 1161842732 19:6692799-6692821 CCCAGCCCAATCTTTGCAAAGGG 0: 1
1: 0
2: 1
3: 6
4: 149
Right 1161842744 19:6692827-6692849 GGCAGTGGGCACATGGAGGTGGG 0: 1
1: 0
2: 4
3: 37
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161842732 Original CRISPR CCCTTTGCAAAGATTGGGCT GGG (reversed) Intronic
900928490 1:5720829-5720851 CCCTTTGGGAGGACTGGGCTAGG - Intergenic
904202866 1:28832847-28832869 CCCTTTGAAGACAATGGGCTAGG - Intronic
905792036 1:40794947-40794969 CTCTTTCCTAAGATTGGGTTGGG + Intronic
906636224 1:47412395-47412417 GCCTTTGCAGAGCTGGGGCTGGG + Intergenic
906786469 1:48620184-48620206 GACTTTGCAAAGATGGGGATGGG + Intronic
907127103 1:52060601-52060623 ACTTTTGCAAAGATTGTGTTGGG - Intronic
907359881 1:53905975-53905997 CCCTTGGCAATGATTTGGCCTGG - Intronic
908349392 1:63269689-63269711 CCCTTTGTAAATATTCTGCTTGG - Intergenic
913301731 1:117377651-117377673 CCCTTTGTATATATTGGGATGGG - Intronic
918303052 1:183221425-183221447 CCCTTTGAAAAGACTGGACCCGG + Intronic
919162897 1:193853952-193853974 CCCTTTGCAGAACTTGGGATTGG - Intergenic
920131488 1:203735496-203735518 CCCTTTGCAGAGGTCGGGGTGGG - Intronic
920192578 1:204202975-204202997 CCCATTGCAGAGATTGGTGTGGG - Exonic
924333557 1:242964687-242964709 CTCTTTGCCAAGCTTGTGCTTGG - Intergenic
1063006193 10:1972785-1972807 CCTCTTGGAAAGATTGGTCTAGG - Intergenic
1063078965 10:2746722-2746744 TCCCTTGCAAATATTGGGCCTGG + Intergenic
1063369370 10:5511306-5511328 CCCTTTGCAGAGAGAAGGCTTGG - Intergenic
1067849485 10:49745649-49745671 GCCTTTGCACAGATTGCTCTTGG + Intronic
1068308581 10:55248850-55248872 CACTTTGGAAAGAATTGGCTAGG - Intronic
1068731162 10:60359411-60359433 CTCTTTGCCAAAGTTGGGCTTGG - Intronic
1070652142 10:78245163-78245185 CCCTTTGCACCACTTGGGCTTGG + Intergenic
1079024703 11:16937288-16937310 CCATGTGCCAAGATTGTGCTGGG + Intronic
1079315452 11:19404160-19404182 CCCTTGGCAAAGATTATGCCAGG - Intronic
1079757598 11:24284251-24284273 TCCTTTGCTAACATTGGGGTTGG - Intergenic
1080052473 11:27871200-27871222 CACTTTGCAATGATTGCTCTGGG + Intergenic
1083181540 11:60988948-60988970 CTCTGTGCAAAGGCTGGGCTAGG - Intronic
1083236823 11:61356432-61356454 GCCTTTGTAAATGTTGGGCTTGG - Intronic
1085364821 11:75930073-75930095 TCATTTGCAAATATTGTGCTAGG + Intronic
1089238959 11:117058112-117058134 CCCTGTGCTAAGAATGAGCTTGG + Intronic
1090974512 11:131670237-131670259 CCTTTGGCAAAAAGTGGGCTCGG + Intronic
1091842942 12:3633556-3633578 CCCTTCCCAAAGATGGGCCTAGG + Intronic
1091856025 12:3741040-3741062 CCCTTTGCAAATATTTGCCTAGG - Intronic
1092961527 12:13601030-13601052 CACTTTGAAAGGATGGGGCTGGG + Intronic
1092975188 12:13737973-13737995 GACATTGCCAAGATTGGGCTCGG + Intronic
1095799481 12:46257278-46257300 CTCTTGGCTAAGAATGGGCTTGG - Intronic
1096050001 12:48599111-48599133 CCCATTGAAAATCTTGGGCTGGG - Intergenic
1098112567 12:67138852-67138874 CCCAGTGCTAACATTGGGCTGGG + Intergenic
1105281222 13:18963780-18963802 CCCTCTGCAGGGACTGGGCTGGG + Intergenic
1105600659 13:21884168-21884190 CCATCTGCACAGACTGGGCTAGG - Intergenic
1111233443 13:85375229-85375251 CCCTTTCTGAAGATTGGGATGGG - Intergenic
1113553260 13:111209862-111209884 CTCTTTGCAGACATCGGGCTGGG + Exonic
1114473476 14:22979373-22979395 CCCTGGGCAAAGACTGGGATGGG - Intronic
1118314554 14:64717664-64717686 CCCTTTGCAAGGGTTGGAATGGG + Intronic
1118448985 14:65880169-65880191 CACTTTGCAAAGCTTGTGCAGGG + Intergenic
1118592161 14:67410044-67410066 CCCTTGGAAAAGACGGGGCTTGG - Intronic
1118765022 14:68903903-68903925 TCCTTACCAAAGATTGGGCCTGG - Intronic
1119174585 14:72559844-72559866 CCCTTTCTACAGAATGGGCTGGG - Intronic
1121249995 14:92492390-92492412 CTCTTGGCAAAGACTGGACTTGG - Intronic
1121492073 14:94368128-94368150 CCGTTTGGACATATTGGGCTGGG + Intergenic
1124245271 15:28065117-28065139 CACTTTGCAAAGACTGGGAAAGG - Intronic
1126089723 15:45040818-45040840 TCCTTTTCAAAGTTTGGGTTAGG - Intronic
1127660917 15:61099309-61099331 CCCAGTGCAAAGTTTGGGCAAGG + Intronic
1128373638 15:67059649-67059671 CCCTATGCCAGGACTGGGCTTGG - Intergenic
1129959547 15:79671074-79671096 CCCTTTGCAAAGACATGGATGGG + Intergenic
1131146449 15:90016778-90016800 CCCTTTGCAGAGATGGGTCTAGG - Intronic
1131208688 15:90474266-90474288 CCCTTTGCTAACATGTGGCTAGG + Intronic
1131258957 15:90878743-90878765 CCCTGTGGACAGAGTGGGCTGGG - Exonic
1140503091 16:75451881-75451903 CCCTCTGCAATGATTGTCCTGGG - Intronic
1148219176 17:45850080-45850102 CCCATTTCACAGATGGGGCTGGG + Intergenic
1149919172 17:60640148-60640170 CCCTCTACAAAGAATTGGCTGGG + Intronic
1149999104 17:61421341-61421363 CCCATTGCACAGATGAGGCTTGG + Intergenic
1152013357 17:77734544-77734566 CCCTTTGCCAAGATCGGGAGAGG + Intergenic
1152014223 17:77739220-77739242 CCTTTTGCCAAGCTTAGGCTGGG - Intergenic
1152199300 17:78935851-78935873 ACCATTGCAAAGAGTGTGCTGGG + Intergenic
1153121458 18:1732391-1732413 CTATTTGCAAAGATTAGGGTGGG + Intergenic
1156901055 18:42300461-42300483 CCTTTTGCATAAATGGGGCTGGG + Intergenic
1158199478 18:54923992-54924014 CTCTTTATTAAGATTGGGCTAGG - Intronic
1161842732 19:6692799-6692821 CCCTTTGCAAAGATTGGGCTGGG - Intronic
1164403113 19:27916475-27916497 TCTTTTGCAAAGATGGGGATTGG + Intergenic
925119159 2:1403921-1403943 CCCTTGACAAAGCTTGGGATGGG + Intronic
925609560 2:5692215-5692237 TGCTTTGCAAAGATGGGGGTGGG - Intergenic
926143284 2:10381309-10381331 CCCTGTGCAGAGCTTTGGCTGGG - Intronic
928118683 2:28566230-28566252 CCCTTGGCACAGAATGGGGTGGG + Intronic
928511525 2:32008938-32008960 CCTTTTGCAAAGAATTGGCTTGG - Intronic
942416749 2:175767476-175767498 CCCTTTACCAAGAGTGGCCTTGG + Intergenic
945758345 2:213878880-213878902 CCCTTTTCAAAAATGGTGCTGGG - Intronic
946770812 2:223086464-223086486 CACTTTGCAGAGATGGAGCTGGG - Intronic
946910351 2:224454628-224454650 CACTTTGCAAAGCTCTGGCTGGG + Intergenic
947850890 2:233286923-233286945 CTCTTTACAATGTTTGGGCTTGG - Intronic
1168958489 20:1851437-1851459 TCCTTAGCAAAGAATGGGATGGG - Intergenic
1170088662 20:12566210-12566232 TCATTTGCAAATATTGGGGTGGG + Intergenic
1172313551 20:33936084-33936106 CCCTTTCCAAATATTGAACTTGG - Intergenic
1174553270 20:51376469-51376491 CCCTCTGTAAAGATGGAGCTGGG - Intergenic
1175342084 20:58238975-58238997 TCTTTTGCAAAGAGTGTGCTAGG + Intergenic
1175796118 20:61772059-61772081 CCCTATGCTAAGCATGGGCTGGG + Intronic
1176412348 21:6455865-6455887 CACTGAGCAAAGACTGGGCTGGG - Intergenic
1177817882 21:25998002-25998024 CCCTTTGATCAGTTTGGGCTGGG - Intronic
1179687842 21:43064187-43064209 CACTGAGCAAAGACTGGGCTGGG - Intronic
1180850415 22:19016499-19016521 TCCTATGCACAGACTGGGCTGGG + Intergenic
950298666 3:11854346-11854368 CCCCTTGAAGAGATTGGCCTAGG - Intergenic
950426002 3:12925029-12925051 CCTTGTACAAAGAATGGGCTGGG + Intronic
952321393 3:32281067-32281089 CCCCATGCAGAGATGGGGCTTGG - Intronic
956802305 3:72770926-72770948 CCCTGTGCAAAGATTGTGTCTGG + Intronic
957834954 3:85575254-85575276 CTCTTTAAAATGATTGGGCTGGG + Intronic
962287915 3:134103845-134103867 CACTTTGAAAAGATGGAGCTGGG - Intronic
962329539 3:134465049-134465071 CCCTCTGCAAAGCATGGTCTGGG - Intergenic
963690602 3:148496565-148496587 TGCTTTGCAAAGATTAGTCTAGG - Intergenic
967388026 3:188929421-188929443 CCCTGTGACATGATTGGGCTTGG - Intergenic
967766393 3:193284437-193284459 CCCTTTACATAAATTGTGCTAGG + Intronic
968079555 3:195836529-195836551 CCCTTTGCAAGGATTGTGTCTGG + Intergenic
968421935 4:492542-492564 CTCTTTCTAGAGATTGGGCTTGG - Intronic
976424817 4:84890398-84890420 TCCTTTTCAAAGCTTGGGCAAGG - Intronic
981864017 4:149392691-149392713 CCCTTGGCAAAGATTTGCCCTGG - Intergenic
982201745 4:152968244-152968266 TCCTCTGCAAAGAATGGGCATGG - Intronic
985514979 5:337749-337771 CCCTTCCCAAAGCTGGGGCTCGG + Intronic
986267193 5:6200986-6201008 CCCTTGCCAAAGATGGGACTGGG + Intergenic
986267708 5:6204614-6204636 CCCTTGCCAAAGATGGGACTGGG + Intergenic
986809549 5:11341188-11341210 CCTTTTTCAAAGAGTGGCCTTGG - Intronic
992623435 5:78615932-78615954 ACCTTTGCAAAGCTGGTGCTAGG + Intronic
994860334 5:105184765-105184787 CCCTATGTAAAGATGGTGCTGGG - Intergenic
999693670 5:154169984-154170006 TTCTTTGCCAAGACTGGGCTGGG - Intronic
1000352479 5:160362728-160362750 CCCAGTGCAATGACTGGGCTTGG + Intronic
1000435971 5:161209182-161209204 CACTTTGGAAAGACTGGGCTGGG - Intergenic
1000749522 5:165076269-165076291 CCCTTAGGCAAGATTGAGCTTGG + Intergenic
1002403460 5:179008498-179008520 CAGTTTGCAAATATTGGACTAGG - Intergenic
1002408653 5:179055781-179055803 CTCTTTGCAAAGACTGGGCTGGG + Intergenic
1002439260 5:179255910-179255932 CCCTTTGCACAGATGCTGCTGGG + Intronic
1003476795 6:6491156-6491178 ACCATTGCAAAGATTAGGCATGG - Intergenic
1005802939 6:29445513-29445535 CCCTGTGAAGAGATTGGCCTGGG - Intronic
1011317308 6:86050182-86050204 CCCTTTACAAAAAGTGGTCTTGG - Intergenic
1012106379 6:95165209-95165231 ATATTTGCTAAGATTGGGCTGGG - Intergenic
1012418328 6:99034341-99034363 CAGTTTGCAAAGATGTGGCTCGG - Intergenic
1015521795 6:134139113-134139135 CTATTTTAAAAGATTGGGCTGGG + Intergenic
1017106639 6:150894391-150894413 CCCTTGGCCAATATTCGGCTGGG - Intronic
1017277502 6:152587014-152587036 CCCTTTACAAAGATATGACTTGG - Intronic
1022661581 7:32372347-32372369 CCCTTGTCAAAAATTAGGCTGGG - Intergenic
1026332380 7:69363980-69364002 CCCTTTGAAAAGTCTGTGCTTGG + Intergenic
1029987377 7:104934524-104934546 CCCATTGGTAAGAATGGGCTAGG - Intergenic
1032854603 7:135823990-135824012 CCCTTTGCAAATGCTGAGCTGGG - Intergenic
1034559468 7:151870840-151870862 ACGTTTGCAGAGATGGGGCTGGG - Intronic
1040017796 8:42714012-42714034 CCATTTGCACAGATTGAGTTTGG + Intronic
1041638181 8:60167162-60167184 CCCTTTTCAAAAATGGTGCTGGG + Intergenic
1044961951 8:97539878-97539900 CAGTTTGCCAGGATTGGGCTGGG - Intergenic
1045020650 8:98040978-98041000 CCCTTTACAAAAACTGGGCCAGG + Intronic
1045320596 8:101079314-101079336 CCCCTTGCAAGGACTGGGCTGGG + Intergenic
1046459425 8:114514034-114514056 CCTTTTACAAATTTTGGGCTTGG - Intergenic
1047197728 8:122736553-122736575 TCCTTGGGAAAGATTGGGCTGGG + Intergenic
1048007780 8:130432840-130432862 CCCTTGGCAGTGATTGGGTTAGG - Intronic
1048194166 8:132318496-132318518 CCCTTTGCAAACACAGAGCTGGG - Intronic
1049553628 8:143271857-143271879 CGCTCTGCAAGGCTTGGGCTAGG - Intronic
1052749671 9:32476915-32476937 TTCATTGAAAAGATTGGGCTGGG - Intronic
1053426559 9:38014071-38014093 CGCTTTGCAAACTTTGGGGTGGG - Intronic
1055564849 9:77557994-77558016 CCATTTGTAAAAATGGGGCTGGG - Intronic
1056383733 9:86078550-86078572 TCCTTTGCTAGGACTGGGCTGGG + Intronic
1057271623 9:93654772-93654794 CCCTCTGCAGGGACTGGGCTGGG - Intronic
1057414703 9:94850831-94850853 TCCTTGCCAAAGATTGGGTTAGG + Intronic
1059416621 9:114166530-114166552 CCCCCTGCAAAGGTTGTGCTGGG - Intronic
1061037726 9:128122771-128122793 CCCTTGGCCAAGATGGGACTTGG - Intronic
1186675006 X:11807028-11807050 CCCTTTGGAAAGGTAGGTCTTGG + Intergenic
1190059848 X:47203577-47203599 AACTTTGCCATGATTGGGCTGGG + Exonic
1190339388 X:49284929-49284951 CCCTTTCAAAAGATGGAGCTAGG + Intronic
1191246176 X:58230026-58230048 CCCATTGCAATGCTTGGGGTCGG - Intergenic
1192117722 X:68427493-68427515 GGCTTTACAAAGATGGGGCTGGG - Intronic
1199850715 X:151723368-151723390 AACTTTGCAAAGCTGGGGCTGGG - Intergenic
1200058551 X:153473979-153474001 CCATCTGCAAGGATAGGGCTGGG - Intronic
1200302561 X:154992604-154992626 CCTTTTGCAAACTTTGAGCTAGG - Intronic
1202391245 Y:24372714-24372736 CTCTTTGCCAAGCTTGTGCTTGG + Intergenic